HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Andoh, A. Articles by Podolsky, D. K. Search for Related Content PubMed PubMed Citation Articles by Andoh, A. Articles by Podolsky, D. K.

Intestinal Trefoil Factor Induces Decay-Accelerating Factor Expression and Enhances the Protective Activities Against Complement Activation in Intestinal Epithelial Cells¹

Gastrointestinal Unit and Center for the Study of Inflammatory Bowel Disease, Department of Medicine, Massachusetts General Hospital, and Harvard Medical School, Boston, MA 02114.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mucosal damage induces a massive influx of serum complement components into the lumen. The epithelium produces a number of factors that can potentially ameliorate injury including intestinal trefoil factor (ITF), a small protease-resistant peptide produced and secreted onto the mucosal surface by goblet cells, and decay-accelerating factor (DAF), a protein produced by columnar epithelium which protects the host tissue from autologous complement injury. However, coordination of these intrinsic defensive products has not been delineated. DAF protein and mRNA expression were evaluated by immunoblotting and Northern blotting, respectively. NF-B-DNA binding activity and DAF promoter activity were assessed by an electrophoretic gel mobility shift assay and a reporter gene luciferase assay, respectively. ITF induced a dose- and time-dependent increase in DAF protein and mRNA expression in human (HT-29 and T84) and rat (IEC-6) intestinal epithelial cells. In differentiated T84 cells grown on cell culture inserts, basolateral stimulation with ITF strongly enhanced DAF expression, but apical stimulation had no effects. The C3 deposition induced by complement activation was significantly blocked by the treatment with ITF. In HT-29 cells, ITF increased the stability of DAF mRNA. ITF also enhanced the promoter activity of the DAF gene via NF-B motif and induced activation of NF-B-DNA binding activity. ITF promotes protection of epithelial cells from complement activation via up-regulation of DAF expression, contributing to a robust mucosal defense.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
After injury disrupts the continuity of gastrointestinal tract mucosa, epithelial cells rapidly spread and migrate across the basement membrane to reseal the denuded area. This process by which epithelial continuity is rapidly re-established after injuries does not require cell proliferation and has been termed restitution (1, 2). Brisk restitution after injury is desirable to block fluid and electrolyte loss and to prevent the entrance of various Ags present in the gastrointestinal tract.

Trefoil peptides, which comprise a family of small protease-resistant proteins characterized by one or more trefoil motifs, play a critical role in epithelial restitution (2, 3). Three trefoil peptides have been identified in humans (3); spasmolytic polypeptide (SP/TFF2),³ pS2/TFF1, and intestinal trefoil factor (ITF/TFF3). Human SP is mainly expressed in the gastric mucous neck cells, and pS2 is expressed in gastric surface (foveolar) mucous cells (4, 5). ITF is synthesized and secreted by goblet cells in the small and large intestine (6). At the margins of mucosal injury such as inflammatory bowel disease (IBD) and gastric ulcer, the expression of trefoil peptides is rapidly up-regulated, and they appear to promote epithelial restitution (2, 3, 5, 7, 8, 9). In ITF-deficient mice, epithelial restitution is absent in the colon, and oral administration of dextran sulfate sodium induces death associated with extensive colitis, presumably because of the failure of healing processes (10). Trefoil peptides have been shown to prevent gastrointestinal injury caused by alcohol and indomethacin and to induce rapid reseal of erosions (11). Thus, trefoil peptides play an important role in the repair and healing of gastrointestinal epithelium through enhancing epithelial restitution (12).

The decay-accelerating factor (DAF) CD55, a 70,000 m.w. glycoprotein that is anchored to the plasma cell membrane by a glycosyl-phosphatidylinositol linkage (13) is another important mucosal defensive protein. DAF prevents the assembly and accelerates the dissociation of autologous C3 convertases (C4b2a and C3bBb) and C5 convertases (C4b2a3b and C3bBb3b), thus efficiently interrupting the amplification steps of the classical and alternative complement activation pathways on host cell surfaces (13, 14, 15). Through these actions, DAF protects host tissues from autologous complement injury.

In the human intestinal tract, DAF has been localized to the apical surfaces of epithelial cells (16). The hepatobiliary system and the exocrine pancreas also secrete large amounts of active complement components into the gastrointestinal tract (17, 18). Intestinal epithelial cells (IECs) locally synthesize and secrete complement components into the lumen (19, 20, 21, 22). Indeed, complement deposition has been detected in the lesions of IBD, celiac disease, and recently in Helicobacter pylori gastritis (23, 24, 25, 26). These observations suggest that inflammatory conditions induce complement activation in the gastrointestinal tract. Interestingly, DAF expression is markedly increased at the inflamed mucosa of IBD patients (16, 27). However, the mechanisms regulating DAF expression to limit complement-induced tissue damage along the gastrointestinal tract remain unclear.

In the present study, we tested the hypothesis that ITF promotes DAF expression in IECs. Because the enhancement of anti-complement activity via DAF expression may enable more effective repair, we speculated that ITF might up-regulate this protective mechanism, in parallel with its ability to facilitate epithelial restitution.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cells and recombinant ITF

Human colon cancer cell lines HT-29 and T84 and the rat IEC line IEC-6 were obtained from American Type Culture Collection (Manassas, VA). HT-29 cells were grown in RPMI 1640 containing 10% FBS, and T84 cells were cultured in a 1:1 mixture of DMEM and Ham’s F-12 medium containing 10% FBS. IEC-6 cells were grown in DMEM containing 10% FBS. All culture medium was supplemented with 50 U/ml penicillin and 50 µg/ml streptomycin. In some experiments, T84 cells were grown on inserts of 0.4 mm pore size (Falcon 3090; BD Biosciences, Mountain View, CA), and used after achieving transepithelial resistance >400 determined with a Millicell-ERS (Millipore, Bedford, MA) apparatus. Purified recombinant human ITF was produced as described previously (28).

Immunoblotting

Expression of DAF protein was confirmed by immunoblotting of cell lysates and growth medium. Cells were grown to confluence in 60-mm cell culture dishes and stimulated with various concentrations of ITF for 48 h. Cells were harvested by scraping and washed with PBS. The pellet was resuspended in 0.5 ml of ice-cold 1% Triton X-114 hypertonic buffer (20 mM Tris, 100 mM NaCl, and protease inhibitor mixture) and sonicated for 30 s. Insoluble material was removed by centrifugation at 13,000 x g. Supernatant was layered onto 0.5 ml of 9% sucrose and incubated at 37° for 5 min to allow phase separation. Cultured medium was mixed with Triton X-100 (final 1%), and similarly treated. The lower detergent-rich layer was recovered after centrifugation, and protein concentrations were determined by Bradford assay (Bio-Rad, Hercules, CA). Equal amounts of protein (2 µg/sample) were separated by nonreducing 10% SDS-PAGE. Gels were blotted and probed with anti-human DAF mAb (IA10; BD PharMingen, San Diego, CA) or anti-rat DAF mAb (RDIII-7; generous gift from B. Morgan, University of Wales College of Medicine; Ref. 14). Detection was accomplished with HRP-coupled sheep anti-mouse IgG (Amersham, Arlington Heights, IL) and the Renaissance chemiluminescence assay (NEN, Boston, MA).

Northern blotting

Total cellular RNA was isolated by TRIzol reagent (Life Technologies, Grand Island, NY). Northern blotting for human DAF gene was performed according to a method described previously (29). A probe specific for the human DAF gene also was prepared as described previously (29). A probe for rat DAF gene was generated by RT-PCR with the following primers: 5'-AATGGTCACATCAACATACCAACT (511–534); and 3'-CGTTGGATGACGTACCGTTGTCTT (1086–1063) (14). It was cloned with a TA-vector kit (Invitrogen, Carlsbad, CA).

DAF promoter luciferase reporter constructs and cell transfection

Three different sizes of human DAF promoter region (30) were amplified by PCR with human genomic DNA as a template with the following primers: DAF (-724), TTCAGATCTCAGTCAGTCTGGAGTAAT; DAF (-437), CAGAGATCTAACTCCACCGCACCTGCA; DAF (-126), TCTAGATCTACCTCTGACCACAACAAA; and DAF (+80), ATGAAGCTTCGGGTTAGAACAAGGACG. The DAF (+80) was used as the common downstream (antisense) primer. The 5' sequence of DAF (-724), DAF (-437), and DAF (-126) were modified for BglII site, and the 5' region of DAF (+80) was modified for HindIII site, respectively. These fragments were ligated into BglII and HindIII sites of the luciferase reporter plasmid pGL3-Basic (Promega, Madison, WI), yielding the reporter constructs -724 DAF, -437 DAF, and -126 DAF. The sequence of inserts was configured with an autosequencer. The reporter plasmid was amplified in DH5 Escherichia coli (Life Technologies) and purified with a Plasmid Maxi kit (Qiagen, Valencia, CA). Transient transfection was performed by using Lipofectamine Plus reagent (Life Technologies) according to the manufacturer’s instructions. Twenty hours before transfection, 1 x 10⁶ HT-29 cells were plated in triplicate in 35-mm wells of a 6-well plate. For each well, 1 µg of plasmid DNA and 0.2 µg of -galactosidase reporter vector pCMV (CLONTECH Laboratories, Palo Alto, CA) were cotransfected and incubated for 24 h. The medium was changed and cells incubated in the presence of stimuli for 12 h. The luciferase activity was measured by the Luciferase Assay System kit (Promega) and expressed as relative activity normalized to -galactosidase activity.

Nuclear extracts and EMSA

Nuclear extracts were prepared from HT-29 cells exposed to ITF (10 µm) and TNF- (20 ng/ml) by the method of Dignam et al. (31). Consensus oligonucleotides of NF-B (5'-AGTTGAGGGGACTTTCCCAGCC) was used (32). Oligonucleotides were 5' end-labeled with T4 polynucleotide kinase (Promega) and [ -³²P]ATP (NEN). Binding reactions were performed by preincubating 7.5 µg of nuclear proteins in HEPES (20 mM; pH 7.9), KCl (60 mM), MgCl₂ (1 mM), EDTA (0.1 M), glycerol (10%), DTT (0.5 mM), and poly(dI-dC) (2 µg) on ice for 10 min, followed by addition of the ³²P-labeled oligonucleotide and a second incubation at room temperature for 20 min. Samples were loaded directly on nondenaturing 4% polyacrylamide gels prepared in Tris-glycine-EDTA buffer (pH 8.5). The gels were dried and exposed to Kodak (Rochester, NY) XRP film with an intensifying screen. Supershift experiments were performed as described above except that 1 µl of Ab for each transcription factor was added to the binding mixture in the absence of the labeled probe. Antisera specifically recognizing each transcriptional factor were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Experiments with unlabeled oligonucleotides used a 100-fold molar excess relative to the radiolabeled oligonucleotide.

ELISA for human complement C3

To evaluate C3 deposition, cells were lysed by buffer (20 mM Tris, 10 mM EDTA, 100 mM NaCl, 0.5% Nonidet P40, 0.5% sodium deoxycholate, and protease inhibitor mixture), and C3 levels were determined by ELISA as described previously (21). These C3 molecules also were analyzed by SDS-PAGE under reducing condition and immunoblot.

Statistical analysis

Student’s t test was used to compare data between two groups (e.g., control and ITF-treated group). Values for p < 0.05 were considered significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
ITF stimulation enhances DAF protein expression in HT-29 cells

HT-29 cells were stimulated with ITF (10 µm) or TNF- (20 ng/ml) for 48 h, and DAF protein expression then was assessed by immunoblotting (Fig. 1 A). Unstimulated HT-29 cells expressed small amounts of DAF protein, detected as a single band of 70,000 m.w., as described previously (13). ITF stimulated DAF protein expression, although this effect was less than that induced by TNF-. HT-29 cells were incubated with increasing concentrations of ITF for 48 h, and DAF protein expression was determined. As shown in Fig. 1B, ITF increased DAF protein expression in a concentration-dependent manner.

View larger version (25K): [in this window] [in a new window]   FIGURE 1. Effects of ITF on DAF protein expression in HT-29 cells. A, HT-29 cells were incubated with medium alone, ITF (10 µm), or TNF- (100 ng/ml) for 48 h and lysed by buffer containing 1% Triton X-114. DAF protein expression was analyzed by SDS-PAGE and immunoblot. B, HT-29 cells were stimulated with increasing concentrations of ITF for 48 h. DAF protein expression was analyzed by SDS-PAGE and immunoblot. C, HT-29 cells were stimulated with increasing concentrations of ITF for 48 h, and culture supernatants then were harvested. Secreted DAF protein was analyzed by SDS-PAGE and immunoblot.

ITF stimulation increases DAF mRNA abundance in HT-29 cells

HT-29 cells were incubated with increasing concentrations of ITF for 12 h, and DAF mRNA abundance was determined by Northern blot. As shown in Fig. 2A, DAF transcripts were detected as 2.2 and 1.6 kb in HT-29 cells, as reported previously (29, 33). ITF induced a concentration-dependent increase in DAF mRNA abundance, and these effects reached a maximum at 10 µM of ITF. To determine the kinetics of ITF-induced effects, HT-29 cells were incubated for different duration in medium alone or in medium containing ITF. An increase in DAF mRNA abundance was observed as early as 3 h and reached a maximum by 12 h.

View larger version (59K): [in this window] [in a new window]   FIGURE 2. Effects of ITF on DAF mRNA expression in HT-29 cells. A, HT-29 cells were stimulated with increasing concentrations of ITF for 6 h, and DAF mRNA abundance was determined by Northern blotting. B, HT-29 cells were stimulated with ITF (10 µm) for various time periods, and DAF mRNA abundance was determined by Northern blotting.

To assess the generality of the effects of ITF observed in HT-29 cells, the effect of ITF on DAF expression was evaluated with the rat nontransformed IEC line IEC-6. The IEC-6 cells were incubated with ITF for 6 h, and DAF mRNA abundance was assessed by Northern blot analysis. As shown in Fig. 3A, ITF increased DAF mRNA abundance in IEC-6 cells. Incubation with ITF for 48 h also enhanced DAF protein expression (Fig. 3B).

View larger version (36K): [in this window] [in a new window]   FIGURE 3. Effects of ITF on DAF expression in IEC-6 cells. A, Cells were incubated with or without ITF (10 µm) for 12 h, and DAF mRNA abundance was assessed by Northern blotting. B, Cells were stimulated with or without ITF (10 µm) for 48 h and lysed by buffer containing 1% Triton X-100. DAF protein expression was analyzed by SDS-PAGE and immunoblot. Each lane represents a different sample.

View larger version (49K): [in this window] [in a new window]   FIGURE 4. Effects of ITF on DAF expression by T84 cells. Cells were cultured on the cell culture insert (pore size 0.4 µm) and formation of tight junctions were determined by transepithelial resistance (> 400). Left, Cells were stimulated with ITF (10 µg/ml) from either the apical or basolateral side for 12 h, and DAF mRNA then was determined by Northern blotting. Right, Cells were stimulated with ITF (10 µm) from either apical or basolateral side for 48 h. DAF protein expression analyzed by SDS-PAGE and immunoblot.

To evaluate whether ITF stimulation increases functional anticomplement activity, we tested the effects of ITF on complement C3 deposition. HT-29 cells were cultured in the absence or presence of ITF for 48 h, and then cells were incubated with acidified fresh human serum for 2 h. After extensive washing, cells were lysed and C3 deposition was evaluated by immunoblot and ELISA. As demonstrated in Fig. 5A, serum C3 is composed of - and -chains linked by disulfide bond (35). Deposited C3 was detected as C3b, in which the molecular size of -chain was smaller than that of native C3 (35). ITF treatment markedly decreased C3 deposition, and these effects were abrogated by the addition of PI-PLC, which cleaves GPI linkage and releases DAF from the cell surface. ELISA analysis demonstrated that ITF treatment decreased C3 deposition by 55% in HT-29 cells (Fig. 5B). C3 deposition also was assessed in T84 cells grown on the cell culture inserts (Fig. 5C). Addition of ITF to the basolateral side significantly decreased C3 deposition, whereas apical addition of ITF had no effect. These findings are compatible with the results of DAF mRNA and protein expression in T84 cells.

View larger version (21K): [in this window] [in a new window]   FIGURE 5. Effects of ITF on C3 deposition. A, HT-29 cells were stimulated with ITF (10 µm) for 48 h and then incubated with acidified fresh human serum for 2 h. Cells were lysed, and C3 deposition was analyzed by SDS-PAGE under reducing condition and immunoblot. B, In HT-29 cells, C3 levels in lysis buffer were determined by ELISA (mean ± SD, n = 4). C, T84 cells were cultured on inserts and formation of tight junctions was determined by transepithelial resistance. Cells were stimulated with ITF (10 µm) from either apical or basolateral side for 48 h, and then incubated with acidified fresh human serum for 2 h. Cells then were lysed, and C3 deposition was determined by ELISA (mean ± SD, n = 4).

Several factors have been reported to induce DAF expression in IECs; IL-4 and TNF- strongly enhance DAF expression by HT-29 cells (29, 33). However, the mechanisms regulating DAF expression by these factors vary. TNF- requires de novo protein synthesis to increase DAF mRNA abundance, but IL-4 does not. Accordingly, the effect of cycloheximide, a protein synthesis inhibitor, on ITF regulation of DAF expression by HT-29 cell was evaluated. As shown in Fig. 6, the addition of cycloheximide strongly enhanced DAF mRNA abundance, indicating superinduction of the DAF gene (36, 37). The addition of cycloheximide completely abrogated ITF-induced increase of DAF mRNA abundance, indicating that ITF requires de novo protein synthesis to up-regulate DAF gene expression.

View larger version (69K): [in this window] [in a new window]   FIGURE 6. Effects of cycloheximide on ITF-induced DAF mRNA expression. HT-29 cells were stimulated with ITF (10 µm) for 6 h in the presence or absence of cycloheximide (5 µM). DAF mRNA abundance was subsequently determined by Northern blotting.

To evaluate the possibility that ITF-induced DAF mRNA is dependent on increased mRNA stability, HT-29 cells were incubated for 6 h in medium alone or in medium plus ITF, washed, and then treated with actinomycin D (5 µg/ml) for various time periods to block further RNA transcription (Fig. 7). In cells treated with medium alone, DAF mRNA abundance decreased by 60% at 6 h after the addition of actinomycin D. Treatment with ITF actually delayed DAF mRNA degradation; 85% of DAF mRNA remained after 6 h. These findings suggest that some of the effects of ITF on DAF mRNA abundance may result from an increase in DAF mRNA stability.

View larger version (51K): [in this window] [in a new window]   FIGURE 7. Stability of DAF mRNA induced by ITF. A, HT-29 cells were stimulated with or without ITF (10 µM) for 12 h, washed, and incubated with actinomycin D (5 µM) for various time periods. Total RNA was extracted, and DAF mRNA abundance was determined by Northern blotting. To assess the role of p38 MAP kinase activation, cells were treated with SB203580 (10 µm) for 1 h before the addition of actinomycin D. B, DAF mRNA abundance was expressed as relative to the corresponding level before addition of actinomycin D (% mRNA remaining).

ITF induces DAF promoter activity

To determine whether ITF regulates DAF gene transcription, three different regions of the human DAF promoter extending to bp -724 upstream of the transcription start site were cloned with human genomic DNA. This region contains a consensus binding site for NF-B (at bp -393 to bp -384) and/or AP-1 (at bp -67 to bp -73; Ref. 30). These fragments were cloned into a luciferase reporter plasmid (designated plasmids -724 DAF, -437 DAF, -126 DAF). The -724 DAF and -437 DAF plasmids contain a NF-B and AP-1 site, and the -126 DAF plasmid contains only an AP-1 site. As shown in Fig. 8, TNF- (50 ng/ml) and ITF significantly increased relative luciferase activity in HT-29 cells transfected with the -724 DAF and -437 DAF plasmids. However, ITF stimulation was modest compared with that by TNF-. ITF stimulation of luciferase activity was absent in cells transfected with the -126 DAF plasmid, which lacks an NF-B binding site. These results suggest that ITF stimulation of the DAF promoter is mediated predominantly via NF-B activation and that the role of AP-1 is negligible. EMSA was performed to determine whether ITF stimulation results in formation of active NF-B-DNA binding complexes. As shown in Fig. 9, stimulation with ITF induced formation of a NF-B-DNA binding complex, although this binding was weaker than that induced by TNF- (20 ng/ml). These binding complexes were blocked by cold probe and supershifted by Abs against p50 and p65 NF-B subunits.

View larger version (22K): [in this window] [in a new window]   FIGURE 8. Effects of ITF on the DAF promoter activity. HT-29 cells were transiently transfected with the indicated DAF promoter-luciferase reporter plasmids and -galactosidase reporter vector. Twenty-four hours after transfection, cells were stimulated with or without ITF (10 µm) or TNF- (50 ng/ml) for 8 h and then harvested. Luciferase activity was normalized to -galactosidase activity and calculated as fold induction compared with the control value (mean ± SD, n = 4).

View larger version (76K): [in this window] [in a new window]   FIGURE 9. EMSAs for NF-B DNA-binding activities. HT-29 cells were incubated with medium alone for 3 h, or with ITF (10 µm) for 1, 3 or 6 h. Other cells were stimulated with TNF- (10 ng/ml) for 1 h and then nuclear extracts prepared.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The present studies demonstrate that ITF, a potent stimulator of epithelial restitution (2, 3), enhances DAF expression in a variety of intestinal epithelial cell lines. This increase was accompanied by an increase in functional activity to block complement C3 deposition. Previous studies have demonstrated that ITF expression is rapidly induced at the ulcerative and inflammatory lesions of the gastrointestinal tracts (5, 7, 8, 9). In such lesions, persistent activation of complement cascade may occur, as the denuded mucosa results in a massive influx of serum complement components into the lumen, and inflammatory mediators such as proinflammatory cytokines IL-1 and TNF- stimulate local complement synthesis in epithelial and other cells (21, 22). ITF stimulation of DAF expression may complement other actions on epithelial cells that promote repair and healing processes in damaged mucosa. These results suggest that ITF may play an important role in protecting epithelial cells against complement-mediated injury via induction of DAF expression. ITF-induced DAF expression may facilitate epithelial restitution in conditions associated with increased complement activation.

In physiological conditions, ITF is secreted by goblet cells into the lumen and coats the mucosal surface (6). This abundant ITF contributes to the stability of the viscoelastic gel that is essential to the preservation of the integrity of the mucosal surface and help reestablishing epithelial continuity over the mucosal defect (3, 6). The abundant expression of ITF contrasts with the generally minimal expression of epithelial DAF under normal condition. Observations in T84 cells, a model system for vectorial ITF stimulation (34), indicate that ITF enhances the expression of DAF mRNA and protein only when present on the basolateral side. Basolateral stimulation by ITF prevented complement C3 deposition on T84 cells. From a functional viewpoint, these findings indicate that ITF coating the mucosal surface does not stimulate basal DAF expression under normal condition. However, after mucosal injury, the denuded mucosa enables easy access and contact of ITF with the basolateral surface of epithelial cells, leading to increased epithelial cell DAF expression. Although previous studies demonstrated that several cytokines including IL-4 and TNF- stimulate DAF expression, ITF provides a more efficient mechanism for induction of DAF expression at inflammatory and ulcerative lesions in gastrointestinal tract. It is likely that ITF may function as an inducer of DAF expression immediately after mucosal injury, promptly enhancing protection against complement-mediated injury to facilitate mucosal repair.

As a posttranscriptional mechanism regulating gene expression, stabilization of mRNAs contributes to rapid induction of genes in inflammatory responses (38). Many short-lived and rapidly inducible mRNAs contain AU-rich elements (AREs) within their 3' untranslated region. AREs have been implicated as key determinants in regulating transcript stability (38). The presence of AREs of four AUUUA motifs in the 3'-untranslated region of DAF mRNA (nt 1895–1913) suggests that DAF gene expression may be regulated by the mechanism of mRNA stabilization (42). This inference is supported by the superinduction of DAF gene by cycloheximide, which inhibits a posttranscriptional mechanism mediating the degradation of short-lived transcripts, resulting in marked increases in mRNA half-life (36). In this study, ITF stimulation induced a marked increase in DAF mRNA stability, indicating that posttranscriptional mechanisms mediate ITF-induced up-regulation of the DAF gene. Recent studies have also reported that p38 MAP kinase plays a role in the induction of mRNA stabilization by inflammatory stimuli, e.g., p38 MAP kinase regulates stability of cyclooxygenase-2 and IL-8 mRNAs (38, 39). However, the p38 MAP kinase inhibitor SB 203580 did not affect the ITF-induced DAF mRNA stabilization in HT-29 cells. Furthermore, ITF did not induce phosphorylation of p38 MAP kinase in this cell line (data not shown). These observations suggest that ITF induces DAF mRNA stabilization by mechanisms independent of p38 MAP kinase activation.

Efforts to determine the mechanism through which ITF induces changes in expression of DAF mRNA focused on activation of NF-B given similarities to the effects of TNF-. NF-B plays a central role in the transcriptional activation of genes encoding proteins induced by TNF- (32). Indeed, a consensus motif of NF-B binding sequence is present in the promoter regions of DAF gene (nucleotide bp -393 to bp -384; Ref. 30), and both transient transfection and EMSAs demonstrated that NF-B activation is induced by ITF stimulation in HT-29 cells, suggesting that ITF-induced regulation of DAF expression may be mediated, at least in part, by NF-B-mediated transcriptional activation of DAF gene. Thus, ITF increases the abundance of DAF gene through both transcriptional and posttranscriptional mechanisms.

In conclusion, these studies provide insight into a previously unappreciated dimension of trefoil peptides that contribute to mucosal defense. This process can assure rapid induction of DAF and subsequent increase in protection against complement attack at sites of mucosal injury. When a mucosal defect occurs, up-regulation of ITF secretion in the wound margin may provide protection for the epithelial cells that migrate across the defect against complement attack. Thus, up-regulation of DAF expression by ITF may provide a mechanism to protect gastrointestinal mucosa during inflammatory and ulcerative processes involving complement activation.

	Footnotes

 
¹ These studies were supported by National Institutes of Health Grants P30DK43351 and R01DK46906.

² Address correspondence to Dr. Daniel K. Podolsky, Gastrointestinal Unit, Massachusetts General Hospital, 55 Fruit Street, Boston, MA 02114. E-mail address: Podolsky.Daniel{at}mgh.harvard.edu

³ Abbreviations used in this paper: SP/TFF2, spasmolytic polypeptide; ITF/TFF3, intestinal trefoil factor; IBD, inflammatory bowel disease; DAF, decay-accelerating factor; IEC, intestinal epithelial cell; MAP, mitogen-activated protein; ARE, AU-rich element.

Received for publication May 11, 2001. Accepted for publication July 24, 2001.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Dignass, A. U., D. K. Podolsky. 1993. Cytokine modulation of intestinal epithelial cell restitution: central role of transforming growth factor-. Gastroenterology 105:1323.[Medline]
2. Dignass, A. U., K. Lynch-Devaney, H. Kindon, L. Thim, D. K. Podolsky. 1994. Trefoil peptides promote epithelial restitution through a TGF- independent pathway. J. Clin. Invest. 94:376.
3. Sands, B. E., D. K. Podolsky. 1996. The trefoil peptide family. Annu. Rev. Physiol. 58:253.[Medline]
4. Taupin, D., D. C. Wu, W. K. Jeon, K. Devaney, T. C. Wang, D. K. Podolsky. 1999. The trefoil gene family are coordinately expressed immediate-early genes: EGF receptor- and MAP kinase-dependent interregulation. J. Clin. Invest. 103:R31.[Medline]
5. Rio, M. C., M. P. Chenard, C. Wolf, L. Marcellin, C. Tomasetto, R. Lathe, J. P. Bellocq, P. Chambon. 1991. Induction of pS2 and hSP genes as markers of mucosal ulceration of the digestive tract. Gastroenterology 100:375.[Medline]
6. Podolsky, D. K., K. Lynch-Devaney, J. F. Stow, P. Oates, B. Murgue, M. DeBeaumont, B. E. Sands, Y. R. Mahida. 1993. Identification of human intestinal trefoil factor. Goblet cell-specific expression of a peptide targeted for apical secretion. J. Biol. Chem. 268:6694.[Abstract/Free Full Text]
7. Wright, N. A., R. Poulsom, G. Stamp, S. van Noorden, C. Sarraf, G. Elia, D. Ahnen, R. Jeffery, J. Longcroft, C. Pike, et al 1993. Trefoil peptide gene expression in gastrointestinal epithelial cells in inflammatory bowel disease. Gastroenterology 104:12.[Medline]
8. Cook, G. A., N. D. Yeomans, A. S. Giraud. 1997. Temporal expression of trefoil peptides in the TGF- knockout mouse after gastric ulceration. Am. J. Physiol. 272:G1540.[Abstract/Free Full Text]
9. Alison, M. R., R. Chiney, R. Poulsom, P. Ashwood, J. M. Longcroft, N. A. Wright. 1995. Experimental ulceration leads to sequential expression of spasmolytic polypeptide, intestinal trefoil factor, epidermal growth factor and transforming growth factor mRNAs in rat stomach. J. Pathol. 175:405.[Medline]
10. Mashimo, H., D. C. Wu, D. K. Podolsky, M. C. Fishman. 1996. Impaired defense of intestinal mucosa in mice lacking intestinal trefoil factor. Science 274:262.[Abstract/Free Full Text]
11. Babyatsky, M. W., M. de Beaumont, L. Thim, D. K. Podolsky. 1996. Oral trefoil peptides protect against ethanol- and indomethacin-induced gastric injury in rats. Gastroenterology 110:487.
12. Taupin, D. R., K. Kinoshita, D. K. Podolsky. 2000. Intestinal trefoil factor confers colonic epithelial resistance to apoptosis. Proc. Natl. Acad. Sci. 97:799.[Abstract/Free Full Text]
13. Kinoshita, T., M. E. Medof, R. Silber, V. Nussentweig. 1985. Distribution of decay-accelerating factor in the peripheral blood of normal individuals and patients with paroxysmal noctual hemoglobinuria. J. Exp. Med. 162:75.[Abstract/Free Full Text]
14. Hinchliffe, S. J., O. B. Spiller, N. K. Rushmere, B. P. Morgan. 1998. Molecular cloning and functional characterization of the rat analogue of human decay-accelerating factor (CD55). J. Immunol. 161:5695.[Abstract/Free Full Text]
15. Morgan, P., H. Beasley, A. Gorrell, E. Martin, P. Gribling, H. Fuchs, N. Gillett, L. E. Burton, I. W. Caras. 1992. Human recombinant soluble decay accelerating factor inhibits complement activation in vitro and in vivo. J. Immunol. 149:1736.[Abstract]
16. Berstad, A. E., P. Brandtzaeg. 1998. Expression of cell membrane complement regulatory glycoproteins along the normal and diseased human gastrointestinal tract. Gut 42:522.[Abstract/Free Full Text]
17. Andoh, A., Y. Fujiyama, K. Sumiyoshi, T. Bamba. 1996. Local secretion of complement C3 in the exocrine pancreas: ductal epithelial cells are possible biosynthetic site. Gastroenterology 110:1919.[Medline]
18. Sumiyoshi, K., A. Andoh, Y. Fujiyama, H. Sakumoto, T. Bamba. 1997. Characterization of complement C3, C4, and factor B molecules in human bile. J. Gastroenterol. 32:230.[Medline]
19. Ahrenstedt, O., B. Knutson, K. Nisson, K. Nilsson-Ekdahl, K. Odlind, R. Hallgren. 1990. Enhanced local production of complement components in the small intestines of patients with Crohn’s disease. N. Engl. J. Med. 322:1345.[Abstract]
20. Andoh, A., Y. Fujiyama, H. Sakumoto, H. Uchihara, T. Kimura, S. Koyama, T. Bamba. 1998. Detection of complement C3 and factor B gene expression in normal colorectal mucosa, adenoma and carcinoma. Clin. Exp. Immunol. 111:477.[Medline]
21. Andoh, A., Y. Fujiyama, T. Bamba, S. Hosoda. 1993. Differential cytokine regulation of complement C3, C4 and factor B synthesis in human intestinal epithelial cell line, Caco-2. J. Immunol. 151:4239.[Abstract]
22. Molmenti, E. P., T. Ziambara, D. H. Perlmutter. 1993. Evidence for an acute phase response in human intestinal epithelial cells. J. Biol. Chem. 268:14116.[Abstract/Free Full Text]
23. Halstensen, T. S., T. E. Mollnes, P. Garred, O. Fausa, P. Brandtzaeg. 1990. Epithelial deposition of immunoglobulin G1 and activated complement (C3b and terminal complement complex) in ulcerative colitis. Gastroenterology 98:1264.[Medline]
24. Halstensen, T. S., T. E. Mollnes, P. Garred, O. Fausa, P. Brandtzaeg. 1992. Surface epithelium related activation of complement differs in Crohn’s disease and ulcerative colitis. Gut 33:902.[Abstract/Free Full Text]
25. Halstensen, T. S., M. Hvatum, H. Scott, O. Fausa, P. Brandtzaeg. 1992. Association of subepithelial deposition of activated complement and immunoglobulin G and M response to gluten in celiac disease. Gastroenterology 102:751.[Medline]
26. Berstad, A. E., P. Brandtzaeg, R. Stave, T. S. Halstensen. 1997. Epithelium related deposition of activated complement in Helicobacter pylori associated gastritis. Gut 40:196.[Abstract/Free Full Text]
27. Andoh, A., Y. Fujiyama, T. Kimura, T. Saotome, T. Tsujikawa, M. Sasaki, S. Koyama, T. Bamba. 1998. Increased expression of decay-accelerating factor (CD55) in the inflamed mucosa of patients with ulcerative colitis. Pathophysiology 5:105.
28. Thim, L., H. F. Woldike, P. F. Nielsen, M. Christensen, K. Lynch-Devaney, D. K. Podolsky. 1995. Characterization of human and rat intestinal trefoil factor produced in yeast. Biochemistry 34:4757.[Medline]
29. Andoh, A., Y. Fujiyama, K. Sumiyoshi, H. Sakumoto, T. Bamba. 1996. Interleukin-4 acts as an inducer of decay-accelerating factor gene expression in human intestinal epithelial cells. Gastroenterology 111:911.[Medline]
30. Thomas, D. J., D. M. Lublin. 1993. Identification of 5'-flanking regions affecting the expression of the human decay accelerating factor gene and their role in tissue-specific expression. J. Immunol. 150:151.[Abstract]
31. Dignam, J. P., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
32. Lenardo, M. J., D. Baltimore. 1989. NF-B: Pleiotropic mediator of inducible and tissue-specific gene control. Cell 58:227.[Medline]
33. Andoh, A., Y. Fujiyama, K. Sumiyoshi, H. Sakumoto, H. Okabe, T. Bamba. 1997. Tumor necrosis factor- up-regulates decay-accelerating factor gene expression in human intestinal epithelial cells. Immunology 90:358.[Medline]
34. Eckmann, L., H. C. Jung, C. Schurer-Maly, A. Panja, E. Morzycka-Wroblewska, M. Kagnoff. 1993. Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin-8. Gastroenterology 105:1689.[Medline]
35. Morgan, B. P.. 1990. The complement system. B. P. Morgan, ed. Complement: Clinical Aspects and Relevance to Disease 1.-35. Academic Press, London.
36. Roger, T., T. A. Out, H. M. Jansen, R. Lutter. 1998. Superinduction of interleukin-6 mRNA in lung epithelial H292 cells depends on transiently increased C/EBP activity and durable increased mRNA stability. Bioch. Biophy. Acta. 1398:275.
37. Riesbeck, K., M. Sigvardsson, T. Leanderson, A. Forsgren. 1994. Superinduction of cytokine gene transcription by ciprofloxacin. J. Immunol. 153:343.[Abstract]
38. Reid, M. E., G. Mallinson, R. B. Sim, J. Poole, V. Pausch, A. H. Merry, Y. W. Liew, M. J. Tanner. 1991. Biochemical studies on red cells from a patient with the Inab phenotype (decay-accelerating factor deficiency). Blood 78:3291.[Abstract/Free Full Text]
39. Daniels, G. L., H. Tohyama, M. Uchikawa. 1982. A possible null phenotype in the Cromer blood group complex. Transfusion 22:362.[Medline]
40. Medof, M. E., D. M. Lublin, M. Holers, D. J. Ayers, R. R. Getty, J. F. Leykam, J. P. Atkinson, M. L. Tykocinski. 1987. Cloning and characterization of cDNAs encoding the complete sequence of decay-accelerating factor of human complement. Proc. Natl. Acad. Sci. USA 84:2007.[Abstract/Free Full Text]
41. Winzen, R., M. Kracht, B. Ritter, A. Wilhelm, C. Y. Chen, A. B. Shyu, M. Muller, M. Gaestel, K. Resch, H. Holtmann. 1999. The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. EMBO J. 18:4969.[Medline]
42. Dean, L. J., M. Brook, A. R. Clark, J. Saklatvala. 1999. p38 Mitogen-activated protein kinase regulates cyclooxygenae-2 mRNA stability and transcription in lipopolysaccharide-treated human monocytes. J. Biol. Chem. 274:264.[Abstract/Free Full Text]

This article has been cited by other articles:

				D. E. Peterson, N. P. Barker, L. I. Akhmadullina, I. Rodionova, N. Z. Sherman, I. S. Davidenko, G. N. Rakovskaya, E. A. Gotovkin, S. A. Shinkarev, M. V. Kopp, et al. Phase II, Randomized, Double-Blind, Placebo-Controlled Study of Recombinant Human Intestinal Trefoil Factor Oral Spray for Prevention of Oral Mucositis in Patients With Colorectal Cancer Who Are Receiving Fluorouracil-Based Chemotherapy J. Clin. Oncol., September 10, 2009; 27(26): 4333 - 4338. [Abstract] [Full Text] [PDF]

				D. P. O'Brien, J. Romero-Gallo, B. G. Schneider, R. Chaturvedi, A. Delgado, E. J. Harris, U. Krishna, S. R. Ogden, D. A. Israel, K. T. Wilson, et al. Regulation of the Helicobacter pylori Cellular Receptor Decay-accelerating Factor J. Biol. Chem., August 29, 2008; 283(35): 23922 - 23930. [Abstract] [Full Text] [PDF]

				S. O. Carrigan, D. B. S. Pink, and A. W. Stadnyk Neutrophil transepithelial migration in response to the chemoattractant fMLP but not C5a is phospholipase D-dependent and related to the use of CD11b/CD18 J. Leukoc. Biol., December 1, 2007; 82(6): 1575 - 1584. [Abstract] [Full Text] [PDF]

				D. M. Cauvi, G. Cauvi, and K. M. Pollard Constitutive Expression of Murine Decay-Accelerating Factor 1 Is Controlled by the Transcription Factor Sp1 J. Immunol., September 15, 2006; 177(6): 3837 - 3847. [Abstract] [Full Text] [PDF]

				J. C. I. Singh, S. M. Cruickshank, D. J. Newton, L. Wakenshaw, A. Graham, J. Lan, J. P. A. Lodge, P. J. Felsburg, and S. R. Carding Toll-like receptor-mediated responses of primary intestinal epithelial cells during the development of colitis Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G514 - G524. [Abstract] [Full Text] [PDF]

				V. R. Holla, D. Wang, J. R. Brown, J. R. Mann, S. Katkuri, and R. N. DuBois Prostaglandin E2 Regulates the Complement Inhibitor CD55/Decay-accelerating Factor in Colorectal Cancer J. Biol. Chem., January 7, 2005; 280(1): 476 - 483. [Abstract] [Full Text] [PDF]

				F. Lin, D. Spencer, D. A. Hatala, A. D. Levine, and M. E. Medof Decay-Accelerating Factor Deficiency Increases Susceptibility to Dextran Sulfate Sodium-Induced Colitis: Role for Complement in Inflammatory Bowel Disease J. Immunol., March 15, 2004; 172(6): 3836 - 3841. [Abstract] [Full Text] [PDF]

				J. C. Mason, Z. Ahmed, R. Mankoff, E. A. Lidington, S. Ahmad, V. Bhatia, A. Kinderlerer, A. M. Randi, and D. O. Haskard Statin-Induced Expression of Decay-Accelerating Factor Protects Vascular Endothelium Against Complement-Mediated Injury Circ. Res., October 18, 2002; 91(8): 696 - 703. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Andoh, A. Articles by Podolsky, D. K. Search for Related Content PubMed PubMed Citation Articles by Andoh, A. Articles by Podolsky, D. K.