The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gobin, S. J. P.
Right arrow Articles by van den Elsen, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gobin, S. J. P.
Right arrow Articles by van den Elsen, P. J.
The Journal of Immunology, 2001, 167: 5175-5184.
Copyright © 2001 by The American Association of Immunologists

The MHC-Specific Enhanceosome and Its Role in MHC Class I and {beta}2-Microglobulin Gene Transactivation1

Sam J. P. Gobin2,*, Marlijn van Zutphen*, Sandy D. Westerheide{dagger}, Jeremy M. Boss{dagger} and Peter J. van den Elsen*

* Department of Immunohematology and Blood Transfusion, Leiden University Medical Center, Leiden, The Netherlands; and {dagger} Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA 30322


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The promoter regions of MHC class I and {beta}2-microglobulin ({beta}2m) genes posses a regulatory module consisting of S, X, and Y boxes, which is shared by MHC class II and its accessory genes. In this study we show that, similar to MHC class II, the SXY module in MHC class I and {beta}2m promoters is cooperatively bound by a multiprotein complex containing regulatory factor X, CREB/activating transcription factor, and nuclear factor Y. Together with the coactivator class II transactivator this multiprotein complex drives transactivation of these genes. In contrast to MHC class II, the multiprotein complex has an additional function in the constitutive transactivation of MHC class I and {beta}2m genes. The requirement for all transcription factors in the complex and correct spacing of the binding sites within the SXY regulatory module for complex formation and functioning of this multiprotein complex strongly suggests that this complex can be regarded as a bona fide enhanceosome. The general coactivators CREB binding protein, p300, general control nonderepressible-5, and p300/CREB binding protein-associated factor exert an ancillary function in MHC class I and {beta}2m transactivation, but exclusively through the class II transactivator component of this enhanceosome. Thus, the SXY module is the basis for a specific enhanceosome important for the constitutive and inducible transactivation of MHC class I and {beta}2m genes.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Tight control of MHC class I and II expression is crucial for an adequate immune response. The expression of MHC class II and functionally related genes (invariant chain, HLA-DM) is regulated by a group of conserved regulatory elements, referred to as the S, X (comprising the X1 and X2 sequences), and Y boxes (1, 2). Together these form a regulatory module, cooperatively bound by regulatory factor X (RFX), X2 box-binding protein (X2BP), and nuclear factor Y (NFY) to the X1, X2, and Y boxes, respectively. RFX is a trimer consisting of RFX5, RFX-associated protein (RFXAP), and RFXB/RFX containing three ankyrin repeats (RFXANK). X2BP is a complex of CREB/activating transcription factor (ATF)3 factors and NFY is a trimer consisting of the NFYa, NFYb, and NFYc subunits (1, 2). In vivo, the X1, X2, and Y boxes, but not the S box, are occupied. Although the S box appears to be important for MHC class II transactivation, its exact role in transactivation is not fully understood. MHC class II genes are fully dependent on the coactivator class II transactivator (CIITA) for their transactivation. This non-DNA binding protein requires the multiprotein complex consisting of RFX, CREB/ATF, and NFY, to drive MHC class II expression.

The SXY regulatory module was initially considered to be specific for MHC class II and functionally related genes. The recent discovery that the coactivator CIITA plays an important role in MHC class I expression was the first line of evidence to suggest a common pathway of transcriptional regulation of MHC class I and II genes (3, 4). Additional research has indicated that this pathway is not isolated and has revealed the existence of the SXY module also in the proximal promoter regions of MHC class I and {beta}2-microglobulin ({beta}2m) genes (5). Taking advantage of type III bare lymphocyte syndrome (BLS) patient cell lines, which are defective in subunits of the RFX complex, it was demonstrated that the SXY module in MHC class I and {beta}2m promoters mediates several transactivation pathways in which the RFX complex is pivotal; RFX regulates the constitutive expression and is crucial for CIITA-induced transactivation of MHC class I and {beta}2m genes (6).

There has been increasing evidence that the SXY module of MHC class I interacts with the same proteins as the SXY module of MHC class II. In MHC class I, the X1 box mediates transactivation by the RFX complex (6, 7), and is bound by the DNA-binding subunit RFX5 (6). The X2 box is bound by several members of the CREB/ATF family of transcription factors, including CREB1, cAMP response element modulator 1, and ATF1 (3, 6), and the Y box is bound by an NFY-like complex (8). Despite the functional importance in transactivation of the proteins acting through the SXY module of MHC class I and {beta}2m, the individual binding of these proteins to their target boxes has been variable and sometimes difficult to determine. This could be explained by the requirement for cooperative binding, which could compensate for low affinity protein/DNA interaction to the individual boxes due to locus-specific nucleotide variation, as is demonstrated for MHC class II genes (1, 2, 9, 10). Furthermore, the involvement of the coactivator CIITA lead to the hypothesis that all these proteins form a multiprotein complex that functions as an enhanceosome driving transactivation (6, 11).

In this study, we investigated the formation and composition of the multiprotein complex interacting with the SXY module in the promoters of MHC class I and {beta}2m and its role in gene activation. The requirement for all transcription factors in the complex and correct spacing of the binding sites within the regulatory module for complex formation and functioning of this multiprotein complex strongly suggests that this complex can be regarded as a bona fide enhanceosome. The presence of this regulatory module exclusively in MHC genes and the participation of MHC-specific transcription factors in this multiprotein complex determine the specificity of this enhanceosome for this family of molecules critical for Ag presentation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture

The cell lines used in this study were the Burkitt’s lymphoma B cell line Raji, the Raji derived CIITA-deficient cell line RJ225, the RFX5-deficient EBV-transformed B cell line SJO, the CIITA-deficient fibroblast cell line ATU (12), the RFXB/RFXANK-deficient fibroblast cell line EBA (7), the RFX5-deficient fibroblast cell line OSE (13), the RFXAP-deficient fibroblast cell line ABI (14), the teratocarcinoma cell line Tera-2, and the monkey fibroblast-like kidney cell line COS-1. These cell lines were grown in IMDM (Life Technologies, Paisley, Scotland) supplemented with 10% (v/v) heat-inactivated FCS (Life Technologies), penicillin (100 IU/ml), and streptomycin (100 µg/ml). Freshly isolated T cells from ATU (complementation group A; 12), EBA (group B; 7), OSE (group C; 13), and ABI (group D; 14) were cultured in the presence of PHA (10 µg/ml) and IL-2 (10 IU/ml) in RPMI 1640 medium (Life Technologies) supplemented with 10% human serum. Stable transfectant of the BLS-derived cell lines complemented with their missing factor were grown on medium with 40 mg/ml hygromycin (3, 6).

FACS analysis

T cells from BLS complementation groups A, B, C, and D, and T cells from the corresponding parents were stained by indirect immunofluorescence. MHC class I and MHC class II were detected with the mAbs W6/32 and B8.11.2, respectively. Cells were also stained with anti-CD3 (BD Biosciences, Woerden, The Netherlands) as control. FITC-conjugated anti-mouse IgG was used as second Ab. The acquisition was performed on a FACScan (BD Biosciences, Mountain View, CA), using a CellQuest program for analysis.

In vivo genomic footprinting (IVGF)

In vivo methylation, preparation of DNA, and ligation-mediated PCR for IVGF was performed as described by Mueller and Wold (15) with minor modifications (16). The promoter regions of {beta}2m and HLA-DRA were analyzed with the following sets of primers for the coding (C) strand (C1, C2, and C3) and the noncoding (NC) strand (NC1, NC2, and NC3): {beta}2m-C1, GCGAGCACAGCTAAGGCCA; {beta}2m-C2, GCGAGACATCTCGGCCCGAAT; {beta}2m-C3, TCTCGGCCCGAATGCTGTCAGC; {beta}2m-NC1, CTAGAATGAGCGCCCGGTGT; {beta}2m-NC2, CCGGAGGGCGCCGATGTA; {beta}2m-NC3, AGGGCGCCGATGTACAGACAGCAAACT; DRA-C1, CGCTCATCAGCACAGCTATGATG; DRA-C2, GCCATTTTCTTCTTGGGCGCTCT; DRA-C3, TCTTCTTGGGCGCTCTTTTGGGAGTCA, DRA-NC1, TCCATTGATTCTATTCTCACTAATGTGCTTC; DRA-NC2, TCCCTGTCTAGAAGTCAGATTGGGGTTAAAG; and DRA-NC3, CAGATTGGGGTTAAAGAGTCTGTCCGTGATTTGA.

Nuclear extracts

Crude and purified nuclear extracts were prepared from the Burkitt’s lymphoma B cell line Raji as described (9). Binding activity of the protein fractions was monitored by EMSA. The fractions containing RFX, CREB/ATF or both were selected for study. NFY co-eluted with RFX from the Hi-Trap Q column (Amersham Pharmacia Biotech, Piscataway, NJ).

EMSA

Protein binding reactions were performed essentially as described previously (9). Purified nuclear protein extract (1.25 µg) was incubated in protein/DNA binding buffer (12 mM HEPES (pH 7.9), 12% v/v glycerol, 0.3 mM DTT, 1 mM EDTA, 0.24 mM MgCl2, 0.1% v/v Nonidet P-40), with 100 ng poly(dI-dC), 100 ng sonicated herring sperm ssDNA, 50 ng methylated pBR322, 5 µg BSA, and 50,000 cpm 32P-radiolabeled probe for 30 min. Incubation of the protein/DNA reaction was performed on ice to favor RFX binding or at room temperature to favor CREB/ATF binding and multiprotein complex formation (9). The nucleotide sequence of the X (X1X2) and XY probes is: X-{beta}2m, GCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTG; X-B7, TGTCGGGTCCTTCTTCCAGGATACTCGTGACGCGTCCCCACTTCCCACTCCC; XY-{beta}2m, GCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTT; XY-B7, TGTCGGGTCCTTCTTCCAGGATACTCGTGACGCGTCCCCACTTCCCACTCCCATTGGGTATTGGATATCT; XY-A2, TGTAGGGTCCTTCTTCCTGGATACTCACGACGCGGACCCAGTTCTCACTCCCATTGGGTGTCGGGTTTCC; and XY-DRA, TTGCAAGAACCCTTCCCCTAGCAACAGATGCGTCATCTCAAAATATTTTTCTGATTGGCCAAAGAGTAATT.

The HLA-DRA X1X2, X1 (X1-{Delta}X2), X2 ({Delta}X1-X2) and Y probes that were used as competitor have been described previously (9). The samples were run on a 5% nondenaturing polyacrylamide gel (69:1) in 1x GTG buffer (0.5 mM EDTA; 90 mM Tris; 28.5 mM taurine) for 2 h, at 200 V and 4°C. For DNA competition assays, protein extracts were incubated with competitor DNA for 30 min. before adding radiolabeled probe. For the supershift assays, 1 µg of each Ab was added 30 min. after adding the probe and incubated for an additional 30 min. The RFX (anti-RFX5) and CREB (anti-CREB1) specific antisera have been previously described (9). The antisera against NFYa (200-401-100) and NF1 (sc-870x) were from Rockland (Gilbertsville, PA) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively.

Plasmids

Luciferase reporter plasmids used were generated by cloning genomic promoter fragments into pGL3-Basic (Promega, Madison, WI). These constructs contain, respectively, a 302-bp {beta}2m PCR-generated promoter fragment (pGL3-{beta}2m), a 228-bp BglI-AhaII HLA-A2 promoter fragment (pGL3-HLA-A), a 269-bp AspI-AhaII HLA-B7 promoter fragment (pGL3-HLA-B), a 281-bp HLA-Cw3 PCR-generated promoter fragment (pGL3-HLA-C),a 261-bp HLA-E PCR-generated promoter fragment (pGL3-HLA-E), a 265-bp HLA-F PCR-generated promoter fragment (pGL3-HLA-F),a 217-bp HLA-G PCR-generated promoter fragment (pGL3-HLA-G), a 690-bp TAP1/LMP2 PCR-generated promoter fragment (pGL3-TAP1), and a 594-bp TAP2 PCR-generated promoter fragment (pGL3-TAP2). The SV40 promoter-driven plasmid pGL3-control (Promega) was used as control.

The S, X1, X2, and Y box mutant promoter constructs of {beta}2m, HLA-B7, and HLA-A2, and the spacing mutant promoter constructs of {beta}2m and HLA-B7 were generated by overlap extension PCR (3). These mutant promoter constructs are identical to the wild-type constructs (pGL3-HLA-A, pGL3-HLA-B, and pGL3-{beta}2m) except for a 4- to 5-bp mutation in the core sequence of the individual boxes (6) or a 5- or 10-bp insertion (GATCG or GATCGATCGA) between the S and X or X and Y boxes. All plasmids were verified by sequence analysis (T7-polymerase sequence kit; Amersham, Little Chalfont, Buckinghamshire, U.K.).

The expression vector pREP4-CIITA is described previously (3). The PRc/RSV expression vectors containing CREB binding protein (CBP), p300, CREB1, and kCREB, a CREB variant that lacks the DNA-binding domain, were a kind gift of Dr. R. H. Goodman. The expression vectors pECE/RSV-ATF1, pRcRSV-hGCN5, and pCX-p300/CBP-associated factor (PCAF) were a kind gift of Dr. M. Green, Dr. S. Berger, and Dr. Y. Nakatani, respectively. The PCAF insert was cloned into pRc/RSV for transfection experiments. The expression vector pCMV-S12E1A and pCMV-S12E1A2-36 were a kind gift of Dr. T. Collins. The expression vectors pMT-protein kinase A (PKA) and pMT-PKAmut were a kind gift of Dr. S. McKnight.

The Renilla luciferase constructs pRL-SV40 (Promega) and pRL-actin were used as internal control for transfection efficiency. pRL-actin was generated by cloning a PCR-generated 1-kb human {beta}-actin promoter fragment into pRL-null (Promega).

Transient transfection

Adherent cells were transfected by the calcium phosphate coprecipitation method as described previously (6). In each of four wells of a six-well plate, 0.2 x 106 cells were transfected with a DNA mix containing 1 µg firefly luciferase pGL3 reporter plasmid and 0.2 µg Renilla luciferase pRL-SV40 control plasmid (Tera-2), or with 0.5 µg of pRSV-LacZ (COS-1). For cotransfection 0.5 µg of pREP4-CIITA, or 1 µg of Rc/RSV-CREB1, pRc/RSV-kCREB, pRc/RSV-ATF1, pMT-PKA, pMT-PKAmut, pRc/RSV-CBP, pRc/RSV-p300, pRc/RSV-GCN5, pRc/RSV-PCAF, pCMV-S12E1A, and pCMV-S12E1A2-36 was used.

Nonadherent cells (Raji, RJ225) were transfected by electroporation (3), with 10 µg firefly luciferase pGL3 reporter plasmid and 1 µg Renilla luciferase pRL-actin control plasmid. The SV40 promoter-driven pGL3 control plasmid (Promega) was used in the electroporation experiments as reference for promoter activity in the different cell lines.

To measure promoter activity, cells were harvested 3 days after calcium phosphate transfection or 2 days after electroporation. Luciferase activity was determined using the (dual)-luciferase reporter assay system (Promega) and a luminometer (Tropix, Badford, MA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
CIITA and RFX regulate MHC class I genes

The regulation of MHC class II gene transcription by CIITA has been well studied. Only recently, it has been shown that MHC class I and {beta}2m genes are also regulated by CIITA (3, 4). These genes share a regulatory module in their promoter consisting of S, X (comprising X1 and X2 halves), and Y boxes, in which X1 is an RFX binding site, X2 a CREB/ATF binding site and Y an NFY binding site. The SXY regulatory module shows considerable sequence homology and conserved spacing between the S and X boxes and the X and Y boxes among the various MHC class I and class II genes. Despite this general conservation, nucleotide variation within the boxes of the different loci of MHC class I and class II genes are noted which could influence protein binding and transactivation by CIITA.

In contrast to MHC class II promoters, MHC class I and {beta}2m promoters contain additional regulatory elements, such as an IFN-stimulated response element (ISRE) and {kappa}B binding sites. These regulatory elements (positioned upstream of the SXY module) are the mediators of alternative transactivation routes that provide for the constitutive and inducible MHC class I expression (17, 18).

There are several lines of evidence in support for a physiologically important role of CIITA and RFX in MHC class I expression. This is evident in cell material from BLS patients, which have a gene defect in either CIITA (complementation group A), RFXB/RFXANK (group B), RFX5 (group C), or RFXAP (group D). Activated T cells lacking either CIITA, RFXB/RFXANK, RFX5, or RFXAP displayed a significant reduction in the level of MHC class I expression at the cell surface (Fig. 1GoA). Because MHC class II promoters do not have any additional regulatory element, they have become fully dependent on the SXY module for their transactivation and, therefore, MHC class II is not expressed in these activated BLS-derived T cells (Fig. 1GoA). Further support for a physiological role of CIITA in MHC class I expression comes from promoter activation studies in CIITA-deficient RJ225 cells. MHC class I and {beta}2m promoter activity was significantly reduced compared with CIITA expressing parental Raji cells, whereas the promoter activity of TAP1 and TAP2 was not compromised by the lack of CIITA (Fig. 1GoB). The residual MHC class I and {beta}2m promoter activity is due to other regulatory elements (such as {kappa}B and ISRE boxes) providing alternative transactivation pathways. Next, taking advantage of BLS derivedfibroblast cell lines, expression of exogenous CIITA in CIITA-deficient fibroblast cells resulted in an elevated MHC class I cell surface expression (Fig. 1GoC). Similarly, expression of exogenous RFX5 or RFXAP in RFX5- or RFXAP-deficient fibroblasts also resulted in an increase of MHC class I cell surface expression (Fig. 1GoC). Notably, complementation with the RFX subunits also lead to an enhanced endogenous MHC class I and {beta}2m genes transcript levels (6). Together, these results show that CIITA and RFX have a physiological role in MHC class I and {beta}2m transactivation and expression. In addition, we evaluated transactivation of the different MHC class I loci by CIITA, because the SXY regulatory module is conserved in most MHC class I promoters (with the exception of the HLA-G promoter). As illustrated in Fig. 1GoD, CIITA was able to activate the promoters of the HLA-A, HLA-B, HLA-C, HLA-E, and HLA-F genes and not the promoters of HLA-G in Tera-2 cells. The MHC class I L chain {beta}2m was also induced by CIITA, albeit to a lesser extent. The promoter activity of the MHC class I accessory genes TAP1 and TAP2 was unaffected by CIITA (Fig. 1GoD; Refs. 3 and 4). Thus all MHC class I H chains (except HLA-G) and the class I L chain {beta}2m are transcriptionally controlled by CIITA.



View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 1. CIITA and RFX are important in the transactivation of MHC class I and {beta}2m genes. A, FACS analysis showing a reduced MHC class I cell surface expression on PHA/IL-2 stimulated T cells from BLS patients deficient in CIITA, RFXB/RFXANK, RFX5, or RFXAP (dotted line). Activated T cells from their respective parents served as controls (solid line). Note that the level of CD3 was unaffected in activated BLS-derived T cells. B, Transient transfection assay of MHC class I promoter-driven luciferase constructs (10 µg/106 cells) in Raji and CIITA-deficient RJ225 cells showing the reduced promoter activity of HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, and {beta}2m. TAP1 and TAP2 promoter activity was not compromised by the CIITA deficiency in RJ225. The percentage of promoter activity in RJ225 compared with Raji is indicated on the right. The SV40 promoter-driven luciferase vector pGL3-control (Control) served as positive control. Cotransfected pRL-actin was used as control for transfection efficiency. Normalized luciferase activity values are expressed as mean ± SD of n = 4. C, Reduced MHC class I expression in fibroblast cell lines. FACS analysis showing reduced MHC class I cell surface expression on fibroblast cell lines from BLS patients deficient in CIITA, RFX5, or RFXAP (thin line, open profile) which was restored in complemented fibroblast cell lines (bold line, shaded). D, Transient cotransfection assay of MHC class I promoter-driven luciferase constructs (1 µg/well) with empty pREP4 vector or pREP4-CIITA (0.5 µg/well) in Tera-2 cells. HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, and {beta}2m are induced by CIITA, whereas HLA-G, TAP1, and TAP2 were unaffected by CIITA induction. Cotransfected pRL-SV40 plasmid was used as control for transfection efficiency. Normalized luciferase activity values are expressed as mean ± SD of n = 4.

 
In contrast to MHC class II gene transactivation, little is known about the role of the regulatory elements of the SXY module and their interacting proteins in the CIITA route of transactivation for {beta}2m and MHC class I genes. Therefore, we embarked on the characterization and functioning of the SXY module of {beta}2m and MHC class I genes.

The X1, X2, and Y boxes and their stereospecific alignment are important for CIITA-induced transactivation of {beta}2m and MHC class I genes

To investigate the importance of the S, X1, X2, and Y boxes in CIITA-induced transactivation of {beta}2m and MHC class I genes, we tested promoter activation in transient transfection assays using promoter constructs with mutations in either the S, X1, X2, or Y box. These reporter assays showed that mutation of the X1, X2, or Y box strongly reduced or even abolished CIITA-induced transactivation of {beta}2m and MHC class I, whereas mutation of the S box had relatively little effect on CIITA-induced transactivation (Fig. 2GoA). These results show that the X1, X2, and Y boxes are each crucial in the CIITA-induced transactivation of MHC class I and {beta}2m, and that the S box is not critical for this route of transactivation. This strongly indicates that the factors binding these boxes jointly provide a platform for CIITA transactivation.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 2. CIITA-induced transactivation is dependent on the X1, X2, and Y boxes and on proper spacing and alignment of the X and Y boxes. A, Transient cotransfection assay of wild-type and S, X1, X2, or Y box mutated {beta}2m and HLA-B7 promoter-driven luciferase reporter constructs (1 µg/well) with empty pREP4 vector or pREP4-CIITA (0.5 µg/well) in Tera-2 cells. Similar results were obtained with HLA-A2 promoter-driven constructs. B, Transient cotransfection assay of wild-type and S5X, X5Y, or X10Y spacing mutants of {beta}2m and HLA-B7 promoter-driven luciferase reporter constructs (0.5 µg/well) with empty pREP4 vector or pREP4-CIITA (0.5 µg/well) in Tera-2 cells. Normalized luciferase activity values are expressed as mean ± SD of n = 4.

 
The spacing between the boxes of the SXY regulatory module of MHC genes is highly conserved, in particular between the X and Y boxes (5, 6). To investigate the importance of the spacing between the S and X and the X and Y boxes on CIITA-induced transactivation of {beta}2m and MHC class I, we tested promoter constructs in which an additional 5 or 10 nucleotides introduced a half or full helical turn between the boxes in transient transfection assays. These reporter assays showed that insertion of a half helical turn between the S and X boxes, thereby changing the spacing and the alignment of the boxes, had no significant effect on the CIITA-induced transactivation of the {beta}2m and MHC class I promoters (Fig. 2GoB). However, insertion of a half-helical turn between the X and Y box, abolished ({beta}2m) or reduced (MHC class I) CIITA-induced transactivation (Fig. 2GoB). Using promoter constructs in which an additional 10 nucleotides introduced one helical turn between the X and Y boxes, thereby changing spacing but conserving the box alignment, had little effect on MHC class I induction by CIITA, whereas it still affected the CIITA-mediated induction of {beta}2m (Fig. 2GoB). These results indicate that the X-Y spacing and box alignment, but not the S-X spacing and alignment, is crucial for CIITA-induced transactivation of {beta}2m and MHC class I genes. This further argues that the factors binding these boxes form a cooperatively functioning multiprotein complex to mediate CIITA transactivation.

Formation of a multiprotein complex on the SXY module of {beta}2m and MHC class I genes

Previously, we demonstrated the in vitro binding of CREB/ATF proteins to a probe encompassing the X1X2 region of MHC class I, but not to the X1X2 probe of {beta}2m (3, 6, 19). Furthermore, the binding of RFX to the X1X2 probe of {beta}2m and MHC class I was difficult to demonstrate in this experimental set-up, despite a clear role for RFX in MHC class I and {beta}2m transactivation (6). Even using purified nuclear extracts and experimental conditions favoring either RFX or CREB/ATF binding (see experimental procedures) it was difficult to establish a strong binding of RFX (and CREB/ATF) to the X-probe encompassing the X1X2 region of both {beta}2m and MHC class I (Fig. 3Go, A and B). This prompted us to use probes including the Y box and experimental conditions that were known to favor multiprotein complex formation on XY DNA of HLA-DRA (9). Using purified nuclear extracts and XY probes encompassing the X1, X2, and Y boxes of {beta}2m and MHC class I, a slow migrating complex was formed (Fig. 3GoC), similar to that observed with the XY probe of HLA-DRA (data not shown). The specificity of the complex was determined by competition with cold probes containing the different boxes of HLA-DRA. This higher order complex was not formed when competitor DNA encoding the X1X2, X2 ({Delta}X1-X2), X1 (X1-{Delta}X2), or Y box sequences of HLA-DRA was added (Fig. 3GoC), illustrated by an increase of free DNA probe and little or no protein/DNA complexes. This strongly suggests that the higher order complex was only formed when all the protein components and X1, X2, and Y boxes were present and that the build up is similar to HLA-DRA. Supershift analysis revealed the presence of RFX, CREB/ATF, and NFY in the higher order complex (Fig. 3GoC), demonstrating that the {beta}2m and MHC class I XY DNA/multiprotein complex resembles that of MHC class II (HLA-DRA). Similar results were obtained when using the XY probe of HLA-A (data not shown). Because in these binding studies multiprotein complex formation was found even in the absence of the S box, it can be deduced that the presence of the S box is not critical for complex formation in vitro.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 3. Complex formation of RFX, CREB/ATF, and NFY on the XY sequence of {beta}2m and MHC class I. A, EMSA showing binding of RFX to the X probe (comprising the X1X2 region) of {beta}2m and HLA-B7. RFX binding was competed with cold X1 and X2 box probes and was supershifted with the anti-RFX5 Ab. B, EMSA showing binding of CREB to the X probe of {beta}2m and HLA-B7. CREB binding was competed with cold X1 and X2 box probes and supershifted with the anti-CREB1 Ab. C, EMSA showing complex formation on the XY probe of {beta}2m and HLA-B7. Complex formation was competed with cold X1X2, X2, X1, and Y box sequences of HLA-DRA. The complex was shown to contain RFX, CREB/ATF, and NFY using specific Abs (anti-RFX5, anti-CREB1, and anti-NFYa). Supershifted complexes are indicated by an arrow; and free probe by an asterisk. Similar results were obtained with X and XY probes of HLA-A2 and HLA-DRA.

 
RFX determines in vivo occupancy of the SXY module in MHC class I and {beta}2m gene promoters

To investigate in vivo promoter occupancy of this regulatory region, we have chosen the nonpolymorphic gene {beta}2m to perform an IVGF assay. In the B cell line Raji, the X1, X2, and Y boxes of {beta}2m were occupied (Fig. 4Go) similar to the occupancy pattern of the HLA-DRA promoter (data not shown). The lack of in vivo protein binding to the S box in the {beta}2m promoter suggests that the S box is not an important protein-binding element. To investigate whether RFX is crucial for protein complex formation and occupancy of this region, we took advantage of the RFX5-deficient B cell line SJO (BLS group C). In the absence of RFX5, no occupancy of the X1X2 box region of {beta}2m was observed (Fig. 4Go). Interestingly, the Y box of {beta}2m remained still occupied, in contrast to the lack of Y box occupation on the DRA promoter in RFX-deficient BLS patients (data not shown; Ref. 20). In addition, complementation of SJO with RFX5 re-established in vivo occupancy of the X1X2 region similar to that of control B cells (Raji). Because the lack of one RFX subunit, in this case RFX5, influences promoter occupancy of the X1X2 region of {beta}2m, this strongly indicates the importance of RFX for recruitment of CREB/ATF and cooperative protein complex assembly on the SXY module.



View larger version (112K):
[in this window]
[in a new window]
  		FIGURE 4. RFX5 determines the in vivo occupancy of the SXY module of the {beta}2m promoter. A, IVGF showing the in vivo occupancy of the SXY region in the Burkitt’s lymphoma Raji but not in the RFX5-deficient B cell line SJO. RFX5 transfection in SJO restores the occupation. Note that the S box was not occupied. The Y box was always occupied independent of the presence of RFX5. In vitro methylated DNA of Raji is used as reference. Arrows indicate position of occupancy, open arrows indicate hypermethylation. B, Nucleotide sequence of the proximal promoter region of {beta}2m and position of occupied sites. Bullets indicate position of occupancy, open bullets indicate hypermethylation.

 
Contribution of RFX and CREB/ATF to constitutive and CIITA-induced {beta}2m and MHC class I transactivation

To determine the interdependency of the CIITA and the RFX transcription factors for {beta}2m and MHC class I transactivation, we performed transient transfection experiments in BLS-derived fibroblast cell lines. CIITA was only able to induce {beta}2m and MHC class I promoter activity when BLS cell lines were complemented for the missing RFX subunit (Fig. 5Go). In the RFXB-deficient cell line, the MHC class I promoter could be weakly induced by CIITA (Fig. 5Go). This demonstrates the requirement of each of the RFX subunits for the CIITA route of transactivation. It is of note that RFX also contributed to the basal level of {beta}2m and MHC class I promoter activity. The CIITA-independent activation by RFX is not observed for MHC class II promoters (data not shown; Ref. 6). Previously it has been shown that the X2 box binding protein complex of MHC class I contains CREB/ATF factors such as CREB1, cAMP response element modulator 1, and ATF1 (6, 19). To test whether CREB1 and ATF1 are important for the CIITA-induced MHC class I and {beta}2m gene transcription, transient cotransfection experiments were performed. It was shown that expression of exogenous CREB1 enhanced the CIITA-induced transactivation of {beta}2m and MHC class I (Fig. 6GoA). Similarly, ATF1 lead to an enhanced CIITA-induced transactivation of {beta}2m and MHC class I (Fig. 6GoA). This demonstrates that CREB1 and ATF1 are functional partners of the CIITA route of transactivation. It is of interest to note that both CREB1 and ATF1 also enhanced the basal level of {beta}2m and MHC class I transactivation (Fig. 6GoA).



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 5. CIITA-induced transactivation is dependent on the presence of the RFX complex. Transient cotransfection assay of {beta}2m and HLA-B7 promoter-driven luciferase reporter constructs (1 µg/well) with pREP4-RFXB, pREP4-RFX5, pREP4-RFXAP (1 µg/well), and/or pREP4-CIITA (0.5 µg/well) in BLS fibroblast cells of complementation group A, B, C, and D. Normalized luciferase activity values are expressed as mean ± SD of n = 4.

 


View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 6. CREB1 and ATF1 are partners in the CIITA-induced transactivation of {beta}2m and MHC class I. A, Transient cotransfection assay of {beta}2m and HLA-B7 promoter-driven luciferase reporter constructs (1 µg/well) with pRc/RSV-CREB1, pRc/RSV-ATF1 (1 µg/well), and/or pREP4-CIITA (CIITA; 0.5 µg/well) in Tera-2 cells. B, The non-DNA binding CREB mutant kCREB helps in the CIITA-induced transactivation of {beta}2m and MHC class I. Transient cotransfection assay of {beta}2m and HLA-B7 promoter-driven luciferase reporter constructs with pRc/RSV-CREB1 (1 µg/well) or pRc/RSV-kCREB (1 µg/well) in combination with pREP4-CIITA (0.5 µg/well) in Tera-2 cells. Normalized luciferase activity values are expressed as mean ± SD of n = 4.

 
Additional experiments were performed with kCREB, a variant of CREB that is mutated in its DNA binding domain. Interestingly, cotransfection with kCREB did not prevent but rather enhanced the level of transactivation of {beta}2m and MHC class I by CIITA, whereas the constitutive level of transactivation was unaffected (Fig. 6GoB). This could indicate that, in the presence of redundant CIITA, kCREB can still be part of the multiprotein complex, which as a whole is still functional. Together, this argues for a role of RFX and CREB/ATF in both the constitutive and CIITA-induced transactivation of {beta}2m and MHC class I genes.

General coactivators enhance the CIITA-induced transactivation of MHC class I and {beta}2m

Although it is evident that for transactivation of MHC class I and {beta}2m the formation of the multiprotein/DNA complex is essential for CIITA mediated transactivation, none of the proteins in this complex (i.e., RFX, CREB/ATF, NFY, and CIITA) are known to posses histone acetyltransferase properties. To investigate whether general coactivators are involved which could fulfil this function, we first tested for the role of CBP in {beta}2m and MHC class I transactivation. In transient cotransfection experiments, the general coactivator CBP was shown to further enhance the CIITA-induced transactivation of {beta}2m and MHC class I (Fig. 7GoA). The specificity of the enhanced transactivation by CBP was determined by cotransfection of the early adenovirus S12E1A protein and a functionally nonactive S12E1A mutant. Cotransfection of S12E1A blocked the enhanced transactivation by CBP, whereas cotransfection of the S12E1A mutant had little or no effect (data not shown). Similarly, p300, GCN5, and PCAF further enhanced transactivation by CIITA (Fig. 7GoB). It is remarkable that CBP (and the other coactivators) could not transactivate {beta}2m and MHC class I in the absence of CIITA (Fig. 7Go, A and B), because the X2 box-binding CREB/ATF complex is a potential target for CBP recruitment.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 7. General coactivators CBP, p300, GCN5, and PCAF enhance the CIITA-induced transactivation of {beta}2m and MHC class I. A, Transient cotransfection assay of {beta}2m and HLA-B7 promoter-driven luciferase reporter constructs with pRc/RSV-CBP (1 µg/well) and/or pREP4-CIITA (0.25 µg/well) in Tera-2 cells. Similar results were obtained with HLA-A2 and HLA-DRA promoter-driven luciferase reporter constructs and in COS-1 cells (data not shown). B, Transient cotransfection assay of HLA-B7 promoter-driven luciferase reporter constructs with pRc/RSV-p300, pRc/RSV-GCN5, and pRc/RSV-PCAF (1 µg/well) in combination with pREP4-CIITA (0.25 µg/well) in Tera-2 cells. Normalized luciferase activity values are expressed as mean ± SD of n = 4.

 
To test whether the lack of CBP-induced transactivation was caused by a lack of phosphorylation of CREB, we performed additional cotransfection experiments with cAMP-dependent PKA and its functionally inactive mutant, PKAmut. Even after phosphorylation by PKA, CBP was not able to transactivate {beta}2m and MHC class I in the absence of CIITA (data not shown). This implied that CBP and other coactivators act exclusively through CIITA of the multiprotein complex.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The existence of a common promoter module (the SXY module) in MHC and functionally related genes has suggested a joint regulation pathway of these genes (5). CIITA regulates all MHC class I and Ib loci (except HLA-G) and {beta}2m in addition to all isotypes and accessory genes involved in MHC class II Ag presentation (Fig. 1Go). Therefore, the SXY module is the basis for the CIITA route of transactivation of this large family of closely related genes.

The SXY regulatory module shows considerable sequence homology and conserved spacing between the S and X boxes and the X and Y boxes among the MHC class I, class II and accessory genes. The conservation of the nucleotide sequence and spatial requirement of the X and Y boxes together with the mutual dependency of the individual proteins for assembly and transactivation in {beta}2m and class I genes argues that the multiprotein complex of RFX, CREB/ATF, NFY, and CIITA functions as an enhanceosome (11). It is shown that the X1, X2, and Y boxes of the SXY module in {beta}2m and MHC class I genes are crucial for CIITA-induced transactivation. In addition, a conserved spacing and alignment of the X and Y boxes is required for optimal CIITA-induced transactivation. This is particularly clear in the transactivation of the {beta}2m promoter. Similar to MHC class II promoters, XY DNA is cooperatively bound by a multiprotein complex, consisting of RFX, CREB/ATF, and NFY. IVGF studies revealed that occupancy of the X1 and X2 boxes of the {beta}2m promoter in RFX5-deficient cells can be restored by functional complementation. This strongly suggest that the other RFX subunits and CREB/ATF are recruited by RFX5 binding to the SXY module.

Multiprotein complex formation on XY DNA can still be accomplished despite an apparent weak binding of the individual proteins to their respective binding sites, as is known from studies on MHC class II promoters (9, 10). This is illustrated by cotransfection of CIITA with kCREB, a CREB variant that lacks its DNA binding domain, which still amplified, albeit less than wild-type CREB, the CIITA-induced transactivation of {beta}2m and MHC class I (see Fig. 6GoB). A possible explanation is that kCREB dimerizes with other CREB/ATF proteins and is as such incorporated into the multiprotein complex. Because there is no absolute requirement for strong DNA binding affinity of the individual proteins to their respective binding sites, in particular to the X2 box, it appears to be the DNA binding affinity of the complex as a whole, which determines the ability of the multiprotein complex to transactivate (this study; Ref. 9). Therefore, it can be envisaged that there exists a certain tolerance for weak protein/DNA interactions in multiprotein complex functioning and CIITA-induced transactivation. This would imply that proteins with minor mutations could still be functional within the multiprotein complex and that minor MHC class I locus-specific nucleotide variation in the regulatory elements of the SXY module is tolerated.

The Y box is perhaps the most important "anchor" point and its protein/DNA interactions are the most stringent. In line with the importance of the Y box is the fact that of all boxes of the SXY module, the Y box-region in MHC class I and {beta}2m promoters displays the highest nucleotide conservation (5) and appears to be constitutively occupied in vivo even in the absence of RFX5 (Fig. 4Go). Moreover, individuals with a mutation in the Y box have a greatly reduced level of constitutive MHC class I expression (21, 22). Recent studies demonstrated that the NFY complex, which is an integral part of the multiprotein complex, is able to interact with and disrupt nucleosomes (23). It is proposed that the histone-like structures in the NFY components are essential for this function. In addition, DNA bending studies strongly suggest a major role for NFY in promoter architecture (23). Furthermore, it has been shown that NFY increases the affinity for other transcription factors to their, sometimes poor, binding sites. As such, NFY could fulfil an essential role in chromatin remodeling (23). Together, this argues for an essential role of NFY in multiprotein complex assembly and functioning, rendering the Y box an important anchor point of the XY module, as has been suggested for MHC class II (24, 25).

No evidence was found for a direct role of the S box in the CIITA route of {beta}2m and MHC class I transactivation, neither for multiprotein complex formation nor for promoter occupancy ( Figs. 2–4GoGoGo). Therefore, it is possible that the S box does not act as a genuine transcription factor-binding site, but rather plays a role in promoter architecture. The lack of occupancy of the S box in MHC class II would also suggest a minor role of the S box in the transcriptional control of MHC class II genes (this study; Refs. 16 and 20). However, other studies have shown that the S box could play a role in the CIITA-mediated route of transactivation through the SXY module (26, 27, 28), which may reflect a different role of the S box in transactivation of {beta}2m and MHC class I, vs MHC class II genes.

The importance of CIITA in MHC expression is of a different nature in MHC class I and class II expression. This is most evident in lymphoid cells, which constitutively express CIITA. In this type of cells, the absence of CIITA results in a reduced MHC class I cell surface expression, whereas MHC class II is absent. The residual MHC class I expression is due to the fact that MHC class I genes possess additional upstream regulatory elements ({kappa}B site, ISRE), which provide for alternative transactivation pathways that can compensate for the lack of CIITA-induced expression. This is in contrast to MHC class II genes, which (with the exception of the invariant chain) only posses an SXY module and, therefore, fully are dependent on CIITA. As a result of these compensatory pathways of {beta}2m and MHC class I transactivation, the absence of CIITA only results in a reduction of MHC class I cell surface expression in activated T cells (Fig. 1GoA), whereas MHC class II expression is absent. In EBV-transformed B cells, the upstream regulatory elements provide for a more full compensation of a CIITA-deficiency, due to the (EBV-related) high expression of NF-{kappa}B and IFN-regulatory factors. Therefore, CIITA-deficient EBV-transformed B cells, displayed in general only a lack of MHC class II expression, and no change in MHC class I expression at the cell surface (data not shown), despite the fact that promoter activity of {beta}2m and MHC class I was reduced (Fig. 1GoB). In EBV-transformed B cell lines, a similar compensation is observed of the expression of the invariant chain. Because the invariant chain contains also additional regulatory elements in its promoter (29), they may provide for alternative transactivation pathways resulting reduced promoter activity and in only a marginal reduction of invariant chain expression in CIITA-deficient (EBV+) B cells (S. J. P. Gobin, P. Biesta, and P. J. Van den Elsen, unpublished observations; Ref. 20). The role of RFX in {beta}2m and MHC class I transactivation is bipartite; RFX (as part of the multiprotein complex) is the mediator for transactivation by CIITA and it is a mediator for constitutive expression. The importance in the CIITA route of transactivation is best illustrated in CIITA expressing T cells that are deficient in the RFX subunits RFXB/RFXANK, RFX5, or RFXAP. In these activated BLS-derived T cells the deficiency in RFX, which abrogates the transactivation by CIITA, resulted in a reduced MHC class I cell surface expression congruent with a lack of MHC class II expression (Fig. 1GoA). Furthermore, both RFX and CREB/ATF contribute also to the constitutive expression of {beta}2m and MHC class I genes (Figs. 5Go and 6Go). This second role for RFX is revealed in nonlymphoid cells, which only express CIITA upon induction by IFN-{gamma}. BLS-derived fibroblasts deficient in one of the RFX subunits display a reduced MHC class I expression, which can be restored by complementation with the missing RFX subunit (6). This role in the constitutive expression of MHC class I is most probably related to the upstream cluster of regulatory elements in {beta}2m and MHC class I genes, because neither RFX nor CREB could induce MHC class I promoter constructs lacking the upstream promoter elements (S. J. P. Gobin, M. Van Zutphen, and P. J. Van den Elsen, unpublished observations). Thus, CIITA provides for an ancillary route in {beta}2m and MHC class I gene transactivation and requires the RFX-CREB/ATF-NFY complex. Of this multiprotein complex, RFX and CREB have a dual function; they have an ancillary function in the constitutive {beta}2m and MHC class I activation driven by the upstream regulatory elements, and provide, as part of the RFX-CREB/ATF-NFY complex, the platform for CIITA transactivation.

For {beta}2m and MHC class I, the multiprotein complex is crucial for CIITA-induced transactivation and is likely to have a similar build up as for MHC class II genes. Recent studies have revealed many aspect of the assembly of the RFX-CREB/ATF-NFY multiprotein complex on SXY DNA and interactions with CIITA (25, 26, 28, 30, 31, 32). In addition, CIITA can form a link to the basal transcription initiation complex by interaction with its components (29, 33, 34, 35). Together, this has lead to view this multiprotein complex as an enhanceosome (11, 32).

Histone acetylation is proposed to be an important mechanism to facilitate the recruitment of the basal transcription initiation complex and binding of transcription factors to upstream regulatory elements; histone hyperacetylation is associated with transcriptional activity and hypoacetylation with transcriptionally silent chromatin (36). None of the proteins in the MHC-specific multiprotein complex (i.e., RFX, CREB/ATF, NFY, or CIITA) are known to possess histone acetyltransferase properties. It can be envisaged that the enhanceosome, to fulfil these functions, requires histone acetyltransferases, such as the coactivators CBP, p300, GCN5, and PCAF (36). Recently, functional interactions of CIITA with CBP, and of NFY with p300, GCN5, and PCAF have been demonstrated (23, 37, 38), which all have intrinsic histone acetylation activity.

Here it is shown that CBP, p300, GCN5, and PCAF all enhance the CIITA-induced transactivation of {beta}2m and MHC class I. Moreover, although CBP is a classic coactivator of CREB, in this experimental set-up CBP could not transactivate {beta}2m and MHC class I genes in the absence of CIITA. Similarly, p300, GCN5 and PCAF exerted their ancillary function in {beta}2m and MHC class I transactivation exclusively through CIITA. This shows that CIITA is the principal mediator for general coactivator activity. It is not clear why these coactivators could not transactivate {beta}2m and MHC class I genes in the absence of CIITA. However, this could be explained by a recent report that the acetylation of CIITA by PCAF induces its nuclear accumulation and consecutive transactivation activity (39). This would imply that the enhanceosome is for its function dependent on CIITA acetylation by general coactivators, but does not require the recruitment of the acetyltransferases to the protein/DNA complex. Still, it is possible that coactivators are recruited to the enhanceosome and form together with CIITA a link with the basal transcription initiation complex.

In conclusion, in this study we show that the SXY module is the basis for a cooperatively functioning multiprotein complex that controls MHC class I and {beta}2m, which is similar to that of MHC class II and its accessory genes. Because of the spatial constraints for the regulatory elements and the cooperative acting protein/DNA it can be viewed as an MHC-specific enhanceosome (11). Although several components (CREB/ATF and NFY) of this enhanceosome are implied in the transactivation of many other genes (23, 40), other components (RFX and CIITA) are, until now, only known to be directly involved in transactivation of MHC and accessory genes. Thus, the specificity of this enhanceosome is determined by the unique composition of the SXY module as well as the unique components and assembly of the multiprotein complex.


   Acknowledgments
 
We thank Dr. S. Berger, Dr. M. Green, Dr. T. Kouzarides, Dr. Y. Nakatani, Dr. S. McKnight, Dr. R. Goodman, and Dr. T. Collins for providingreagents. We also thank M. van Eggermond for excellent technical assistance, and Dr. N. van der Stoep and Dr. J. P. Medema for critically reading the manuscript.


   Footnotes
 
1 This work was supported by The Netherlands Foundation for the Support of Multiple Sclerosis Research (96-248 MS) and the Dr. Gisela Thier Foundation (to P.J.v.d.E.), and National Institutes of Health Grants AI34000 and GM47310 (to J.M.B.). S.J.P.G. is a fellow of the Royal Netherlands Academy of Arts and Sciences. Back

2 Address correspondence and reprint requests to Dr. Sam J. P. Gobin, Department of Immunohematology and Blood Transfusion, Leiden University Medical Center, Building 1, E3-Q, Albinusdreef 2, 2333 ZA Leiden, The Netherlands. E-mail address: gobin{at}LUMC.nl Back

3 Abbreviations used in this paper: ATF, activating transcription factor, {beta}2m, {beta}2-microglobulin; BLS, bare lymphocyte syndrome; CBP, CREB binding protein;CIITA, class II transactivator; ISRE, IFN-stimulated response element; PCAF, p300/CBP-associated factor; PKA, protein kinase A; IVGF, in vivo genomic footprinting; C, coding; NC, noncoding; RFX, regulatory factor X; X2BP, X2 box-binding protein; NFY, nuclear factor Y; RFXAP, RFX-associated protein; RFXANK, RFX containing three ankyrin repeats. Back

Received for publication November 1, 2000. Accepted for publication September 4, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Reith, W., B. Mach. 2001. The bare lymphocyte syndrome and the regulation of MHC expression. Annu. Rev. Immunol. 19:331.[Medline]
  2. DeSandro, A., U. M. Nagarajan, J. M. Boss. 1999. The bare lymphocyte syndrome: molecular clues to the transcriptional regulation of major histocompatibility complex class II genes. Am. J. Hum. Genet. 65:279.[Medline]
  3. Gobin, S. J. P., A. Peijnenburg, V. Keijsers, P. J. Van den Elsen. 1997. Site {alpha} is crucial for two routes of IFN-{gamma}-induced MHC class I transactivation: the ISRE mediated route and a novel pathway involving CIITA. Immunity 6:601.[Medline]
  4. Martin, B. K., K. C. Chin, J. C. Olsen, C. A. Skinner, A. Dey, K. Ozato, J. Y. P. Ting. 1997. Induction of MHC class I expression by the MHC class II transactivator CIITA. Immunity 6:591.[Medline]
  5. Van den Elsen, P. J., A. Peijnenburg, M. C. J. A. Van Eggermond, S. J. P. Gobin. 1998. Shared regulatory elements in the promoters of MHC class I and class II genes. Immunol. Today 19:308.[Medline]
  6. Gobin, S. J. P., A. Peijnenburg, M. Van Eggermond, M. Van Zutphen, R. Van den Berg, P. J. Van den Elsen. 1998. The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and {beta}2-microglobulin genes. Immunity 9:531.[Medline]
  7. Nagarajan, U. M., A. Peijnenburg, S. J. P. Gobin, J. M. Boss, P. J. Van den Elsen. 2000. Novel mutations within the RFX-B gene and partial rescue of MHC and related genes through exogenous class II transactivator in RFX-B-deficient cells. J. Immunol. 164:3666.[Abstract/Free Full Text]
  8. Schoneich, J., J. L. Lee, P. Mansky, M. Sheffery, S. Y. Yang. 1997. The pentanucleotide ATTGG, the "inverted CCAAT," is an essential element for HLA class I gene transcription. J. Immunol. 158:4788.[Abstract]
  9. Louis-Plence, P. L., C. S. Moreno, J. M. Boss. 1997. Formation of a regulatory factor X/X2 Box-binding protein nuclear factor-Y multiprotein complex on the conserved regulatory regions on HLA class II genes. J. Immunol. 159:3899.[Abstract]
  10. Fontes, J. D., N. Jabrane-Ferrat, B. M. Peterlin. 1997. Assembly of functional regulatory complexes on MHC class II promoters in vivo. J. Mol. Biol. 270:336.[Medline]
  11. Carey, M.. 1998. The enhanceosome and transcriptional synergy. Cell 92:5.[Medline]
  12. Peijnenburg, A., R. Van den Berg, M. J. C. A. Van Eggermond, J. M. J. J. Ö. Sanal, A.-M. Vossen, C. Alcaïde Lennon, -L oridan, P. J. Van den Elsen. 2000. Defective MHC class II expression in an MHC class II deficiency patient is caused by a novel deletion of a splice donor site in the MHC class II transactivator gene. Immunogenetics 51:42.[Medline]
  13. Peijnenburg, A., M. C. J. A. Van Eggermond, R. Van den Berg, J. M. J. J. Vossen Ö. Sanal, P. J. Van den Elsen. 1999. Molecular analysis of an MHC class II deficiency patient reveals a novel mutation in the RFX5 gene. Immunogenetics 49:338.[Medline]
  14. Peijnenburg, A., S. J. P. Gobin, M. C. J. A. Van Eggermond, B. C. Godthelp, N. Graafeiland, P. J. Van den Elsen. 1997. Introduction of exogenous class II trans-activator in MHC class II-deficient ABI fibroblasts results in incomplete rescue of MHC class II antigen expression. J. Immunol. 159:2720.[Abstract]
  15. Mueller, P. R., B. Wold. 1989. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 246:780.[Abstract/Free Full Text]
  16. Westerheide, S. D., P. Louis-Plence, D. Ping, X. F. He, J. M. Boss. 1997. HLA-DMA and HLA-DMB gene expression functions through the conserved SXY region. J. Immunol. 158:4812.[Abstract]
  17. Gobin, S. J. P., V. Keijsers, P. J. Van den Elsen. 1998. The role of enhancer A in the locus-specific regulation of classical and non-classical HLA class I genes by NF-{kappa}B. J. Immunol. 161:2276.[Abstract/Free Full Text]
  18. Gobin, S. J. P., M. Van Zutphen, A. M. Woltman, V. Keijsers, P. J. Van den Elsen. 1999. Transactivation of classical and nonclassical HLA class I genes through the IFN-stimulated response element. J. Immunol. 163:1428.[Abstract/Free Full Text]
  19. Gobin, S. J. P., P. J. Van den Elsen. 2001. Locus-specific regulation of HLA-A and HLA-B expression is not determined by nucleotide variation in the X2 box promoter element. Blood 97:1518.[Free Full Text]
  20. Kara, C. J., L. H. Glimcher. 1993. Promoter accessibility within the environment of MHC is affected in class II-deficient combined immunodeficiency. EMBO J. 12:187.[Medline]
  21. Balas, A., F. García-Sánchez, F. Gómez-Reino, J. Vicario. 1994. HLA-A class I allele HLA-A2 expression defect associated with a mutation in its enhancer B inverted CAT in two families. Hum. Immunol. 41:69.[Medline]
  22. Lardy, N. M., N. Otting, A. R. Van der Horst, R. E. Bontrop, L. P. De Waal. 1997. 5' regulatory nucleotide sequence of an HLA*0101 null allele. Immunogenetics 46:152.[Medline]
  23. Mantovani, R.. 1999. The molecular biology of the CCAAT-binding factor NF-Y. Gene 239:15.[Medline]
  24. Linhoff, M. W., K. L. Wright, J. P. Y. Ting. 1997. CCAAT-binding factor NF-Y and RFX are required for in vivo assembly of a nucleoprotein complex that spans 250 base pairs: the invariant chain as a model. Mol. Cell. Biol. 17:4589.[Abstract]
  25. Zhu, X. S., M. W. Linhoff, G. Li, K. C. Chin, S. N. Maity, J. P. Ting. 2000. Transcriptional scaffold: CIITA interacts with NF-Y, RFX, and CREB to cause stereospecific regulation of the class II major histocompatibility complex promoter. Mol. Cell. Biol. 20:6051.[Abstract/Free Full Text]
  26. Nekrep, N., N. Jabrane-Ferrat, B. M. Peterlin. 2000. Mutations in the bare lymphocyte syndrome define critical steps in the assembly of the regulatory factor X complex. Mol. Cell. Biol. 20:4455.[Abstract/Free Full Text]
  27. Brown, J. A., E. M. Rogers, J. M. Boss. 1998. Mutational analysis of the MHC class II transactivator CIITA indicates a functional requirement for conserved LCD motifs and for interactions with the conserved W-box promoter element. Nucleic Acids Res. 26:4128.[Abstract/Free Full Text]
  28. Westerheide, S. D., J. M. Boss. 1999. Orientation and positional mapping of the subunits of the multicomponent transcription factors RFX and X2BP to the major histocompatibility complex class II transcriptional enhancer. Nucleic Acids Res. 27:1635.[Abstract/Free Full Text]
  29. Harton, J. A., J. P.-Y. Ting. 2000. Class II transactivator: mastering the art of major histocompatibility complex expression. Mol. Cell. Biol. 20:6185.[Free Full Text]
  30. DeSandro, A. M., U. M. Nagarajan, J. M. Boss. 2000. Associations and interactions between bare lymphocyte syndrome factors. Mol. Cell. Biol. 20:6587.[Abstract/Free Full Text]
  31. Villard, J., M. Peretti, K. Masternak, E. Barras, G. Caretti, R. Mantovani, W. Reith. 2000. A functionally essential domain of RFX5 mediates activation of major histocompatibility complex class II promoters by promoting cooperative binding between RFX and NF-Y. Mol. Cell. Biol. 20:3364.[Abstract/Free Full Text]
  32. Masternak, K., A. Muhlethaler-Mottet, J. Villard, M. Zufferey, V. Steimle, W. Reith. 2000. CIITA is a transcriptional coactivator that is required to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev. 14:1156.[Abstract/Free Full Text]
  33. Mahanta, S. K., T. Scholl, F. C. Yang, J. L. Strominger. 1997. Transactivation by CIITA, the type II bare lymphocyte syndrome-associated factor, requires participation of multiple regions of the TATA box binding protein. Proc. Natl. Acad. Sci. USA 94:6324.[Abstract/Free Full Text]
  34. Scholl, T., S. K. Mahanta, J. L. Strominger. 1997. Specific complex formation between the type II bare lymphocyte syndrome-associated transactivators CIITA and RFX5. Proc. Natl. Acad. Sci. USA 94:6330.[Abstract/Free Full Text]
  35. Fontes, J. D., B. Jiang, B. M. Peterlin. 1997. The class II trans-activatorCIITA interacts with the TBP-associated factor TAFII33. Nucleic Acids Res. 25:2522.[Abstract/Free Full Text]
  36. Sterner, D. E., S. L. Berger. 2000. Acetylation of histones and transcription-related factors. Microbiol. Mol. Biol. Rev. 64:435.[Abstract/Free Full Text]
  37. Kretsovali, A., T. Agalioti, C. Spilianakis, E. Tzortzakaki, M. Merika, J. Papamatheakis. 1998. Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with the class II transactivator. Mol. Cell. Biol. 18:6777.[Abstract/Free Full Text]
  38. Fontes, J. D., S. Kanazawa, D. Jean, B. M. Peterlin. 1999. Interactions between the class II transactivator and CREB binding protein increase transcription of major histocompatibility complex class II genes. Mol. Cell. Biol. 19:941.[Abstract/Free Full Text]
  39. Spilianakis, C., J. Papamatheakis, A. Kretsovali. 2000. Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes. Mol. Cell. Biol. 20:8489.[Abstract/Free Full Text]
  40. Montminy, M.. 1997. Transcriptional regulation by cyclic AMP. Annu. Rev. Biochem. 66:807.[Medline]



This article has been cited by other articles:


Home page
 BloodHome page
H. F. Kuipers, P. J. Biesta, L. J. Montagne, E. S. van Haastert, P. van der Valk, and P. J. van den Elsen
CC chemokine receptor 5 gene promoter activation by the cyclic AMP response element binding transcription factor
Blood, September 1, 2008; 112(5): 1610 - 1619.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. A. Moon, S. M. Veniamin, J. A. Parks-Dely, and K. E. Magor
The MHC of the Duck (Anas platyrhynchos) Contains Five Differentially Expressed Class I Genes
J. Immunol., November 15, 2005; 175(10): 6702 - 6712.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Rohrer, F. R. Pinto, K. E. Hulse, H. R. Lohr, L. Zhang, and J. S. Almeida
Multidestructive Pathways Triggered in Photoreceptor Cell Death of the RD Mouse as Determined through Gene Expression Profiling
J. Biol. Chem., October 1, 2004; 279(40): 41903 - 41910.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. E. Magor, B. P. Shum, and P. Parham
The {beta}2-Microglobulin Locus of Rainbow Trout (Oncorhynchus mykiss) Contains Three Polymorphic Genes
J. Immunol., March 15, 2004; 172(6): 3635 - 3643.
[Abstract]