The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharif, M. N.
Right arrow Articles by Eckhardt, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharif, M. N.
Right arrow Articles by Eckhardt, L. A.
The Journal of Immunology, 2001, 167: 4421-4429.
Copyright © 2001 by The American Association of Immunologists

Unique Function for Carboxyl-Terminal Domain of Oct-2 in Ig-Secreting Cells1

M. Nusrat Sharif, Hanna S. Radomska, David M. Miller and Laurel A. Eckhardt2

Department of Biological Sciences, Hunter College, and Graduate School of City University of New York, New York, NY 10021


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The activity of Ig gene promoters and enhancers is regulated by two related transcription factors, Oct-1 (ubiquitous) and Oct-2 (B lineage specific), which bind the octamer motif (ATTTGCAT) present in these elements. As Ig promoter-binding factors, Oct-1 and Oct-2 each work together with a B lymphocyte-specific cofactor OCA-B/OBF-1/Bob-1 that interacts with them through their POU (DNA-binding) domains. Because both can mediate Ig promoter activity in B cells, there has been some question as to whether these two octamer-binding factors serve distinct functions in lymphocytes. We have shown previously that the silencing of B lymphocyte-specific genes in plasmacytoma x T lymphoma hybrids can be prevented by preserving Oct-2 expression. The pronounced effect of this transcription factor on the phenotype of plasmacytoma x T lymphoma hybrids established a critical role for Oct-2 not only in maintaining Ig gene expression, but in maintaining the overall genetic program of Ig-secreting cells. In the present study, we have explored the functional differences between Oct-1 and Oct-2 using chimeric Oct-1/Oct-2 proteins in cell fusion assays. Our results provide further evidence for an essential role for Oct-2 in Ig-secreting cells and identify the C-terminal domain of Oct-2 as responsible for its unique function in these cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Oct-1 and Oct-2 are POU homeodomain proteins that recognize the same sequence, the octamer motif (ATGCAAAT), but are differentially expressed in vivo. Oct-1 is a ubiquitous transcription factor implicated in the control of genes expressed by all cells, whereas Oct-2 is largely B lineage restricted and has been implicated in the control of B lymphocyte-specific gene expression (1, 2, 3, 4, 5, 6). Both proteins are members of the POU family of transcription factors, having in common a bipartite DNA-binding domain that consists of an N-terminal POU-specific domain and a C-terminal POU homeodomain separated by a flexible linker region (6, 7, 8, 9, 10, 11).

Although the POU domains of Oct-1 and Oct-2 are highly homologous (87% amino acid identity, not including the linker region between POU-specific and homeodomains), there are functional differences between them. For example, the POU domain of Oct-1 binds the viral transcription factor VP16, whereas that of Oct-2 cannot. This functional difference maps to one of seven amino acid differences between the two POU homeodomains (12). Outside the POU domains, Oct-1 and Oct-2 have very little sequence homology. Their N-terminal regions differ both in size and sequence (28.5% amino acid sequence homology; also see Fig. 2Go) (8, 9, 13, 14). However, they have in common a high concentration of glutamine residues, a feature shared by the trans activation regions of many transcription factors. The carboxyl-terminal regions of Oct-1 and Oct-2 also show very little homology either in size or sequence (~12% homology; C-terminal domain of Oct-1 is 194 aa longer than that of Oct-2; see Fig. 2Go), but again, there is some similarity in that both have stretches rich in serine, threonine, and proline (8, 9, 13, 14).



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 2. Diagrams of hOct-1, hOct-2, and chimeric proteins used in cell fusion experiments. N, POU, and C refer to the amino-terminal region, the central DNA-binding domain, and the carboxyl-terminal regions of the proteins, respectively. Numbers in parentheses indicate the number of amino acids in each domain. hOct-2 domains are shaded.

 
The notion that Oct-2 and Oct-1 differed in their ability to drive B cell-specific gene expression was initially a widely held assumption (1, 15, 16, 17). Oct-2 cDNA was cloned by virtue of its ability to encode a factor that could trans activate an Ig promoter in nonlymphoid cells, something the endogenously expressed Oct-1 was unable to do (8, 15, 16). The functional difference between these two octamer-binding proteins, when assayed with octamer-containing reporter genes in nonlymphoid cells, mapped to their carboxyl-terminal domains (13). However, it was not clear how this finding translated to the control of B cell-specific genes, such as the Ig genes, in B lymphoid cells. Several studies, in fact, suggested that Oct-1 and Oct-2 were functionally interchangeable within B lymphoid cells (18, 19, 20, 21). Discovery of the B lineage-restricted, coactivator OBF-1 (OCA-B, Bob-1) subsequently provided an alternate explanation for the tissue-restricted activity of Ig promoters (22, 23, 24). This coactivator significantly augmented Ig promoter activity (measured in reporter genes) through its interaction with the POU domain of either Oct-1 or Oct-2.

However, gene knockout studies involving the Pou2f2 (murine locus encoding Oct-2) and OBF-1 loci (encoding OCA-B/OBF-1) countered either model invoking Oct-2 or OCA-B, respectively, as essential to Ig promoter activity. Mice lacking either or both of these genes produced surface Ig-positive B cells, demonstrating that neither Oct-2 nor OCA-B is essential for the activation of Ig genes nor for early events in B cell development (25, 26, 27, 28). However, these knockout mice showed defects in events that commonly occur after B cell activation (i.e., postantigenic challenge), making evident unique functions for Oct-2 and OCA-B in late-stage cells (27, 28, 29, 30, 31, 32).

Studies involving somatic cell hybrids similarly ascribed an essential function to Oct-2 in late-stage cells (33). Specifically, it was discovered that B cell-specific genes were uniformly and coordinately silenced when Ig-secreting cells (plasmacytomas) were fused to a non-B lineage cell line (34). The locus encoding Oct-2, Pou2f2, was one of the many genes silenced in this cell fusion system. Our laboratory showed that if we sustained expression of just this one protein (Oct-2), the Pou2f2 locus and all other assayed, B cell-specific genes simultaneously escaped silencing (33). Our means of maintaining Oct-2 expression in these fusion experiments involved use of a cloned gene expressing Oct-2. The Ig-secreting plasmacytoma was stably transformed with human Oct-2 (hOct-2)3 cDNA under the control of a CMV promoter before cell fusion. Because the CMV promoter was not subject to T lymphoma-mediated silencing, the hOct-2 gene remained active in hybrid lines. The expressed hOct-2 carried an influenza epitope (16 aa) at the N terminus, and could be distinguished from endogenously encoded murine Oct-2 (mOct-2) by use of an anti-flu Ab (13, 33).

The dramatic rescue of the phenotype of Ig-secreting cell in hybrids that retained and expressed the hOct-2 gene led us to conclude that Oct-2 played a critical role in Ig-secreting cells, affecting the expression of numerous genes uniquely expressed in these cells. We also noted that whereas Pou2f2 was normally silenced in the plasmacytoma x T cell hybrids, Pou2f1 (the locus encoding Oct-1) remained active. Therefore, it appeared that Oct-1 could not substitute for Oct-2 in preserving the genetic program of the plasmacyte (33).

In the present study, we have used chimeric hOct-2/hOct-1 proteins in cell fusion assays as a means for identifying specific protein domain(s) required for the unique function of Oct-2 in Ig-secreting cells. As detailed below, we find that the carboxyl-terminal region of Oct-2 is critical to this activity. We discuss these findings both in relation to known (OCA-B) and hypothetical coactivators of Oct-2 function and in relation to the observed differences in Oct-2 function when assayed as a binding factor for gene promoter vs enhancer sequences (35, 36, 37).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Plasmid constructions

pCGNOct-1 is a flu epitope-tagged eukaryotic vector that produces hOct-1 (13). This vector has a CMV promoter that drives expression of hOct-1 cDNA. The Oct-1 coding sequence begins at the first Oct-1 AUG codon described previously (14) and encodes a 743-aa protein. pCGNOct1neo, a derivative of pCGNOct1 containing the bacterial neor gene as selectable marker, was constructed by inserting a 2.4-kb EcoRI-BamHI fragment from pKOneo (38) into the PvuI site of pCGNOct1.

The pCGNOct1.2.2, pCGNOct2.1.2, pCGNOct2.2.1, and pCGNOct 1.1.2 vectors encoding hOct-2/hOct-1 chimeric proteins (13) were covalently linked to the hisD transcription unit from pSV2his (39) to generate pCGNOct1.2.2.his, pCGNOct2.1.2his, pCGNOct2.2.1his, and pCGNOct1.1.2his, respectively.

Cell lines

BW5147.G.1.4 OUAR.1 (T lymphoma) was obtained from the American Type Culture Collection (ATCC CRL1588; Manassas, VA). This cell line is resistant to 10-3 M ouabain and 10-4 M 6-thioguanine. It is derived from an AKR/J mouse thymoma. The 45.6.2.4 is a {gamma}2b/{kappa}-producing plasmacytoma cell line derived from the BALB/c mouse tumor MPC11 (40). We refer to this cell line as MPC11. MPC11 cells grow in medium containing hypoxanthine, aminopterin, and thymidine, but die in medium containing ouabain.

These cell lines were maintained in complete DMEM, which consists of DMEM (catalog 12100-061; Life Technologies, Gaithersburg, MD) containing 10% bovine calf serum (catalog A-2151-L; HyClone Laboratories, Logan, UT), 100 U/ml penicillin, 100 µg/ml streptomycin (catalog 15140-015; Life Technologies), and 0.1 mM nonessential amino acids (catalog 11140-019; Life Technologies).

Transfections

Transfections were as previously described (33). Briefly, 107 cells were transfected with 10 µg of linearized plasmid by electroporation (0.25 kV, 960 µF). Cells were plated at 105 cells/well in 96-well plates, and 48 h later, appropriate drug-selection medium was added. BW5147 cells transfected with pCGNOct-1neo were selected in 1 mg/ml G418-containing DMEM (G418 from Life Technologies; catalog 860-1811IJ). MPC11 cells transfected with hisD-containing vectors were placed in 3 mM L-histidinol-containing DMEM.

Cell fusions

Cell fusions were performed in an electroporator as previously described (gene pulser with capacitance extender; Bio-Rad, Hercules, CA) (41). After electrofusion, cells were plated at a density of 105 cells/well in a 96-well plate, and selective medium was added 48 h later. In cell fusions between BO1(16) neo and MPC11, selection of hybrids was in complete DMEM supplemented with 10-3 M ouabain and 1 mg/ml G418. When BW5147 was fused with MPC11 transformants, in which the exogenous genes were covalently linked to hisD, selection of hybrids was in complete DMEM supplemented with 10-3 M ouabain and 3 mM L-histidinol.

In all fusions, growing cells were recovered in <30% of the wells and, therefore, most likely represent single fusion events. Two weeks from the date of fusion, growing clones were transferred to 12-well plates and cultured for an additional week before being frozen as stable hybrids. Clones were further analyzed by genomic Southern to test for retention of plasmacytoma-derived and T lymphoma-derived IgH and IgL loci before they were designated informative hybrids.

Genomic Southern blots

Southern blots were conducted as previously described (33). Approximately 15 µg of genomic DNA was digested with BamHI restriction endonuclease before electrophoresis. Ig loci were detected with a 1.8-kb BamHI-EcoRI fragment from pJ11 that contains JH3-JH4 coding sequences and IgH intron enhancer sequences (42). This probe detects the {gamma}2b-producing locus of MPC11, but not the aberrantly rearranged IgH locus of this cell line (43). The Ig{kappa} loci were detected with a 1.8-kb genomic XbaI-BamHI fragment spanning C{kappa}. In MPC11, there are two rearranged Ig{kappa} loci, only one of which produces a functional L chain (44). When MPC11 DNA is digested with BamHI, the 7.7-kb fragment detected with the C{kappa} probe corresponds to the functional locus. A 0.83-kb PvuII- HincII fragment isolated from pSV2his was used to detect hisD sequences (39).

Northern blots

Total cytoplasmic RNA was extracted using an RNA isolation kit (catalog 200345; Stratagene, La Jolla, CA). Northern blots were as previously described (33). Twenty micrograms of RNA was used for each sample analyzed. J chain mRNA was identified with a 1.2-kb cDNA fragment from plasmid Jc21 (45). PU.1 mRNA was identified with a 0.4-kb SacI cDNA fragment derived from pBSKS-PU.1 (46). To normalize amounts of RNA in each sample, RNA blots were erased (by treating for 15 min with 1 L boiling 0.1x SSC, 0.01% SDS) and then rehybridized with a {beta}-actin probe (0.28-kb EcoRI-HindIII fragment from plasmid pSP6-{beta} actin; catalogue 7315; Ambion, Austin, TX) or a GAPDH probe (catalog 7330; Ambion).

EMSAs

Binding reactions and EMSAs were performed as previously described (33, 47). Approximately 15 µg of protein (nuclear extract) was incubated with 104 cpm end-labeled 51-bp fragment from the IgH intron (Eµ) enhancer (47). The sequence of the 51-bp fragment is: AATCCTCAACTTATTTTAGAAATGCAAATTACCCAGGTGGTGTTTTGCTCA (octamer italicized and bold). In experiments involving Ab, anti-flu tag Ab (12CA5 hybridoma culture supernatant at 1/8 dilution) (48) was added to the incubation mix before adding the radioactive probe.

ELISAs

Cytoplasmic lysates were made for ELISAs, as previously described (49). For detection of {gamma}2b-H chains, ELISA plates (Dynatech Laboratories, Chantilly, VA) were coated with purified anti-mouse {gamma}2b (rat IgG1) (catalog 02041D; BD PharMingen, San Diego, CA). Coated wells were then incubated with cell lysates and {gamma}2b chains detected with alkaline phosphatase-conjugated (rat IgG2a) anti-mouse {gamma}2b (catalog 02033E; BD PharMingen) and enzyme substrate (catalog 104-105; Sigma Diagnostics, St. Louis, MO). For {kappa}-L chain assays, the coating Ab was affinity-purified goat anti-mouse {kappa} Ab (catalog 1050-01; Fisher Biotech, Pittsburgh, PA). The detecting Ab was biotinylated goat anti-mouse {kappa} Ab (catalog 1179; Amersham International, Little Chalfont, Buckinghamshire, U.K.), used together with an avidin-conjugated alkaline phosphatase (catalog 62-253-1; Miles Scientific, Naperville, IL).

Western blots

Approximately 2 x 107 cells were resuspended in 50 µl of lysis buffer (20 mM HEPES, pH 7.9, 0.4 M KCl, 0.5 mM EDTA, 0.5 mM EGTA, 0.5 mM DTT, 20% glycerol, and 0.025% Nonidet P-40) and subjected to five freeze-thaw cycles (liquid nitrogen and 25°C water bath), and cellular debris were removed by centrifugation (12,000 x g, 10 min, 4°C). Supernatants comprising whole cell extract were stored at -80°C until electrophoresis. Extracts corresponding to 50 µg of total protein (Bradford Assay; catalog 500-0006; Bio-Rad) were applied to discontinuous polyacrylamide gels (5% stacking, 8% separating), and proteins were electrophoretically transferred to nitrocellulose membranes (Bio-Rad Transblot apparatus), as described (50). Electrophoretic transfer was monitored by membrane staining with Ponceau Red. Blots were incubated in PBS containing 6% nonfat milk, to block nonspecific binding of protein. Abs were added in the same blocking solution.

Detection of flu tag: anti-HA.11 mAb (Covance, MMS-101P; Berkeley Antibody, Richmond, CA) and HRP-conjugated rabbit anti-mouse IgG1 (61-0120; Zymed, South San Francisco, CA).

Detection of tubulin: affinity-purified rat anti-{alpha} tubulin (MCAP77; Serotec, Raleigh, NC) and HRP-conjugated mouse monoclonal anti-rat IgG2a (03-9620; Zymed).

Detection of Oct-2: rabbit polyclonal anti-Oct-2(C-20)X (SC-233X; Santa Cruz Biotechnology, Santa Cruz, CA) and HRP-conjugated donkey anti-rabbit whole Ig (NA934; Amersham Pharmacia Biotech, Piscataway, NJ).

Detection of Ig {kappa}-chain: HRP-conjugated goat anti-mouse IgG (H&L, 31430; Pierce, Rockford, IL).

Detection of OCA-B: polyclonal rabbit anti-hOCA-B (kindly supplied by R. Roeder, The Rockefeller University, New York, NY) and HRP-conjugated donkey anti-rabbit whole Ig (as above).

Blots were developed with SuperSignal chemiluminescent substrate (Pierce), and chemiluminescence was visualized by various exposures to Kodak (Rochester, NY) X-OMAT film.

RT-PCR

RT-PCR was as described by Radomska et al. (33), except that 2 µg of starting RNA was used. A pair of primers unique for mOct-2 mRNA was used to amplify cDNA derived from endogenous murine Pou2f2 (forward primer, 5'-GCCACAGGCACAGCAGAGTCAG-3', GenBank accession no. X57936, nt 450–471; reverse primer, 5'-CCAGAATTCTAAGGGGCAGGGTTCCACCA-3', accession no. X57936, nt 1371–1390). RT-PCR products were size fractionated on 0.8% agarose gels and blotted to nylon filters. Blots were hybridized with a HindIII-BglII fragment from pCGNOct-2. The expected RT-PCR product was 0.9 kb.

BW x MP-hOct1.1.2 hybrids were also analyzed by PCR for expression of chimeric hOct1.1.2 mRNA. The primers used were the same reverse primer shown above and a forward primer specific for hOct-1 (5'-AGCCAAGCCAGCCAAGCCAGCCTTCCCAGCA-3', accession no. X53468, nt 307–329).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Constitutively expressed hOct-1 does not prevent Ig gene silencing in plasmacytoma x T lymphoma hybrids

As noted above, the Pou2f2 locus (encoding Oct-2) is silenced in T lymphoma x plasmacytoma fusions, whereas the Pou2f1 locus (encoding Oct-1) is not. The resulting hybrids lack expression of plasmacytoma-specific genes, demonstrating that endogenously expressed Oct-1 is not capable of rescuing these genes from fusion-mediated silencing. However, when we used a cloned hOct-2 gene as a means for preventing loss of Oct-2 in these fusions, all of the resulting hybrids expressed the genetic program of the plasmacyte (33).

As outlined below, we used a series of chimeric genes to further map the functional differences between these two POU family proteins. However, we first considered the possibility that differences in the levels or patterns of expression of the transfected hOct-2 gene and the endogenous Pou2f1 locus might explain why expression of the former, but not of the latter, could preserve plasmacytoma gene expression in cell hybrids. To test this possibility, we made use of an expression vector encoding hOct-1. The vector backbone was the same as that used for the hOct-2 experiments and appended an influenza epitope at the amino terminus of hOct-1. The vector also included a selectable marker (pSV2neor) that allowed transformants to be growth selected in G418-containing medium. Nuclear extracts made from G418r clones were then assayed by EMSA in the presence of anti-flu Ab (12CA5) (13) to test for expression of the transfected hOct-1 gene.

One of the flu-tagged hOct-1 transformants (BO1(16)neo, Fig. 1GoA) was subsequently fused to the Ig-secreting plasmacytoma MPC11. Eighteen isolated hybrids retained Ig{gamma}2b and/or Ig{kappa} genes from the plasmacytoma parent as well as Ig loci from the T lymphoma parent, demonstrating both that they were truly hybrid in nature and informative with respect to Ig gene silencing.



View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 1. Expression of transfected hOct-1 in T cell transformants and hybrids. A, EMSA of octamer-binding proteins in BW5147 (BW) and its hOct-1 transformants (13–16). The 32P-labeled DNA probe is a 51-bp fragment from the IgH intronic (Eµ) enhancer that contains the octamer motif. DNA/protein complexes formed by endogenous Oct-1 (Oct-1) and exogenous Oct-1 (hOct-1) comigrate, but a supershifted complex containing flu-tagged hOct-1 is visible with anti-flu Ab (hOct-1/Ab). B, Nuclear extracts from the plasmacytoma parent (MPC11) and T lymphoma parent (BO1; BO1(16)neo transformant shown in A) and from their hybrids were analyzed as in A. Representative data for six hybrids are shown. The Oct-2 complex generated from MPC11 extracts is indicated.

 
EMSAs performed with nuclear extracts from these hybrids identified 16 that continued to produce hOct-1 from the transfected hOct-1 gene (representative data, Fig. 1GoB). When tested by ELISA for the production of {gamma}2b and {kappa}-chains, only one of the sixteen hybrids was producing Ig (Table IGo). One Ig-expressing hybrid of sixteen is comparable with the frequency of exceptional hybrids normally recovered in fusions between MPC11 and BW5147 (33, 34). Therefore, there was no indication that hOct-1, even when present as the product of both the endogenous Pou2f1 locus and a hOct-1 transgene, was having any impact on the silencing of plasmacytoma-specific genes in the MPC11 x BW5147-hOct-1 hybrids.


View this table:
[in this window]
[in a new window]
  		Table I. Summary of hybrid cell analyses

 
A modified hOct-2 protein with the POU domain of Oct-1 is able to preserve Ig gene expression in hybrid cells

To map the protein domain(s) responsible for the unique function of Oct-2 in Ig-secreting cells, we made use of a series of expression vectors encoding flu-tagged Oct-1/Oct-2 chimeric proteins (Fig. 2Go) (13). Each of the vectors was introduced into the MPC11 plasmacytoma, and transformants were examined by EMSA for DNA/protein complexes characteristic of the chimeric proteins (Fig. 3Go). Transformants expressing chimeric genes were subcloned and then fused with the BW5147 T lymphoma by electrofusion. Hybrids were isolated in appropriate growth-selected medium and then analyzed by genomic Southern to test for retention of plasmacytoma and T lymphoma-derived IgH and IgL loci.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 3. Expression of chimeric Oct-binding proteins in MPC11 transformants. Assays were as described in Fig. 1GoA. A, Anti-flu epitope Ab was added to all binding reactions shown. hOct 1.2.2, intermediate in size to Oct-1 and Oct-2, is seen as a distinct band between the Oct-1- and Oct-2-containing complexes. MP-hOct1.2.2 transformants 1 and 4 (numbers indicated above lanes) were used in cell fusion experiments. hOct 2.1.2, approximately the same size as endogenously encoded mOct-2, comigrates with it. MP-hOct2.1.2 transformants 6 and 7 were used in cell fusion experiments. Expression of hOct 1.2.2 and hOct 2.1.2 was confirmed by formation of an anti-flu Ab supershifted complex (hOct + Ab). B, Anti-flu epitope Ab was added to all binding reactions shown. hOct 2.2.1 comigrates with Oct-1. It is best visualized in a complex with anti-flu Ab (hOct2.2.1/Ab). MP-hOct2.2.1 transformants 1 and 9 were used in cell fusion experiments. C, hOct 1.1.2, intermediate in size to Oct-1 and Oct-2, forms a discrete band between Oct-1- and Oct-2-containing complexes. Anti-flu Ab was added to those binding reactions designated with a +. In these reactions, hOct1.1.2 is visualized in a complex with the anti-flu Ab (hOct1.1.2/Ab). MP-hOct1.1.2 transformants 3 and 7 were used in cell fusion experiments. In other experiments, the complex formed with endogenous Oct-2 was more clearly detected in the MPC11 parental line and transformants.

 
A representative Southern blot of DNA from BW x MP-hOct1.1.2 hybrids is shown in Fig. 4Go. A probe for the JH region of the IgH locus hybridized to a ~9.9-kb BamHI fragment from the BW5147 genome and a ~4.8-kb BamHI fragment from the genome of the MP-hOct1.1.2 transformant. The latter fragment is derived from the productively rearranged and expressed IgH locus of the plasmacytoma (51). Nine of the ten hybrids analyzed in Fig. 4Go retained the BamHI fragments derived from both parents, demonstrating both that they were true hybrids and that they retained a functionally assembled IgH gene from the plasmacytoma parent. Similar analyses of the Ig{kappa} locus in these 10 hybrids demonstrated that most retained both the unrearranged Ig{kappa} locus from the T lymphoma BW5147 (14 kb) and the two rearranged Ig{kappa} loci from the MP-hOct1.1.2 plasmacytoma parent (7.7 kb = functionally rearranged and 3 kb = aberrantly rearranged) (44).



View larger version (88K):
[in this window]
[in a new window]
  		FIGURE 4. Genomic Southern blot showing the presence of plasmacytoma and T lymphoma-derived genes in BW5147 x MP-hOct1.1.2 hybrids. A, Genomic DNA digested with BamHI and hybridized with 32P-labeled pJ11 probe to detect IgH genes (IgH). DNAs from the hOct 1.1.2-expressing plasmacytoma parent (MP1.1.2his), the T lymphoma parent (BW5147), and their hybrids (data for 10 representative 1.1.2 hybrids shown) were analyzed. Clones retaining both the 4.8- and 9.9-kb bands from the parental lines were considered hybrids and were included in further analyses. Hybrids with the designation "7.n" were those obtained from fusion with MPC11-hOct1.1.2 transformant 7, and those with the "3.n" designation were from fusions with MPC11-hOct1.1.2 3. B, Southern blots of BamHI-digested DNA from the same cell lines in A, hybridized with C{kappa} probe to detect Ig{kappa} genes (see Materials and Methods). The two fragments detected with MPC11 DNA correspond to the functionally rearranged Ig{kappa} locus of MPC11 (7.7-kb BamHI fragment) and an aberrantly rearranged Ig{kappa} locus (3 kb).

 
Using this experimental strategy, we first tested whether differences in the POU region were responsible for the unique ability of Oct-2 to preserve B cell-specific gene function. MPC11 transformants expressing hOct2.1.2 were isolated (Fig. 3GoA; for protein structure, see Fig. 2Go). Two of these, MP-hOct2.1.2 6 and MP-hOct2.1.2 7, were fused with BW5147, and the resulting hybrids were analyzed by genomic Southern. Eighteen hybrids that retained Ig loci from both parental lines were also expressing hOct2.1.2 by EMSA (data not shown). All 18 also expressed Ig as determined by ELISA (Table IGo).

Given our previous observation that the Ig loci behaved coordinately with other plasmacytoma-specific genes in plasmacytoma x T cell hybrids (33, 34), we tested several of the hybrids for {gamma}2b, PU.1, and J chain gene expression by Northern blot (representative data, Fig. 5Go). As expected from the ELISA data, all examined hybrids expressed {gamma}2b mRNA, although the level varied among hybrids. Hybrid clone 1 expressed particularly low levels of {gamma}2b, but even this level of expression is not seen in Ig-silenced hybrids, in which the Ig locus is not only transcriptionally inactive (as determined by nuclear run-on assays), but also becomes de novo methylated (51). J chain and PU.1 mRNA levels in the hybrids paralleled that of {gamma}2b, with PU.1 mRNA being the least abundant and, therefore, not detectable in hybrid clone 1. This variation in gene expression levels was also seen previously in hybrids involving MPC11-hOct-2 transformants (33), and is discussed further below.



View larger version (106K):
[in this window]
[in a new window]
  		FIGURE 5. PU.1, J chain, and {gamma}2b expression in BW x MP-hOct2.1.2 hybrids. Northern blot analyses of total cytoplasmic RNA isolated from BW5147, MPC11, and eight representative hybrid lines. A single Northern blot was hybridized successively with PU.1, J chain, {gamma}2b, and {beta}-actin probes. {beta}-actin mRNA levels were used to normalize RNA amounts. Hybrids 28, 30, 32, and 33 were derived from fusions with MPC11-hOct2.1.2 2, whereas hybrids 1, 6, 13, and 24 resulted from fusions with MPC11-hOct2.1.2 6.

 
In summary, the ability of hOct-2 to rescue plasmacytoma-specific genes from T lymphoma-mediated silencing was not detectably affected by replacement of the POU domain of the protein with that of hOct-1.

The N-terminal domains of hOct-1 and hOct-2 are interchangeable with respect to preserving Ig gene expression in plasmacytoma x T lymphoma hybrid cell lines

In the chimeric protein hOct 1.2.2, the N-terminal domain of Oct-2 is replaced by that of Oct-1, resulting in a chimeric protein with a m.w. intermediate to that of Oct-1 and Oct-2 (Fig. 3GoA). Two MPC11-hOct1.2.2 transformants (1 and 4, see Fig. 3GoA) were independently fused to BW5147. Ten hybrids arising from these fusions both expressed chimeric hOct 1.2.2 and retained Ig loci from the plasmacytoma and T lymphoma parents (Fig. 6Go and data not shown). When tested by ELISA, all of the hybrids were Ig positive (Table IGo), and Northern blots revealed that they also expressed PU.1 and J chain mRNAs, again at varying levels (data not shown). EMSAs confirmed that hOct1.2.2 was being expressed in each of the hybrids (Fig. 6Go). Because complexes between the octamer probe and the chimeric hOct1.2.2 protein were easily distinguished from those between the octamer probe and mOct-2, these EMSAs also demonstrated that the endogenous Pou2f2 gene (usually silenced) remained active in these hybrid lines (Fig. 6Go). Like hOct-2 of our earlier studies (33), hOct1.2.2 could rescue Pou2f2 function.



View larger version (80K):
[in this window]
[in a new window]
  		FIGURE 6. Oct-2 and hOct1.2.2 expression in BW x MP-hOct1.2.2 hybrid lines. EMSA of nuclear extracts made from parental and hybrid lines. Anti-flu tag Ab confirmed that the intermediate complex contained flu-tagged hOct1.2.2 (data not shown). Methods as described in Fig. 1GoA. All of the hybrids shown were derived from fusions with MPC11-hOct1.2.2 1.

 
The C-terminal domain of Oct-2 is required for its unique function in Ig-secreting cells

Given that the activity of hOct-1 in the fusion assays was clearly distinguishable from that of hOct-2 and from that of the hOct1.2.2 and hOct2.1.2 chimeric proteins, the most likely interpretation was that the C-terminal domain of Oct-2 was responsible for the unique function of this transcription factor. This domain was shown previously to distinguish between Oct-1 and Oct-2 in transactivation studies of a synthetic, octamer-dependent promoter (13). We were interested to determine whether the more global effect of Oct-2 on the natural, endogenous genes of the plasmacyte was similarly dependent upon this domain.

Two chimeric, octamer-binding proteins were used to test this hypothesis: a chimeric protein replacing the C-terminal region of Oct-2 with that of Oct-1 (hOct2.2.1) and a reciprocal, chimeric protein consisting of the N-terminal and POU domains of Oct-1 and the C-terminal domain of Oct-2 (hOct1.1.2) (see Fig. 2Go).

Two hOct2.2.1 transformants (MP-hOct2.2.1 1 and MP-hOct2.2.1 9, Fig. 3GoB) were fused to the T lymphoma BW5147. Ten clones were confirmed as informative hybrids (genomic Southern blots, data not shown) and continued to express chimeric hOct2.2.1 as determined by EMSA and Western blot (Figs. 7GoA and 8, Flu lanes). None of these hybrid clones expressed either IgH or IgL chain, as determined by Northern blot, Western blot, and/or ELISA (Figs. 7GoB and 8, {kappa} lanes and data not shown; summarized in Table IGo). Because this chimeric protein forms complexes with the octamer probe that are distinguishable from those formed with mOct-2, we could also conclude from EMSA of hybrid cell extracts that these hybrids were negative for mOct-2 (Fig. 7GoA). This was confirmed by Western blot analyses (Fig. 8Go, Oct-2 lanes). Western blots also revealed that there was no OCA-B expression in these hybrids (Fig. 8Go, Oct-2 and OCA-B lanes), and Northern blots showed that they lacked J chain mRNA (Fig. 7GoB). In summary, hOct2.2.1 was unable to preserve Ig, endogenous mOct-2, OCA-B, or J chain gene expression in the plasmacytoma x T lymphoma hybrids, supporting the notion that these rescue functions require the C-terminal domain of Oct-2.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 7. Oct-2 protein and J chain mRNA are absent in BW x MP-hOct2.2.1 hybrids. A, EMSA of Oct 2.2.1 hybrids. Extracts from MPC11, a hOct2.2.1-expressing transformant, MP-hOct2.2.1 1 (MP2.2.1 1), and five representative hybrid lines made from a fusion of this transformant with BW5147. Methods were as described in Fig. 1GoA, except that both binding reactions with (+) and without anti-flu Abs were included. In the absence of anti-Ab, hOct 2.2.1 and Oct-1 protein/DNA complexes comigrate, resulting in a dense complex (compare hybrid extracts with and without Ab). B, Northern blot of total RNA from MPC11, BW5147, hOct2.2.1-producing transformants (MP221 1 and MP221 9), and seven representative BW x MPhOct2.2.1 hybrids. Northern blots were probed successively with a J chain probe and, for normalization, with a GAPDH probe.

 


View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 8. Plasmacytoma-specific protein expression in BW x MP-hOct1.1.2 hybrids, but not in BW x MP-hOct2.2.1 hybrids. A Western blot is shown of whole cell extracts obtained from the parental lines, MPC11 and BW5147, the Oct1.1.2-expressing transformant MP112his 7, and hybrids resulting from fusion of BW5147 with MP-hOct1.1.2 transformants (1.1.2 hybrids) or with MP-hOct2.2.1 transformants (2.2.1 hybrids). The 1.1.2 hybrids 3.14, 3.17, 7.5, 7.8, 7.9, and 7.13 were initially classified as Ig expressing by ELISA, whereas 1.1.2 hybrids 7.41, 3.30, and 3.27 were Ig negative by this criterion. The Ag specificities of the Abs used are indicated to the left of the blots (e.g., Flu = anti-flu Ab). Note that the Ab to the C-terminal domain of Oct-2 detects both endogenous Oct-2 and the Oct1.1.2 chimeric protein, but not the Oct2.2.1 chimeric protein. Ab to OCA-B cross-reacts with a ubiquitous protein (upper band present in all cell lines, including BW5147) as well as with OCA-B (faster-migrating band). For the data shown, the same protein extracts were run on duplicate gels, and one blot was cut and separately incubated with Abs to Flu, Ig{kappa}, and tubulin, while the other blot was cut and separately incubated with Abs to Oct-2 and OCA-B. Each hybrid was analyzed in this fashion two or more times, using at least two separate preparations of protein.

 
A reciprocal chimeric protein, hOct1.1.2, was used to ask whether the C-terminal domain of hOct-2 was sufficient to convert hOct-1 into a form that could preserve B cell-specific gene expression in hybrid cells (structure shown in Fig. 2Go). MP-hOct1.1.2 3 and MP-hOct1.1.2. 7 transformants (Fig. 3GoC) were fused to BW5147, hybrid clones were recovered, and the clones were examined by Southern blot (representative data, Fig. 4Go). In initial screens of the Oct1.1.2 hybrids by ELISA, most of the hybrids expressed Ig. However, some appeared not to express Ig, despite the fact that they retained the functionally assembled Ig genes ({gamma}2b and/or {kappa}) of the plasmacytoma parent. For this reason, we analyzed a large number of these hybrids (45) to obtain a reliable estimate of this protein’s rescuing function. Thirty-five continued to express Ig, as determined by ELISA, whereas ten did not (data summarized in Table IGo). Several of the Ig-expressing and Ig-negative hybrids were also analyzed for J chain mRNA. The Ig-expressing hybrids expressed these mRNAs, whereas the Ig-negative 1.1.2 hybrids did not (Fig. 9Go). Although efficiency appears compromised with the hOct1.1.2 protein (78% instead of 100% of hybrid clones expressed Ig), much of the activity of the hOct-2 protein is transferred to the hOct-1 protein through this single domain exchange.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 9. Coordinate expression of plasmacyte-specific genes in BW x MP-hOct1.1.2 hybrids. A, Northern blot of total RNA from MPC11, BW5147, two Oct1.1.2-expressing transformants of MPC11 (MP112 3 and MP112 7), and six representative, Ig-expressing BW x MP-hOct1.1.2 hybrids. The same blot was sequentially hybridized with Ig{kappa}, J chain, and GAPDH (for normalization) probes. B, Northern blots of five representative Ig-negative BW x MP-hOct1.1.2 hybrids. Blots were hybridized successively with J chain and {beta}-actin probes.

 
Among the 35 BW x MP-hOct1.1.2 hybrids that expressed Ig, there was variation in Ig levels. This is evident in the Northern blot shown in Fig. 9GoA. All six of the hybrids analyzed in this experiment expressed both J chain and Ig{kappa} mRNA, but hybrids 3.14 and 7.13 expressed these at very low levels. We also saw this variation in the BW x MP-hOct2.1.2 hybrids (Fig. 5Go) and in hybrids involving MP-hOct1.2.2 and MP-hOct-2 transformants, as well (data not shown) (33). We used Western analyses of the BW x MP-hOct1.1.2 hybrids to look for a correlation between level of hOct1.1.2 transgene expression and the level at which rescued genes were expressed (Fig. 8Go).

Overall, there was correlation among the rescued genes: hybrids making abundant {kappa}-L chain were also making relatively abundant OCA-B and were making discernible mOct-2 (e.g., 1.1.2 hybrids 3.17, 7.5, 7.8, and 7.9). Therefore, as we have seen before with hOct-2-expressing hybrids, there was coordinate rescue of multiple plasmacytoma-specific genes. However, there was not a strict correlation between hOct1.1.2 levels and the expression levels of these rescued genes. For example, 1.1.2 hybrid 7.8 made significantly more flu-tagged hOct1.1.2 than the other hybrids, but did not make more mOct-2, OCA-B, or Ig{kappa} protein. Similarly, 1.1.2 hybrid 7.13 made flu-tagged hOct1.1.2 at the same level as 1.1.2 hybrids 3.17, 7.5, and 7.9, but made significantly less mOct-2, OCA-B, and {kappa} protein than the latter three hybrids. These analyses were repeated several times, using several independent isolations of protein. The relationships exemplified in Fig. 8Go were maintained. It should be noted that one of the hybrids initially classified as Iglow by Northern blot lost expression of the flu-tagged 1.1.2 protein during culturing. In this hybrid (3.14), mOct-2, OCA-B, and {kappa}-L chain expression ceased as well (Fig. 8Go).

As noted above and summarized in the Table IGo, not all of the Oct1.1.2 hybrids (10 of 45 hybrids) showed rescue of plasmacytoma-specific genes. In addition to ELISA analyses (data not shown) and Northern blot analyses (Fig. 9GoB), Western blot analyses were done on some of these hybrids. Again, there was no clear correlation with Oct1.1.2 protein levels. As shown in Fig. 8Go, Ig-negative hybrids 7.41, 3.30, and 3.27 made as much or more flu-tagged Oct1.1.2 than the Ig-rescued hybrids (e.g., compare hybrids 7.9 and 7.41, Fig. 8Go). The same hybrids were J chain mRNA negative (Fig. 9GoB) and Ig negative by ELISA (data not shown). Although ELISAs had initially shown these hybrids to be Ig negative, Western blots revealed a small quantity of Ig{kappa} chain in hybrid 3.30, and both this and hybrid 3.27 seemed to produce a small amount of OCA-B. This may mean that there was more gene rescue with this chimeric protein than we initially assumed, but the expression levels of the rescued genes vary over a large enough range to make it sometimes difficult to distinguish low expressors from nonexpressors. In any case, there was again no strict correlation between Oct1.1.2 levels in the hybrids and the level of plasmacytoma-specific gene products.

The hybrid lines expressing Oct2.2.1 differed markedly from those expressing Oct-2 or any of the other chimeric proteins. In the Oct2.2.1 hybrids, there was never any evidence of plasmacytoma-specific gene expression (Figs. 7Go and 8Go, and Table IGo). This was true, despite the fact that the 2.2.1 hybrids produced copious amounts of the hOct2.2.1 chimeric protein (Fig. 8Go).

In summary, the chimeric Oct proteins that carried the C-terminal domain of Oct-2 were able to coordinately rescue (sustain) expression of multiple plasmacytoma-specific genes in plasmacytoma x T lymphoma hybrids. In most cases, rescue was seen in 100% of hybrids. In hybrids expressing Oct1.1.2, rescue was lower, but approached 80% of hybrids. The level of expression of the rescued genes varied among the hybrids, suggesting that additional factor(s) further modulates expression of these genes. This was evident in hybrids rescued by Oct-2 (33), Oct1.2.2, Oct2.1.2 (Fig. 5Go and data not shown), and Oct1.1.2. However, a chimeric Oct-2 protein missing its C-terminal domain (replaced by that of Oct-1) had no rescue function at all; all hybrids expressing this protein lacked plasmacytoma-specific gene expression.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In previous studies, we showed that Oct-2 was essential to preservation of the genetic program of the Ig-secreting cell in the context of a cell fusion system (33). Endogenously encoded Oct-1 (from the Pou2f1 locus) could not mimic Oct-2 function in these cells. In the present study, we have shown that introduction of a hOct-1 transgene under viral promoter control has no effect on hybrid cell phenotype. However, if the C-terminal domain of Oct-1 is replaced by that of Oct-2, as in the hOct1.1.2 chimera, >75% of resulting hybrids express endogenous Ig, Pou2f2, PU.1, OCA-B, and J chain loci. The reciprocal chimera, hOct2.2.1, does not rescue any of the assayed plasmacytoma-specific genes from gene silencing. Therefore, the C-terminal domain of Oct-2 is critical to the program-preserving activity of Oct-2.

The fact that hOct-2 and, similarly, hOct1.1.2 rescue the expression of endogenous, mOct-2 suggests that the Pou2f2 locus is subject to regulation by its own gene product (33 and present study). Because the chimeric protein rescues endogenous Oct-2 expression, it is formally possible that only the Pou2f2 locus can be activated directly by this modified protein (lacking the N-terminal and POU domains of Oct-2), and that other genes rescued by expression of Oct1.1.2 are actually dependent upon the endogenous and intact Oct-2 for their expression. Consistent with this possibility is the fact that mOct-2 levels correlated fairly well with the level of both OCA-B and Ig{kappa} in the 1.1.2 hybrids, whereas hOct1.1.2 levels did not (Fig. 8Go). It is certainly possible that different regions of the Oct-2 protein are required for regulation of different target genes (e.g., when bound to a promoter or enhancer for one gene, Oct-2 may recruit proteins that bind to its C-terminal domain, but when bound to the promoter/enhancer of another gene, there may be a requirement for proteins that bind to both the N- and C-terminal domains of Oct-2). Further studies, such as chimeric gene rescue of the Pou2f2 knockout mice (Oct-2 deficient), are required before these possibilities can be explored. In any case, it is clear from the present experiments that the C-terminal domain of Oct-2 lies at the apex of the gene-regulatory cascade in Ig-secreting cells.

Earlier studies with synthetic reporter genes have similarly attributed unique functions to the C-terminal domain of Oct-2. Namely, the ability of this factor to activate octamer-dependent enhancers, as distinct from octamer-dependent promoters, appears to be dependent upon the presence of this domain (35, 36, 37).

However, the latter studies used synthetic, octamer-dependent enhancers, and it was not clear how the results translated to effects on endogenous genes. This was problematic, particularly in view of the fact that, when measured in transient assays, natural, octamer-containing enhancers (e.g., the IgH intronic enhancer Eµ) often retained significant activity after octamer site mutation (52, 53). In the present study, we were able to perform a structure-function assay of Oct-2 in which we were measuring effects on the natural target genes of this transcription factor. Again, we found a critical requirement for the C-terminal domain of Oct-2.

As shown in these and our previous studies, hOct-2 (and the chimeric proteins hOct1.1.2, 2.1.2, and 1.2.2) rescued the expression of the transcription factor PU.1 (33 and present study). Although gene knockout studies suggest that PU.1 expression is not dependent upon Oct-2 in early B cells (compare phenotypes, reviewed in Refs. 54 and 55), it is not surprising that transcriptional regulation of this and other genes would change as B cells are induced to differentiate into Ig-secreting plasmacytes. This is certainly the case for the IgH locus (56, 57). The cell fusion system we describe can be used to further delineate the hierarchy of action of these and other B cell-specific genes within Ig-secreting cells. For example, experiments in progress will determine how sustained expression of PU.1 in cell hybrids affects Oct-2 expression, allowing us to determine whether these transcription factors act reciprocally in these cells or, rather, the PU.1 gene lies in a subordinate position relative to Oct-2.

We have previously postulated the involvement of another B cell-restricted factor in the program-sustaining activity of Oct-2 (hypothetical B cell accessory factor) (33). Others have also invoked such a factor to explain why Oct-2 is able to transactivate octamer-dependent enhancers only in B lineage cells (35, 36, 37). Although OCA-B, bound to the POU domain of Oct-2, may be required for one or more of the functions of Oct-2 in Ig-secreting cells, there is a further requirement for some type of interaction between the transcriptional machinery of the cell and the C-terminal domain of Oct-2. It is possible that another tissue-specific protein is involved in this interaction as well. Studies are underway to explore this possibility and to further elucidate the mechanism by which the C-terminal domain of Oct-2 mediates its function.


   Acknowledgments
 
We gratefully acknowledge gifts of chimeric Oct-1/Oct-2 genes from Dr. Winship Herr (Cold Spring Harbor Laboratories, Cold Spring Harbor, NY), and anti-OCA-B antiserum from Dr. Robert Roeder (The Rockefeller University). We thank Ryszard Stawowy for expert technical assistance, and Drs. Betty Diamond (Albert Einstein College of Medicine, Bronx, NY) and Michael Young (The Rockefeller University) for critical reading of the manuscript.


   Footnotes
 
1 This work was supported by Public Health Service Grant CA-62363 from the National Cancer Institute, and by Professional Staff Congress-City University of New York Awards 665140, 667157, and 668189 (to L.A.E.). Research Centers in Minority Institutions Award RR-03037 from the National Center for Research Resources of the National Institutes of Health, which supports the infrastructure and instrumentation of the Biological Sciences Department at Hunter College, is also acknowledged. Back

2 Address correspondence and reprint requests to Dr. Laurel A. Eckhardt, Department of Biological Sciences, Hunter College, City University of New York, 695 Park Avenue, New York, NY 10021. E-mail address: eckhardt{at}genectr.hunter.cuny.edu Back

3 Abbreviation used in this paper: hOct, human Oct; mOct, murine Oct. Back

Received for publication June 25, 2001. Accepted for publication August 8, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Staudt, L. M., H. Singh, R. Sen, T. Wirth, P. A. Sharp, D. Baltimore. 1986. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature 323:640.[Medline]
  2. Singh, H., R. Sen, D. Baltimore, P. A. Sharp. 1986. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature 319:154.[Medline]
  3. Rosales, R., M. Vigeron, M. Macchi, I. Davidson, T. H. Xian, P. Chambon. 1987. In vitro binding of cell-specific and ubiquitous nuclear proteins to the octamer motif of the SV40 enhancer and related motives present in other promoters and enhancers. EMBO J. 6:3015.[Medline]
  4. Scheidereit, C., A. Heguy, R. G. Roeder. 1987. Identification and purification of a human lymphoid-specific octamer-binding protein (OTF-2) that activates transcription of an immunoglobulin promoter in vitro. Cell 51:783.[Medline]
  5. Landolfi, N. F., J. D. Capra, P. W. Tucker. 1986. Interaction of cell-type-specific nuclear proteins with immunoglobulin VH promoter region sequences. Nature 323:548.[Medline]
  6. Sturm, R. A., W. Herr. 1988. The POU domain is a bipartite DNA-binding structure. Nature 336:601.[Medline]
  7. Ko, H. S., P. Fast, W. McBride, L. M. Staudt. 1988. A human protein specific for the immunoglobulin octamer DNA motif contains a functional homeobox domain. Cell 55:135.[Medline]
  8. Clerc, R. G., L. M. Corcoran, J. H. LeBowitz, D. Baltimore, P. A. Sharp. 1988. The B-cell specific Oct-2 protein contains POU-box and homeo-box-type domains. Genes Dev. 2:1570.[Abstract/Free Full Text]
  9. Herr, W., R. A. Sturm, R. G. Clerc, L. M. Corcoran, D. Baltimore, P. A. Sharp, H. A. Ingraham, M. G. Rosenfeld, M. Finney, G. Ruvkun, H. R. Horvitz. 1988. The POU domain: a large conserved region in the mammalian pit-1, oct-1, oct-2, and Caenorhabditis elegans unc-86 gene products. Genes Dev. 2:1513.[Free Full Text]
  10. Rosenfeld, M. G.. 1991. POU-domain transcription factors: pou-er-ful developmental regulators. Genes Dev. 5:897.[Free Full Text]
  11. Herr, W., M. A. Cleary. 1995. The POU domain: versatility in transcriptional regulation by a flexible two in one DNA binding domain. Genes Dev. 9:1679.[Free Full Text]
  12. Lai, J. S., M. A. Cleary, W. Herr. 1992. A single amino acid exchange transfers VP-16-induced positive control from the Oct-1 to the Oct-2 homeo domain. Genes Dev. 6:2058.[Abstract/Free Full Text]
  13. Tanaka, M., W. Herr. 1990. Differential transcriptional activation by Oct-1 and Oct-2: interdependent activation domains induce Oct-2 phosphorylation. Cell 60:375.[Medline]
  14. Sturm, R. A., G. Das, W. Herr. 1988. The ubiquitous octamer-binding protein Oct-1 contains a POU domain with a homeo box subdomain. Genes Dev. 2:1582.[Abstract/Free Full Text]
  15. Muller, M. M., S. Ruppert, W. Schaffner, P. Matthias. 1988. A cloned octamer transcription factor stimulates transcription from lymphoid-specific promoters in non-B cells. Nature 336:544.[Medline]
  16. Scheidereit, C., J. A. Cromlish, T. Gerster, K. Kawakami, C. G. Balmaceda, R. A. Currie, R. G. Roeder. 1988. A human lymphoid-specific transcription factor that activates immunoglobulin genes is a homeobox protein. Nature 336:551.[Medline]
  17. Wirth, T., L. Staudt, D. Baltimore. 1987. An octamer oligonucleotide upstream of a TATA motif is sufficient for lymphoid-specific promoter activity. Nature 329:174.[Medline]
  18. Johnson, D. G., L. Carayannopoulos, J. D. Capra, P. W. Tucker, J. H. Hanke. 1990. The ubiquitous octamer-binding protein(s) is sufficient for transcription of immunoglobulin genes. Mol. Cell. Biol. 10:982.[Abstract/Free Full Text]
  19. LeBowitz, J. H., T. Kobayashi, L. Staudt, D. Baltimore, P. A. Sharp. 1988. Octamer-binding proteins from B or HeLa cells stimulate transcription of the immunoglobulin heavy-chain promoter in vitro. Genes Dev. 2:1227.[Abstract/Free Full Text]
  20. Pierani, A., A. Heguy, H. Fujii, R. G. Roeder. 1990. Activation of octamer containing promoters by either octamer binding transcription factor 1 (OTF-1) or OTF-2 and requirement of an additional B cell specific component for optimal transcription of immunoglobulin promoters. Mol. Cell. Biol. 10:6204.[Abstract/Free Full Text]
  21. Luo, Y., H. Fujii, T. Gerster, R. G. Roeder. 1992. A novel B cell-derived coactivator potentiates the activation of immunoglobulin promoters by octamer-binding transcription factors. Cell 71:231.[Medline]
  22. Luo, Y., R. G. Roeder. 1995. Cloning, functional characterization, and mechanism of action of the B-cell-specific transcriptional coactivator OCA-B. Mol. Cell. Biol. 15:4115.[Abstract]
  23. Gstaiger, M., L. Knoepfel, O. Georgiev, W. Schaffner, C. M. Hovens. 1995. A B-cell coactivator of octamer-binding transcription factors. Nature 373:360.[Medline]
  24. Strubin, M., J. W. Newwell, P. Matthias. 1995. OBF-1, a novel B cell-specific coactivator that stimulates immunoglobulin promoter activity through association with octamer-binding proteins. Cell 80:497.[Medline]
  25. Corcoran, L. M., M. Karvelas, G. J. Nossal, Z. S. Ye, T. Jacks, D. Baltimore. 1993. Oct-2, although not required for early B-cell development, is critical for later B-cell maturation and for postnatal survival. Genes Dev. 7:570.[Abstract/Free Full Text]
  26. Schubart, D. B., A. Rolink, M. H. Kosco-Vilbois, F. Botteri, P. Matthias. 1996. B-cell-specific coactivator OBF-1/OCA-B/Bob-1 required for immune response and germinal centre formation. Nature 383:538.[Medline]
  27. Kim, U., X. F. Qin, S. Gong, S. Stevens, Y. Luo, M. Nussenzweig, R. G. Roeder. 1996. The B-cell-specific transcriptional coactivator OCA-B/OBF-1/Bob-1 is essential for normal production of immunoglobulin isotypes. Nature 383:542.[Medline]
  28. Schubart, K., M. Steffen, D. Schubart, L. M. Corcoran, A. G. Rolink, P. Matthias. 2001. B cell development and immunoglobulin gene transcription in the absence of Oct-2 and OBF-1. Nat. Immun. 2:69.[Medline]
  29. Corcoran, L. M., M. Karvelas. 1994. Oct-2 is required early in T cell-independent B cell activation for G1 progression and for proliferation. Immunity 1:6553.
  30. Nielsen, P. J., O. Georgiev, B. Lorenz, W. Schaffner. 1996. B lymphocytes are impaired in mice lacking the transcriptional co-activator Bob1/OCA-B/OBF1. Eur. J. Immunol. 26:3214.[Medline]
  31. Humbert, P. O., L. M. Corcoran. 1997. oct-2 gene disruption eliminates the peritoneal B-1 lymphocyte lineage and attenuates B-2 cell maturation and function. J. Immunol. 159:5237.
  32. Qin, X. F., A. Reichlin, Y. Luo, R. G. Roeder, M. C. Nussenzweig. 1998. OCA-B integrates B cell antigen receptor-, CD40L- and IL 4-mediated signals for the germinal center pathway of B cell development. EMBO J. 17:5066.[Medline]
  33. Radomska, H. S., C. P. Shen, T. Kadesch, L. A. Eckhardt. 1994. Constitutively expressed Oct-2 prevents immunoglobulin gene silencing in myeloma x T cell hybrids. Immunity 1:623.[Medline]
  34. Lieberman, S. A., M. D. Hines, P. L. Bergsagel, W. M. Kuehl, L. A. Eckhardt. 1993. Coordinate silencing of myeloma-specific genes in myeloma x T lymphoma hybrids. J. Immunol. 151:2588.[Abstract]
  35. Annweiler, A., M. Muller-Immergluck, T. Wirth. 1992. Oct2 transactivation from a remote enhancer position requires a B-cell-restricted activity. Mol. Cell. Biol. 12:3107.[Abstract/Free Full Text]
  36. Seipel, K., O. Georgiev, W. Schaffner. 1992. Different activation domains stimulate transcription from remote ("enhancer") and proximal ("promoter") positions. EMBO J. 11:4961.[Medline]
  37. Pfisterer, P., A. Annweiler, C. Ullmer, L. M. Corcoran, T. Wirth. 1994. Differential transactivation potential of Oct1 and Oct2 is determined by additional B cell-specific activities. EMBO J. 13:1654.[Medline]
  38. Van Doren, K., D. Hanahan, Y. Gluzman. 1984. Infection of eucaryotic cells by helper-independent recombinant adenoviruses: early region 1 is not obligatory for integration of viral DNA. J. Virol. 50:606.[Abstract/Free Full Text]
  39. Hartman, S. C., R. C. Mulligan. 1988. Two dominant-acting selectable markers for gene transfer studies in mammalian cells. Proc. Natl. Acad. Sci. USA 85:8047.[Abstract/Free Full Text]
  40. Laskov, R., M. D. Scharff. 1970. Synthesis assembly and secretion of {gamma} globulin by mouse myeloma cells. I. Adoption of the MPC-11 tumor to culture, cloning and characterization of {gamma} globulin subunits. J. Exp. Med. 131:515.[Abstract]
  41. Radomska, H. S., L. A. Eckhardt. 1995. Mammalian cell fusion in an electroporation device. J. Immunol. Methods 188:209.[Medline]
  42. Marcu, K. B., J. Banerji, N. A. Penncavage, R. Lang, N. Arnheim. 1980. 5' flanking region of immunoglobulin heavy chain constant region genes displays length heterogeneity in germlines of inbred mouse strains. Cell 22:187.[Medline]
  43. Lang, R. B., L. W. Stanton, K. B. Marcu. 1982. On immunoglobulin heavy chain gene switching: two Y2b genes are rearranged via switch sequences in MPC-11 cells but only one is expressed. Nucleic Acids Res. 10:611.[Abstract/Free Full Text]
  44. Seidman, J. G., P. Leder. 1980. A mutant immunoglobulin light chain is formed by aberrant DNA- and RNA-splicing events. Nature 286:779.[Medline]
  45. Cann, G. M., A. Zaritsky, M. E. Koshland. 1982. Primary structure of the immunoglobulin J chain from the mouse. Proc. Natl. Acad. Sci. USA 79:6656.[Abstract/Free Full Text]
  46. Klemsz, M. J., S. R. McKercher, A. Celada, C. VanBeveren, R. A. Maki. 1990. The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell 61:113.[Medline]
  47. Yu, H., B. Porton, L. Shen, L. A. Eckhardt. 1989. Role of the octamer motif in hybrid cell extinction of immunoglobulin gene expression; extinction is dominant in a two enhancer system. Cell 58:441.[Medline]
  48. Field, J., J. Nikawa, D. Broek, B. MacDonald, L. Rodgers, I. A. Wilson, R. A. Lerner, M. Wigler. 1988. Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8:2159.[Abstract/Free Full Text]
  49. Yu, H., L. A. Eckhardt. 1986. DNA rearrangement causes a high rate of spontaneous mutation at the immunoglobulin heavy-chain locus of a mouse myeloma cell line. Mol. Cell. Biol. 6:4228.[Abstract/Free Full Text]
  50. Maniatis, T., E. Fritsch, J. Sambrook. 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratories, Cold Spring Harbor.
  51. Zaller, D. M., H. Yu, L. A. Eckhardt. 1988. Genes activated in the presence of an immunoglobulin enhancer or promoter are negatively regulated by a T-lymphoma cell line. Mol. Cell. Biol. 8:1932.[Abstract/Free Full Text]
  52. Lenardo, M., J. W. Pierce, D. Baltimore. 1987. Protein-binding sites in Ig gene enhancers determine transcriptional activity and inducibility. Science 236:1573.[Abstract/Free Full Text]
  53. Kiledjian, M., L. K. Su, T. Kadesch. 1988. Identification and characterization of two functional domains within the murine heavy-chain enhancer. Mol. Cell. Biol. 8:145.[Abstract/Free Full Text]
  54. Matthias, P.. 1998. Lymphoid-specific transcription mediated by the conserved octamer site: who is doing what?. Semin. Immunol. 10:155.[Medline]
  55. Simon, M. C.. 1998. PU.1 and hematopoiesis: lessons learned from gene targeting experiments. Semin. Immunol. 10:111.[Medline]
  56. Arulampalam, V., L. Eckhardt, S. Pettersson. 1997. The enhancer shift: a model to explain the developmental control of IgH gene expression in B-lineage cells. Immunol. Today 18:549.[Medline]
  57. Ong, J., S. Stevens, R. G. Roeder, L. A. Eckhardt. 1998. 3' IgH enhancer elements shift synergistic interactions during B cell development. J. Immunol. 160:4896.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
I. Ahmad, D. C. Hoessli, E. Walker-Nasir, S. M. Rafik, A. R. Shakoori, and Nasir-ud-Din
Oct-2 DNA binding transcription factor: functional consequences of phosphorylation and glycosylation
Nucleic Acids Res., January 8, 2006; 34(1): 175 - 184.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. M. Corcoran, F. Koentgen, W. Dietrich, M. Veale, and P. O. Humbert
All Known In Vivo Functions of the Oct-2 Transcription Factor Require the C-Terminal Protein Domain
J. Immunol., March 1, 2004; 172(5): 2962 - 2969.
[Abstract] [Full Text] [PDF]

Home page