The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petry, F.
Right arrow Articles by Loos, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petry, F.
Right arrow Articles by Loos, M.
The Journal of Immunology, 2001, 167: 4033-4037.
Copyright © 2001 by The American Association of Immunologists

Reconstitution of the Complement Function in C1q-Deficient (C1qa-/-) Mice with Wild-Type Bone Marrow Cells1

Franz Petry2,*, Marina Botto{ddagger}, Rafaela Holtappels{dagger}, Mark J. Walport{ddagger} and Michael Loos*

* Institute of Medical Microbiology and Hygiene and {dagger} Institute of Virology, Johannes Gutenberg-University, Mainz, Germany; and {ddagger} Rheumatology Section, Imperial College School of Medicine, London, United Kingdom


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Besides Ab-independent and Ab-dependent activation of the complement classical pathway in host defense, C1q plays a key role in the processing of immune complexes and in the clearance of apoptotic cells. In humans, C1q deficiency leads to systemic lupus erythematosus-like symptoms in over 90% of the cases, thus making this defect a strong disease susceptibility factor. Similarly, C1q-deficient mice (C1qa-/-) develop systemic lupus erythematosus-like symptoms, such as autoantibodies and glomerulonephritis. We have previously provided evidence that C1q is produced by cells of the monocyte-macrophage lineage. In this study, we have tested whether transplantation of bone marrow cells would be sufficient to reconstitute C1q levels in C1qa-/- mice. C1qa-/- mice received a single graft of 107 bone marrow cells from wild-type (wt) donors after irradiation doses of 6, 7, 8, or 9 Gy. Engraftment was monitored by a Y chromosome-specific PCR and a PCR that differentiated wt from C1qa-/- genotype. Serum levels of C1q Ag and C1 function increased rapidly in the recipient mice, and titers reached normal levels within 6 wk after bone marrow transplantation. In wt mice that received C1qa-/- bone marrow, serum levels of C1q decreased constantly over time and became C1q deficient within 55 wk. These data clearly demonstrate that bone marrow-derived cells are the source of serum C1q and are competent to reconstitute normal C1q serum levels in C1q-deficient mice. Therefore, stem cell transplantation could be a therapy for patients with hereditary C1q deficiency.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The complement component C1q plays an important role in host immune responses. C1q initiates the classical pathway activation of the complement system by binding to microbial ligands (innate immunity) or to Ag-Ab complexes (immune complexes, ICs)3 via the Fc region of IgG and IgM molecules (adaptive immunity). Absence of C1q, as in hereditary C1q deficiency, leads to recurrent infections, demonstrating the role of C1q in host defense (1, 2). A second important function of C1q is linked with the clearance of ICs and the development of autoimmunity in cases of total or partial deficiency. C1q prevents the formation of large IC lattices. Pathological conditions such as systemic lupus erythematosus (SLE) lead to IC deposition, inflammation, and tissue damage. Patients with SLE develop secondary C1q deficiency due to C1q consumption in the acute phases of the disease, and they also generate autoantibodies against C1q (3). A third function of C1q has been recognized only recently. It has been demonstrated that the surface blebs of apoptotic cells bind C1q directly in the absence of Ig (4). Furthermore, C1q-deficient mice showed numerous apoptotic bodies in inflamed glomeruli (5). Both findings suggest a crucial role of C1q in the clearance of apoptotic cells, which has been demonstrated by Taylor et al. (6).

Hereditary C1q deficiency is strongly linked with SLE-like disease. Of 41 C1q-deficient patients described in the literature, 38 presented with SLE-like symptoms, including generation of autoantibodies, glomerulonephritis, and involvement of the CNS (3). Attempts to treat patients with hereditary C1q deficiency with fresh-frozen plasma as a source of C1q have been disappointing, as C1q levels dropped within hours after transfusion (7). Preformed ICs appeared to have fixed C1q, causing rapid depletion of infused C1q.

The generation of a C1q-deficient mouse model has opened new perspectives to study and understand the various biological roles of C1q. Whereas the majority of complement components are synthesized by hepatocytes, accumulating evidence has shown that the cells of the monocyte/macrophage lineage are responsible for the production of C1q (8, 9, 10, 11, 12, 13). As these cells derive from precursors of hemopoietic stem cells, we tested the hypothesis that bone marrow cells (BMC) are capable and sufficient to reconstitute C1q serum levels in C1qa-/- mice.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mouse strains and bone marrow transplantation (BMT)

C1qa-/- mice used were on a hybrid genetic background (129/Sv x C57BL/6) or backcrossed onto C57BL/6 for seven generations, as specified in each experiment, and were generated as previously described (5). Age- and sex-matched wild-type (wt) (129/Sv x C57BL/6 and C57BL/6) mice were used as controls. Animals were bred under specific pathogen-free conditions and kept in filtered cages during the experiments.

Recipient mice, generally 10–16 wk of age, received a total body {gamma}-irradiation dose of 6–9 Gy delivered by a 137Cs {gamma}-ray source. Donor femoral and tibial BMC were isolated by flushing medium through the bone shafts, washed three times, and filtered through nylon gauze to remove large particles. Recipients received 107 donor BMC of the opposite sex suspended in medium, which were infused i.v. into the tail veins within 6 h after irradiation. Starting at 2 wk after transplant, mice were bled by tail vein incision at various time points up to 55 wk.

PCR conditions

The successful reconstitution of the hemopoietic lineages after BMT was monitored by a Y chromosome-specific PCR. Blood leukocytes from recipient mice were used as a source of genomic DNA, which was prepared by the Chelex-100 method from whole blood (14). A 402-bp DNA fragment of the male sex-determining gene tdy (15) was amplified by PCR, as described (16). Two PCR that discriminate wt from C1qa-/- genotype were used to screen the recipient mice. For the amplification of an ~380-bp DNA fragment of the wt genotype, the primer pair mC1qA/5'+ (GGGGCCTGTGATCCAGACAG; a sequence within exon 1 of the C1qa gene) and mC1qA/In1- (ACCAATCGCTTCTCAGGACC; a sequence within intron 1 of the C1qa gene) were used. An ~180-bp fragment of the C1qa-/- genotype was received using primers mC1qA/In1- and NEO (GGGGATCGGCAATAAAAAGAC; a sequence within the neomycin resistance gene of the gene-targeting construct). PCR amplification for both primer combinations was conducted for 3 min at 94°C, followed by 30 cycles of 60 s at 94°C, 30 s at 64°C, 30 s at 72°C, and finally 10 min at 72°C. Amplification products were visualized by ethidium bromide-stained agarose gel electrophoresis.

Northern blot analysis and RT-PCR

At various time points, individual mice were sacrificed and total RNA was extracted from various tissues using standard methods (17, 18). Electrophoresis, blotting, and hybridization of RNA and labeling of cloned mouse C1qa cDNA were performed, as described (19). To amplify C1qa gene transcripts, a RT-PCR was performed using intron flanking primers (MA-5/INT, ACAGTGGCTGAAGATGTCTG; MA-INT/3, CTGGTCCCTGATATTGCCTG), which can differentiate mRNA from genomic DNA PCR products. cDNA was synthesized from 4 to 8 µg RNA, as previously described (20). RT-PCR amplification was conducted for 3 min at 94°C, followed by 35 cycles of 45 s at 94°C, 45 s at 60°C, 60 s at 72°C, and finally 10 min at 72°C. Amplification of C1qa mRNA sequence results in an amplicon size of 279 bp.

Complement assays

Functional activity of serum C1q in C1qa-/-, wt, and mice after BMT was measured in a hemolytic C1 test, as described for human C1 (21), with purified guinea pig C4 and C2 preparations and EDTA-treated guinea pig serum as a source for C3 to C9 components.

C1q Ag was estimated in an ELISA. Microtiter plates (Maxisorb; Nunc, Wiesbaden, Germany) were coated with 0.3 µg total mouse IgG1 (M-9269; Sigma, Deisenhofen, Germany) and blocked with 1% BSA in PBS. Serum samples were diluted 1/50 and incubated in coated plates for 1 h at room temperature. After two washes with PBS-0.05% Tween 20, bound C1q was incubated with a biotinylated goat anti-mouse C1q Ab (IgG preparation preadsorbed with mouse IgG) for 30 min, followed by two washes with PBS-Tween 20. Biotinylated anti-C1q was detected with an avidin-peroxidase conjugate (Sigma). Plates were washed and incubated with ABTS. OD was measured at 402 nm.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Control of graft establishment

In preliminary experiments, the optimal irradiation dose that gave an efficient engraftment of donor BMC without causing mortality within the first 2 wk after irradiation was determined. Mice were irradiated with doses of 6–9 Gy and were given 107 BMC within 6 h after irradiation. In the group that received 9 Gy, over 50% (five of nine mice) died within the first week of the experiment; no mice of the other groups died in that period. A dose of 8 Gy was found to be optimal in terms of survival rates and the time frame necessary for a successful engraftment; therefore, it was applied in subsequent experiments. Recipient mice were screened for circulating donor-type leukocytes using a Y chromosome-specific PCR for the tdy gene and a second PCR for detection of wt or C1qa-/- genotypes. Two weeks after BMT, the tdy gene could be detected in DNA preparations from blood leukocytes in almost every female recipient of male BMC and in none of the male recipients of female bone marrow (Fig. 1GoA). In some wt males that received female BMC, the tdy gene could be amplified 6 wk posttransplant. Using the discriminating C1qa gene PCR, a complete conversion of the genotype was seen at this time point in all recipient mice (Fig. 1GoB). The same results were obtained from mice on hybrid 129/Sv x C57BL/6 genetic background as well as mice on C57BL/6 genetic background.



View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 1. Control of engraftment of donor BMC in irradiated recipient mice. Agarose gel electrophoresis of PCR products for the detection of Y chromosome tdy gene (A) and for differentiation of C1q genotypes (B) amplified from blood leukocyte DNA. A, Recipient mice were transplanted with 107 donor BMC of the opposite sex after receiving an irradiation dose of 8 Gy. Recipient and donor mice were of mixed 129/Sv x C57BL/6 genetic background. At wk 2 and 6 posttransplant in almost every female recipient, male donor-derived circulating leukocytes were detectable. In male recipients, the tdy gene was absent at wk 2, but was detectable again at wk 6 posttransplant in some mice. B, C1qa-/- recipients showed a complete conversion of the C1q genotype posttransplant.

 
Gene expression

RT-PCR experiments showed that within 2 wk after BMT, organs of C1qa-/- recipients were colonized by wt donor cells expressing normal C1q. C1qa mRNA-specific PCR products could be demonstrated in cDNA preparations of peritoneal cells, heart, liver, spleen, and kidney (Fig. 2GoA). Northern blot experiments confirmed these results. An increase of C1qa mRNA over time could be shown in C1qa-/- mice reconstituted with wt BMC, whereas no specific hybridization was detected in mRNA from untreated C1qa-/- control mouse spleen (Fig. 2GoB). C1qa-/- mice that received C1qa-/- BMC had no detectable C1qa mRNA levels, whereas wt mice reconstituted with wt BMC showed hybridization signals comparable with untreated wt controls. Similar results were seen in RNA preparations from liver, heart, and kidney (results not shown). At wk 4 after BMT, the Northern blot hybridization signal from thioglycolate-stimulated peritoneal cells in C1qa-/- recipients reconstituted with wt BMC was indistinguishable from wt recipients reconstituted with wt BMC and nontreated wt mice, whereas in C1qa-/- recipients receiving C1qa-/- BMC, no C1qa mRNA was detectable even after prolonged exposure of the Northern blot (Fig. 2GoC).



View larger version (56K):
[in this window]
[in a new window]
  		FIGURE 2. C1qa gene expression in engrafted recipients. All recipients in this experiment were preconditioned with an irradiation dose of 6 Gy. C1qa-/- mice and wt mice were of mixed 129/Sv x C57BL/6 genetic background, except where noted differently. A, Agarose gel electrophoresis of RT-PCR products for the detection of C1qa mRNA. Lane 1, cDNA preparation from wt spleen; lanes 2–6, cDNA preparations from C1qa-/- mice at wk 2 posttransplant, as specified; lane 7, cDNA preparation from wt DBA1 mice; marker (100-bp ladder). B, Agarose gel electrophoresis (top) and Northern blot hybridization (bottom) of spleen RNA preparations from C1qa-/- recipients + wt BMC at wk 2, 3, and 4 (lanes 2–4). Lane 1, Untreated C1qa-/-; lane 5, C1qa-/- recipients + C1qa-/- BMC; lane 6, wt recipient + wt BMC; lane 7, untreated wt; lane 8, untreated wt C57BL/6. C, Agarose gel (top) and Northern blot (bottom) of peritoneal cell RNA from recipients 4 wk posttransplant. Mice were stimulated with thioglycolate medium i.p. 4 days before cell harvest. Blots in B and C were hybridized with a C1qa cDNA-specific probe. Exposure times, 7 days (B) and 16 h (C). The size of the C1qa mRNA is indicated.

 
Detection of C1q Ag and functional activity in sera of reconstituted mice

Functional activity of C1q was tested in a hemolytic C1 assay. In C1qa-/- mice on the hybrid 129/Sv x C57BL/6 genetic background reconstituted with wt BMC, C1 functional activity was in the range of C1 titers of wt mice within 4–6 wk after transplant (Fig. 3GoA). In the reciprocal experiment, C1 titers decreased over time. Six to 8 wk posttransplant, recipients irradiated with 8 and 9 Gy had C1 titers below the range of wt control mice. However, C1 titers in mice irradiated with only 7 Gy were still in the range of normal C1 function (Fig. 3GoC). In this study, the loss of C1 function over time was proportional to the irradiation dose received. This phenomenon was less pronounced in C1qa-/- recipients. Similar results were obtained testing the sera at different time points with the C1q-ELISA, described in Materials and Methods. In C1qa-/- mice receiving wt BMC, C1q antigenic levels increased rapidly after 2 wk post-BMT and reached levels within the range of wt control sera within 4 wk (Fig. 3GoB). The decrease of C1q serum levels was less pronounced in wt recipients receiving C1qa-/- BMC (Fig. 3GoD). As seen for C1 functional activity, changes in C1q antigenic levels were dependent on the irradiation dose.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 3. C1 functional activity and C1q antigenic levels in reconstituted mice. A and B, Represent the C1 function and C1q ELISA results of C1qa-/- mice (mixed 129/Sv x C57BL/6 background) reconstituted with 107 wt (129Sv x C57BL/6) BMC after total body irradiation with 7–9 Gy. In C and D, the results of wt recipients (129/Sv x C57BL/6) that received C1qa-/- BMC are shown. Individual graphs represent the mean values of several mice (numbers of mice in each group are given in parentheses; error bars = SEM). C1 function is expressed as the percentage of the mean of 20 wt mice. Gray areas represent the range of C1 function in these control mice.

 
When C1qa-/- mice on the C57BL/6 background became available, experiments were repeated with 10 mice per group. Mice were monitored over a period of 55 wk after BMT. Analysis of the C1q genotype of these mice gave similar results as those obtained in the previous three BMT experiments. Fig. 4Go represents the results of the C1q ELISA of each recipient at all time points. An increase of C1q Ag can be seen in C1qa-/- mice as a result of wt BMC engraftment. By wk 6 post-BMT, each recipient had C1q antigenic concentrations in the normal range. Seven of ten mice remained within that range until the end of the experiment at wk 55 post-BMT. Of the three mice that dropped below that range, one mouse did not receive the full 107 BMC due to a leakage of the vein during injection. Another mouse in which C1q levels dropped dramatically after wk 32 died at wk 53.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 4. Long-term screening of C1q antigenic levels in reconstituted mice. A, C1qa-/- mice (C57BL/6 background) reconstituted with 107 C57BL/6 wt BMC after total body irradiation with 8 Gy. B, C57BL/6 wt mice reconstituted with C1qa-/- BMC. Graphs represent C1q levels for each individual mouse (•). The mean value for all mice is also shown ({square}). Gray areas at the top of each figure part mark the range of C1q levels in wt mice from a pretransplant bleeding. Areas near the abscissa show the range of ELISA values in sera of C1qa-/- mice before transplantation. Note the change of the time scale at wk 10 posttransplant.

 
Wt mice that received C1qa-/- BMC developed a linear decrease of C1q Ag over the observation period. At wk 55 post-BMT, all but one mouse had C1q levels in the range of the ELISA values of C1qa-/- sera.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
BMT experiments were conducted to determine whether monocyte/macrophage precursors in BMC were competent and sufficient to restore the wt C1q phenotype in C1q-deficient mice. To ensure effective engraftment of hemopoietic stem cells, recipients were preconditioned with high dose total body {gamma}-irradiation. The BMT itself did not modify the C1q phenotype of the recipient, as irradiated wt mice receiving wt BMC had full C1q function, and C1qa-/- mice receiving C1qa-/- BMC tested negative (data not shown). Furthermore, C1q mRNA hybridization signals were identical in mice given homologous transplants as those seen in untreated mice (Fig. 2GoC). In mice preconditioned with 8 or 9 Gy, the heterologous donor C1q phenotype established faster than in mice given lower irradiation doses. Therefore, a total body irradiation dose of 8 Gy was used in subsequent experiments.

Accumulating data have demonstrated that the major source of C1q biosynthesis are cells of the monocyte/macrophage lineage. Functional assays, biosynthetic labeling experiments, and mRNA studies have shown that peritoneal macrophages are capable of producing C1q (8, 9, 10, 11). C1q biosynthesis could also be demonstrated in cultured peripheral blood monocytes (12, 13), follicular dendritic cells and interdigitating cells of the spleen (22), Kupffer cells of the liver (23), and microglial cells of the brain (24, 25, 26). A recent report has demonstrated C1q gene activity in nonmonocyte/macrophage neuronal cell lines by RT-PCR (27). These findings are in contrast to the majority of the other complement components for which hepatocytes are the major sites of biosynthesis.

Therefore, we tested the hypothesis that BMT, containing the precursors of monocytes/macrophages, is capable and sufficient to restore C1q levels in C1q-deficient mice. The results showed that a single graft of 107 BMC was sufficient to restore normal serum levels of C1q in genetically deficient mice. Furthermore, wt mice were made C1q deficient by a single transplant of BMC from C1qa-/- donor mice. However, there was a marked difference in the time course of the increase and decrease of C1q levels between C1qa-/- and wt mice, respectively. In C1q-deficient mice, reconstitution of C1q to normal levels was detected within 6 wk after transplantation, whereas a much slower decrease of C1q was identified in wt mice that received C1qa-/- BMC. C1q mRNA studies in C1qa-/- mice preconditioned with 6 Gy showed that within 2 wk, various organs were colonized by C1q-synthesizing donor cells (Fig. 2GoA).

Although the actual ratio of donor and recipient macrophages in the various organs was not determined with the methods applied, it is most likely that resident tissue macrophages that have been demonstrated to produce C1q in situ (22) are only slowly replaced by donor cells. The {gamma}-irradiation doses that destroy hemopoietic stem cells and other rapidly proliferating cells are ineffective for differentiated cells such as tissue macrophages. Therefore, recipient macrophages continue to produce C1q over a long period of time (i.e., months) and, as a consequence, C1q serum levels decrease only slowly in wt mice that were reconstituted with C1qa-/- BMC.

From the results of the experiments performed, we cannot determine the location of the C1q-producing cells that are responsible for the serum levels that have been measured. Apparently, only a proportion of the total C1q-producing cells is required to reach normal C1q levels in serum. This implies that even sublethal total body irradiation or other myeloablative procedures for preconditioning individuals undergoing BMT could be sufficient for correction of a hereditary C1q defect. The data presented in this work suggest that transplantation of hemopoietic stem cells, which has become more and more a routine in hematological practice, might be a potential treatment for patients with hereditary C1q deficiency.


   Acknowledgments
 
We thank Inka Kneib, Steffi Marx, and Sabine Pauls for exceptional technical assistence.


   Footnotes
 
1 This work was supported by a grant of the Deutsche Forschungsgemeinschaft (SFB 311 Project D1). Back

2 Address correspondence and reprint requests to Dr. Franz Petry, Institute of Medical Microbiology and Hygiene, Johannes Gutenberg-University Mainz, Augustusplatz/Hochhaus, D-55101 Mainz, Germany. E-mail address: fpetry{at}mail.uni-mainz.de Back

3 Abbreviations used in this paper: IC, immune complex; BMC, bone marrow cell; BMT, bone marrow transplantation; SLE, systemic lupus erythematosus; wt, wild type. Back

Received for publication June 18, 2001. Accepted for publication July 18, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Berkel, A. I., M. Loos, O. Sanal, G. Mauff, Y. Gungen, U. Ors, F. Ersoy, O. Yegin. 1979. Clinical and immunological studies in a case of selective complete C1q deficiency. Clin. Exp. Immunol. 38:52.[Medline]
  2. Berkel, A. I., M. Loos, O. Sanal, F. Ersoy, O. Yegin. 1981. Selective complete C1q deficiency: report of two new cases. Immunol. Lett. 2:263.
  3. Walport, M. J., K. A. Davies, M. Botto. 1998. C1q and systemic lupus erythematosus. Immunobiology 199:265.[Medline]
  4. Korb, L. C., J. M. Ahearn. 1997. C1q binds directly and specifically to surface blebs of apoptotic human keratinocytes: complement deficiency and systemic lupus erythematosus revisited. J. Immunol. 158:4525.[Abstract]
  5. Botto, M., C. Dell’Agnola, A. E. Bygrave, E. M. Thompson, H. T. Cook, F. Petry, M. Loos, P. P. Pandolfi, M. J. Walport. 1998. Homozygous C1q deficiency causes glomerulonephritis associated with multiple apoptotic bodies. Nat. Genet. 19:56.[Medline]
  6. Taylor, P. R., A. Carugati, V. A. Fadok, H. T. Cook, M. Andrews, M. C. Carroll, J. S. Savill, P. M. Henson, M. Botto, M. J. Walport. 2000. A hierarchical role for classical pathway complement proteins in the clearance of apoptotic cells in vivo. J. Exp. Med. 192:359.[Abstract/Free Full Text]
  7. Berkel, A. I., O. Sanal, R. Thesen, M. Loos. 1977. A case of selective Clq deficiency. Turk. J. Pediatr. 19:101.[Medline]
  8. Rabs, U., H. Martin, T. Hitschold, M. D. Golan, H.-P. Heinz, M. Loos. 1986. Isolation and characterization of macrophage derived C1q and its similarities to serum C1q. Eur. J. Immunol. 16:1183.[Medline]
  9. Martin, H., M. Loos. 1989. Biosynthesis of complement components by macrophages. C. Sorg, ed. Cytokines 155. Karger, Basel.
  10. Petry, F., K. B. M. Reid, M. Loos. 1989. Molecular cloning of the complementary DNA coding for the B-chain of murine C1q. FEBS Lett. 258:89.[Medline]
  11. Trinder, P., D. Faust, M. Loos. 1990. C1q biosynthesis by murine peritoneal macrophages: regulation by a cyclic AMP-dependent pathway. Complement Inflamm. 7:162.
  12. Gulati, P., C. Lemercier, D. Guc, D. Lappin, K. Whaley. 1993. Regulation of synthesis of C1 subcomponents and C1-inhibitor. Behring Inst. Mitt. 93:196.
  13. Kaul, M., M. Loos. 1995. Collagen-like complement component C1q is a membrane protein of human monocyte-derived macrophages that mediates endocytosis. J. Immunol. 155:5795.[Abstract]
  14. Walsh, P. S., D. A. Metzger, R. Higuchi. 1991. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 10:506.[Medline]
  15. Gubbay, J., J. Collignon, P. Koopman, B. Capel, A. Economou, A. Munsterberg, N. Vivian, P. Goodfellow, R. Lovell-Badge. 1990. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346:245.[Medline]
  16. Mayer, A., J. Podlech, S. Kurz, H. P. Steffens, S. Maiberger, K. Thalmeier, P. Angele, L. Dreher, M. J. Reddehase. 1997. Bone marrow failure by cytomegalovirus is associated with an in vivo deficiency in the expression of essential stromal hemopoietin genes. J. Virol. 71:4589.[Abstract]
  17. Chomcynski, P., N. Sacchi. 1987. Single-step method for RNA-isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  18. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294.[Medline]
  19. Petry, F., K. B. M. Reid, M. Loos. 1991. Gene expression of the A- and B-chain of mouse C1q in different tissues and the characterization of the recombinant A-chain. J. Immunol. 1470:3988.
  20. Walter, W., M. Loos, M. J. Maeurer. 1996. H2-M polymorphism in mice susceptible to collagen-induced arthritis involves the peptide binding groove. Immunogenetics 44:19.[Medline]
  21. Rapp, H. J., T. Borsos. 1970. Molecular Basis of Complement Action Appleton Century Crofts, New York.
  22. Schwaeble, W., K.-H. Schaefer, F. Petry, T. Fink, D. Knebel, E. Weihe, M. Loos. 1995. Follicular dendritic cells, interdigitating cells and cells of the monocyte-macrophage-lineage are the C1q-producing sources in the spleen: identification of specific cell types by in situ hybridization and immunohistochemical analysis. J. Immunol. 155:4971.[Abstract]
  23. Armbrust, T., B. Nordmann, M. Kreissig, G. Ramadori. 1997. C1Q synthesis by tissue mononuclear phagocytes from normal and from damaged rat liver: up-regulation by dexamethasone, down-regulation by interferon {gamma}, and lipopolysaccharide. Hepatology 26:98.[Medline]
  24. Dietzschold, B., W. Schwaeble, M. K. Schafer, D. C. Hooper, Y. M. Zehng, F. Petry, H. Sheng, T. Fink, M. Loos, H. Koprowski, E. Weihe. 1995. Expression of C1q, a subcomponent of the rat complement system, is dramatically enhanced in brains of rats with either Borna disease or experimental allergic encephalomyelitis. J. Neurol. Sci. 130:11.[Medline]
  25. Singhrao, S. K., J. W. Neal, B. P. Morgan, P. Gasque. 1999. Increased complement biosynthesis by microglia and complement activation on neurons in Huntington’s disease. Exp. Neurol. 159:362.[Medline]
  26. Schafer, M. K., W. J. Schwaeble, C. Post, P. Salvati, M. Calabresi, R. B. Sim, F. Petry, M. Loos, E. Weihe. 2000. Complement C1q is dramatically up-regulated in brain microglia in response to transient global cerebral ischemia. J. Immunol. 164:5446.[Abstract/Free Full Text]
  27. Thomas, A., P. Gasque, D. Vaudry, B. Gonzalez, M. Fontaine. 2000. Expression of a complete and functional complement system by human neuronal cells in vitro. Int. Immunol. 12:1015.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
P. Baruah, I. E. Dumitriu, T. H. Malik, H. T. Cook, J. Dyson, D. Scott, E. Simpson, and M. Botto
C1q enhances IFN-{gamma} production by antigen-specific T cells via the CD40 costimulatory pathway on dendritic cells
Blood, April 9, 2009; 113(15): 3485 - 3493.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Baudino, Y. Shinohara, F. Nimmerjahn, J.-I. Furukawa, M. Nakata, E. Martinez-Soria, F. Petry, J. V. Ravetch, S.-I. Nishimura, and S. Izui
Crucial Role of Aspartic Acid at Position 265 in the CH2 Domain for Murine IgG2a and IgG2b Fc-Associated Effector Functions
J. Immunol., November 1, 2008; 181(9): 6664 - 6669.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Baudino, F. Nimmerjahn, Y. Shinohara, J.-I. Furukawa, F. Petry, J. S. Verbeek, S.-I. Nishimura, J. V. Ravetch, and S. Izui
Impact of a Three Amino Acid Deletion in the CH2 Domain of Murine IgG1 on Fc-Associated Effector Functions
J. Immunol., September 15, 2008; 181(6): 4107 - 4112.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Paidassi, P. Tacnet-Delorme, V. Garlatti, C. Darnault, B. Ghebrehiwet, C. Gaboriaud, G. J. Arlaud, and P. Frachet
C1q Binds Phosphatidylserine and Likely Acts as a Multiligand-Bridging Molecule in Apoptotic Cell Recognition
J. Immunol., February 15, 2008; 180(4): 2329 - 2338.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
G. Castellano, A. M. Woltman, A. J. Nauta, A. Roos, L. A. Trouw, M. A. Seelen, F. P. Schena, M. R. Daha, and C. van Kooten
Maturation of dendritic cells abrogates C1q production in vivo and in vitro
Blood, May 15, 2004; 103(10): 3813 - 3820.
[Abstract] [Full Text] [PDF]

Home page
 LupusHome page
D. Jayne, J. Passweg, A. Marmont, D. Farge, X. Zhao, R. Arnold, F. Hiepe, I. Lisukov, M. Musso, J. Ou-Yang, et al.
Autologous stem cell transplantation for systemic lupus erythematosus
Lupus, March 1, 2004; 13(3): 168 - 176.
[Abstract] [PDF]

Home page
 J. Immunol.Home page
A. Verschoor, M. A. Brockman, M. Gadjeva, D. M. Knipe, and M. C. Carroll
Myeloid C3 Determines Induction of Humoral Responses to Peripheral Herpes Simplex Virus Infection
J. Immunol., November 15, 2003; 171(10): 5363 - 5371.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. Rossbacher and M. J. Shlomchik
The B Cell Receptor Itself Can Activate Complement to Provide the Complement Receptor 1/2 Ligand Required to Enhance B Cell Immune Responses In Vivo
J. Exp. Med., August 18, 2003; 198(4): 591 - 602.
[Abstract] [Full Text] [PDF]

Home page
 CVIHome page
T. Jaatinen, M. Lahti, O. Ruuskanen, R. Kinos, L. Truedsson, R. Lahesmaa, and M.-L. Lokki
Total C4B Deficiency Due to Gene Deletion and Gene Conversion in a Patient with Severe Infections
Clin. Vaccine Immunol., March 1, 2003; 10(2): 195 - 201.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Gadjeva, A. Verschoor, M. A. Brockman, H. Jezak, L. M. Shen, D. M. Knipe, and M. C. Carroll
Macrophage-Derived Complement Component C4 Can Restore Humoral Immunity in C4-Deficient Mice
J. Immunol., November 15, 2002; 169(10): 5489 - 5495.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petry, F.
Right arrow Articles by Loos, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petry, F.
Right arrow Articles by Loos, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS