|
|
||||||||
Gastrointestinal Unit and Center for the Study of Inflammatory Bowel Disease, Department of Medicine, Massachusetts General Hospital, and Harvard Medical School, Boston, MA 02114.
| Abstract |
|---|
|
|
|---|
B-DNA binding activity and DAF promoter
activity were assessed by an electrophoretic gel mobility shift assay
and a reporter gene luciferase assay, respectively. ITF induced a dose-
and time-dependent increase in DAF protein and mRNA expression in human
(HT-29 and T84) and rat (IEC-6) intestinal epithelial cells. In
differentiated T84 cells grown on cell culture inserts, basolateral
stimulation with ITF strongly enhanced DAF expression, but apical
stimulation had no effects. The C3 deposition induced by complement
activation was significantly blocked by the treatment with ITF. In
HT-29 cells, ITF increased the stability of DAF mRNA. ITF also enhanced
the promoter activity of the DAF gene via NF-
B motif and induced
activation of NF-
B-DNA binding activity. ITF promotes protection of
epithelial cells from complement activation via up-regulation of DAF
expression, contributing to a robust mucosal
defense. | Introduction |
|---|
|
|
|---|
Trefoil peptides, which comprise a family of small protease-resistant proteins characterized by one or more trefoil motifs, play a critical role in epithelial restitution (2, 3). Three trefoil peptides have been identified in humans (3); spasmolytic polypeptide (SP/TFF2),3 pS2/TFF1, and intestinal trefoil factor (ITF/TFF3). Human SP is mainly expressed in the gastric mucous neck cells, and pS2 is expressed in gastric surface (foveolar) mucous cells (4, 5). ITF is synthesized and secreted by goblet cells in the small and large intestine (6). At the margins of mucosal injury such as inflammatory bowel disease (IBD) and gastric ulcer, the expression of trefoil peptides is rapidly up-regulated, and they appear to promote epithelial restitution (2, 3, 5, 7, 8, 9). In ITF-deficient mice, epithelial restitution is absent in the colon, and oral administration of dextran sulfate sodium induces death associated with extensive colitis, presumably because of the failure of healing processes (10). Trefoil peptides have been shown to prevent gastrointestinal injury caused by alcohol and indomethacin and to induce rapid reseal of erosions (11). Thus, trefoil peptides play an important role in the repair and healing of gastrointestinal epithelium through enhancing epithelial restitution (12).
The decay-accelerating factor (DAF) CD55, a 70,000 m.w. glycoprotein that is anchored to the plasma cell membrane by a glycosyl-phosphatidylinositol linkage (13) is another important mucosal defensive protein. DAF prevents the assembly and accelerates the dissociation of autologous C3 convertases (C4b2a and C3bBb) and C5 convertases (C4b2a3b and C3bBb3b), thus efficiently interrupting the amplification steps of the classical and alternative complement activation pathways on host cell surfaces (13, 14, 15). Through these actions, DAF protects host tissues from autologous complement injury.
In the human intestinal tract, DAF has been localized to the apical surfaces of epithelial cells (16). The hepatobiliary system and the exocrine pancreas also secrete large amounts of active complement components into the gastrointestinal tract (17, 18). Intestinal epithelial cells (IECs) locally synthesize and secrete complement components into the lumen (19, 20, 21, 22). Indeed, complement deposition has been detected in the lesions of IBD, celiac disease, and recently in Helicobacter pylori gastritis (23, 24, 25, 26). These observations suggest that inflammatory conditions induce complement activation in the gastrointestinal tract. Interestingly, DAF expression is markedly increased at the inflamed mucosa of IBD patients (16, 27). However, the mechanisms regulating DAF expression to limit complement-induced tissue damage along the gastrointestinal tract remain unclear.
In the present study, we tested the hypothesis that ITF promotes DAF expression in IECs. Because the enhancement of anti-complement activity via DAF expression may enable more effective repair, we speculated that ITF might up-regulate this protective mechanism, in parallel with its ability to facilitate epithelial restitution.
| Materials and Methods |
|---|
|
|
|---|
Human colon cancer cell lines HT-29 and T84 and the rat IEC line
IEC-6 were obtained from American Type Culture Collection (Manassas,
VA). HT-29 cells were grown in RPMI 1640 containing 10% FBS, and T84
cells were cultured in a 1:1 mixture of DMEM and Hams F-12 medium
containing 10% FBS. IEC-6 cells were grown in DMEM containing 10%
FBS. All culture medium was supplemented with 50 U/ml penicillin and 50
µg/ml streptomycin. In some experiments, T84 cells were grown on
inserts of 0.4 mm pore size (Falcon 3090; BD Biosciences, Mountain
View, CA), and used after achieving transepithelial resistance >400
determined with a Millicell-ERS (Millipore, Bedford, MA) apparatus.
Purified recombinant human ITF was produced as described previously
(28).
Immunoblotting
Expression of DAF protein was confirmed by immunoblotting of cell lysates and growth medium. Cells were grown to confluence in 60-mm cell culture dishes and stimulated with various concentrations of ITF for 48 h. Cells were harvested by scraping and washed with PBS. The pellet was resuspended in 0.5 ml of ice-cold 1% Triton X-114 hypertonic buffer (20 mM Tris, 100 mM NaCl, and protease inhibitor mixture) and sonicated for 30 s. Insoluble material was removed by centrifugation at 13,000 x g. Supernatant was layered onto 0.5 ml of 9% sucrose and incubated at 37° for 5 min to allow phase separation. Cultured medium was mixed with Triton X-100 (final 1%), and similarly treated. The lower detergent-rich layer was recovered after centrifugation, and protein concentrations were determined by Bradford assay (Bio-Rad, Hercules, CA). Equal amounts of protein (2 µg/sample) were separated by nonreducing 10% SDS-PAGE. Gels were blotted and probed with anti-human DAF mAb (IA10; BD PharMingen, San Diego, CA) or anti-rat DAF mAb (RDIII-7; generous gift from B. Morgan, University of Wales College of Medicine; Ref. 14). Detection was accomplished with HRP-coupled sheep anti-mouse IgG (Amersham, Arlington Heights, IL) and the Renaissance chemiluminescence assay (NEN, Boston, MA).
Northern blotting
Total cellular RNA was isolated by TRIzol reagent (Life Technologies, Grand Island, NY). Northern blotting for human DAF gene was performed according to a method described previously (29). A probe specific for the human DAF gene also was prepared as described previously (29). A probe for rat DAF gene was generated by RT-PCR with the following primers: 5'-AATGGTCACATCAACATACCAACT (511534); and 3'-CGTTGGATGACGTACCGTTGTCTT (10861063) (14). It was cloned with a TA-vector kit (Invitrogen, Carlsbad, CA).
DAF promoter luciferase reporter constructs and cell transfection
Three different sizes of human DAF promoter region
(30) were amplified by PCR with human genomic DNA as a
template with the following primers: DAF (-724),
TTCAGATCTCAGTCAGTCTGGAGTAAT; DAF (-437), CAGAGATCTAACTCCACCGCACCTGCA;
DAF (-126), TCTAGATCTACCTCTGACCACAACAAA; and DAF (+80),
ATGAAGCTTCGGGTTAGAACAAGGACG. The DAF (+80) was used as the common
downstream (antisense) primer. The 5' sequence of DAF (-724), DAF
(-437), and DAF (-126) were modified for BglII site, and
the 5' region of DAF (+80) was modified for HindIII site,
respectively. These fragments were ligated into BglII and
HindIII sites of the luciferase reporter plasmid pGL3-Basic
(Promega, Madison, WI), yielding the reporter constructs -724 DAF,
-437 DAF, and -126 DAF. The sequence of inserts was configured with
an autosequencer. The reporter plasmid was amplified in DH5
Escherichia coli (Life Technologies) and purified with a
Plasmid Maxi kit (Qiagen, Valencia, CA). Transient transfection was
performed by using Lipofectamine Plus reagent (Life Technologies)
according to the manufacturers instructions. Twenty hours before
transfection, 1 x 106 HT-29 cells were
plated in triplicate in 35-mm wells of a 6-well plate. For each well, 1
µg of plasmid DNA and 0.2 µg of
-galactosidase reporter vector
pCMV
(CLONTECH Laboratories, Palo Alto, CA) were cotransfected and
incubated for 24 h. The medium was changed and cells incubated in
the presence of stimuli for 12 h. The luciferase activity was
measured by the Luciferase Assay System kit (Promega) and expressed as
relative activity normalized to
-galactosidase activity.
Nuclear extracts and EMSA
Nuclear extracts were prepared from HT-29 cells exposed to ITF
(10 µm) and TNF-
(20 ng/ml) by the method of Dignam et al.
(31). Consensus oligonucleotides of NF-
B
(5'-AGTTGAGGGGACTTTCCCAGCC) was used (32).
Oligonucleotides were 5' end-labeled with T4 polynucleotide kinase
(Promega) and [
-32P]ATP (NEN). Binding
reactions were performed by preincubating 7.5 µg of nuclear proteins
in HEPES (20 mM; pH 7.9), KCl (60 mM), MgCl2 (1
mM), EDTA (0.1 M), glycerol (10%), DTT (0.5 mM), and poly(dI-dC) (2
µg) on ice for 10 min, followed by addition of the
32P-labeled oligonucleotide and a second
incubation at room temperature for 20 min. Samples were loaded directly
on nondenaturing 4% polyacrylamide gels prepared in Tris-glycine-EDTA
buffer (pH 8.5). The gels were dried and exposed to Kodak (Rochester,
NY) XRP film with an intensifying screen. Supershift experiments were
performed as described above except that 1 µl of Ab for each
transcription factor was added to the binding mixture in the absence of
the labeled probe. Antisera specifically recognizing each
transcriptional factor were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). Experiments with unlabeled oligonucleotides used a
100-fold molar excess relative to the radiolabeled oligonucleotide.
ELISA for human complement C3
To evaluate C3 deposition, cells were lysed by buffer (20 mM Tris, 10 mM EDTA, 100 mM NaCl, 0.5% Nonidet P40, 0.5% sodium deoxycholate, and protease inhibitor mixture), and C3 levels were determined by ELISA as described previously (21). These C3 molecules also were analyzed by SDS-PAGE under reducing condition and immunoblot.
Statistical analysis
Students t test was used to compare data between two groups (e.g., control and ITF-treated group). Values for p < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
HT-29 cells were stimulated with ITF (10 µm) or TNF-
(20
ng/ml) for 48 h, and DAF protein expression then was assessed by
immunoblotting (Fig. 1
A).
Unstimulated HT-29 cells expressed small amounts of DAF protein,
detected as a single band of
70,000 m.w., as described previously
(13). ITF stimulated DAF protein expression, although this
effect was less than that induced by TNF-
. HT-29 cells were
incubated with increasing concentrations of ITF for 48 h, and DAF
protein expression was determined. As shown in Fig. 1
B, ITF
increased DAF protein expression in a concentration-dependent
manner.
|
ITF stimulation increases DAF mRNA abundance in HT-29 cells
HT-29 cells were incubated with increasing concentrations of ITF
for 12 h, and DAF mRNA abundance was determined by Northern blot.
As shown in Fig. 2
A, DAF
transcripts were detected as 2.2 and 1.6 kb in HT-29 cells, as reported
previously (29, 33). ITF induced a concentration-dependent
increase in DAF mRNA abundance, and these effects reached a maximum at
10 µM of ITF. To determine the kinetics of ITF-induced effects, HT-29
cells were incubated for different duration in medium alone or in
medium containing ITF. An increase in DAF mRNA abundance was observed
as early as 3 h and reached a maximum by 12 h.
|
To assess the generality of the effects of ITF observed in HT-29
cells, the effect of ITF on DAF expression was evaluated with the
rat nontransformed IEC line IEC-6. The IEC-6 cells were incubated
with ITF for 6 h, and DAF mRNA abundance was assessed by Northern
blot analysis. As shown in Fig. 3
A, ITF increased DAF mRNA
abundance in IEC-6 cells. Incubation with ITF for 48 h also
enhanced DAF protein expression (Fig. 3
B).
|
). Of note, as shown in Fig. 4
|
To evaluate whether ITF stimulation increases functional
anticomplement activity, we tested the effects of ITF on complement C3
deposition. HT-29 cells were cultured in the absence or presence of ITF
for 48 h, and then cells were incubated with acidified fresh human
serum for 2 h. After extensive washing, cells were lysed and C3
deposition was evaluated by immunoblot and ELISA. As demonstrated in
Fig. 5
A, serum C3 is composed
of
- and
-chains linked by disulfide bond (35).
Deposited C3 was detected as C3b, in which the molecular size of
-chain was smaller than that of native C3 (35). ITF
treatment markedly decreased C3 deposition, and these effects were
abrogated by the addition of PI-PLC, which cleaves GPI linkage and
releases DAF from the cell surface. ELISA analysis demonstrated that
ITF treatment decreased C3 deposition by 55% in HT-29 cells (Fig. 5
B). C3 deposition also was assessed in T84 cells grown on
the cell culture inserts (Fig. 5
C). Addition of ITF to the
basolateral side significantly decreased C3 deposition, whereas apical
addition of ITF had no effect. These findings are compatible with the
results of DAF mRNA and protein expression in T84 cells.
|
Several factors have been reported to induce DAF expression in
IECs; IL-4 and TNF-
strongly enhance DAF expression by HT-29 cells
(29, 33). However, the mechanisms regulating DAF
expression by these factors vary. TNF-
requires de novo protein
synthesis to increase DAF mRNA abundance, but IL-4 does not.
Accordingly, the effect of cycloheximide, a protein synthesis
inhibitor, on ITF regulation of DAF expression by HT-29 cell was
evaluated. As shown in Fig. 6
, the
addition of cycloheximide strongly enhanced DAF mRNA abundance,
indicating superinduction of the DAF gene (36, 37). The
addition of cycloheximide completely abrogated ITF-induced increase of
DAF mRNA abundance, indicating that ITF requires de novo protein
synthesis to up-regulate DAF gene expression.
|
To evaluate the possibility that ITF-induced DAF mRNA is dependent
on increased mRNA stability, HT-29 cells were incubated for 6 h in
medium alone or in medium plus ITF, washed, and then treated with
actinomycin D (5 µg/ml) for various time periods to block further RNA
transcription (Fig. 7
). In cells treated
with medium alone, DAF mRNA abundance decreased by 60% at 6 h
after the addition of actinomycin D. Treatment with ITF actually
delayed DAF mRNA degradation; 85% of DAF mRNA remained after 6 h.
These findings suggest that some of the effects of ITF on DAF mRNA
abundance may result from an increase in DAF mRNA stability.
|
ITF induces DAF promoter activity
To determine whether ITF regulates DAF gene transcription, three
different regions of the human DAF promoter extending to bp -724
upstream of the transcription start site were cloned with human genomic
DNA. This region contains a consensus binding site for NF-
B (at bp
-393 to bp -384) and/or AP-1 (at bp -67 to bp -73; Ref.
30). These fragments were cloned into a luciferase
reporter plasmid (designated plasmids -724 DAF, -437 DAF, -126 DAF).
The -724 DAF and -437 DAF plasmids contain a NF-
B and AP-1 site,
and the -126 DAF plasmid contains only an AP-1 site. As shown in Fig. 8
, TNF-
(50 ng/ml) and ITF
significantly increased relative luciferase activity in HT-29 cells
transfected with the -724 DAF and -437 DAF plasmids. However, ITF
stimulation was modest compared with that by TNF-
. ITF stimulation
of luciferase activity was absent in cells transfected with the -126
DAF plasmid, which lacks an NF-
B binding site. These results suggest
that ITF stimulation of the DAF promoter is mediated predominantly via
NF-
B activation and that the role of AP-1 is negligible. EMSA was
performed to determine whether ITF stimulation results in formation of
active NF-
B-DNA binding complexes. As shown in Fig. 9
, stimulation with ITF induced formation
of a NF-
B-DNA binding complex, although this binding was weaker than
that induced by TNF-
(20 ng/ml). These binding complexes were
blocked by cold probe and supershifted by Abs against p50 and p65
NF-
B subunits.
|
|
| Discussion |
|---|
|
|
|---|
The present studies demonstrate that ITF, a potent stimulator of
epithelial restitution (2, 3), enhances DAF expression in
a variety of intestinal epithelial cell lines. This increase was
accompanied by an increase in functional activity to block complement
C3 deposition. Previous studies have demonstrated that ITF expression
is rapidly induced at the ulcerative and inflammatory lesions of the
gastrointestinal tracts (5, 7, 8, 9). In such lesions,
persistent activation of complement cascade may occur, as the denuded
mucosa results in a massive influx of serum complement components into
the lumen, and inflammatory mediators such as proinflammatory cytokines
IL-1
and TNF-
stimulate local complement synthesis in epithelial
and other cells (21, 22). ITF stimulation of DAF
expression may complement other actions on epithelial cells that
promote repair and healing processes in damaged mucosa. These results
suggest that ITF may play an important role in protecting epithelial
cells against complement-mediated injury via induction of DAF
expression. ITF-induced DAF expression may facilitate epithelial
restitution in conditions associated with increased complement
activation.
In physiological conditions, ITF is secreted by goblet cells into the
lumen and coats the mucosal surface (6). This abundant ITF
contributes to the stability of the viscoelastic gel that is essential
to the preservation of the integrity of the mucosal surface and help
reestablishing epithelial continuity over the mucosal defect (3, 6). The abundant expression of ITF contrasts with the generally
minimal expression of epithelial DAF under normal condition.
Observations in T84 cells, a model system for vectorial ITF stimulation
(34), indicate that ITF enhances the expression of DAF
mRNA and protein only when present on the basolateral side. Basolateral
stimulation by ITF prevented complement C3 deposition on T84 cells.
From a functional viewpoint, these findings indicate that ITF coating
the mucosal surface does not stimulate basal DAF expression under
normal condition. However, after mucosal injury, the denuded mucosa
enables easy access and contact of ITF with the basolateral surface of
epithelial cells, leading to increased epithelial cell DAF expression.
Although previous studies demonstrated that several cytokines including
IL-4 and TNF-
stimulate DAF expression, ITF provides a more
efficient mechanism for induction of DAF expression at inflammatory and
ulcerative lesions in gastrointestinal tract. It is likely that ITF may
function as an inducer of DAF expression immediately after mucosal
injury, promptly enhancing protection against complement-mediated
injury to facilitate mucosal repair.
As a posttranscriptional mechanism regulating gene expression, stabilization of mRNAs contributes to rapid induction of genes in inflammatory responses (38). Many short-lived and rapidly inducible mRNAs contain AU-rich elements (AREs) within their 3' untranslated region. AREs have been implicated as key determinants in regulating transcript stability (38). The presence of AREs of four AUUUA motifs in the 3'-untranslated region of DAF mRNA (nt 18951913) suggests that DAF gene expression may be regulated by the mechanism of mRNA stabilization (42). This inference is supported by the superinduction of DAF gene by cycloheximide, which inhibits a posttranscriptional mechanism mediating the degradation of short-lived transcripts, resulting in marked increases in mRNA half-life (36). In this study, ITF stimulation induced a marked increase in DAF mRNA stability, indicating that posttranscriptional mechanisms mediate ITF-induced up-regulation of the DAF gene. Recent studies have also reported that p38 MAP kinase plays a role in the induction of mRNA stabilization by inflammatory stimuli, e.g., p38 MAP kinase regulates stability of cyclooxygenase-2 and IL-8 mRNAs (38, 39). However, the p38 MAP kinase inhibitor SB 203580 did not affect the ITF-induced DAF mRNA stabilization in HT-29 cells. Furthermore, ITF did not induce phosphorylation of p38 MAP kinase in this cell line (data not shown). These observations suggest that ITF induces DAF mRNA stabilization by mechanisms independent of p38 MAP kinase activation.
Efforts to determine the mechanism through which ITF induces changes in
expression of DAF mRNA focused on activation of NF-
B given
similarities to the effects of TNF-
. NF-
B plays a central role in
the transcriptional activation of genes encoding proteins induced by
TNF-
(32). Indeed, a consensus motif of NF-
B binding
sequence is present in the promoter regions of DAF gene (nucleotide bp
-393 to bp -384; Ref. 30), and both transient
transfection and EMSAs demonstrated that NF-
B activation is induced
by ITF stimulation in HT-29 cells, suggesting that
ITF-induced regulation of DAF expression may be mediated, at least in
part, by NF-
B-mediated transcriptional activation of DAF gene. Thus,
ITF increases the abundance of DAF gene through both transcriptional
and posttranscriptional mechanisms.
In conclusion, these studies provide insight into a previously unappreciated dimension of trefoil peptides that contribute to mucosal defense. This process can assure rapid induction of DAF and subsequent increase in protection against complement attack at sites of mucosal injury. When a mucosal defect occurs, up-regulation of ITF secretion in the wound margin may provide protection for the epithelial cells that migrate across the defect against complement attack. Thus, up-regulation of DAF expression by ITF may provide a mechanism to protect gastrointestinal mucosa during inflammatory and ulcerative processes involving complement activation.
| Footnotes |
|---|
2 Address correspondence to Dr. Daniel K. Podolsky, Gastrointestinal Unit, Massachusetts General Hospital, 55 Fruit Street, Boston, MA 02114. E-mail address: Podolsky.Daniel{at}mgh.harvard.edu ![]()
3 Abbreviations used in this paper: SP/TFF2, spasmolytic polypeptide; ITF/TFF3, intestinal trefoil factor; IBD, inflammatory bowel disease; DAF, decay-accelerating factor; IEC, intestinal epithelial cell; MAP, mitogen-activated protein; ARE, AU-rich element. ![]()
Received for publication May 11, 2001. Accepted for publication July 24, 2001.
| References |
|---|
|
|
|---|
. Gastroenterology 105:1323.[Medline]
independent pathway. J. Clin. Invest. 94:376.
knockout mouse after gastric ulceration. Am. J. Physiol. 272:G1540.
mRNAs in rat stomach. J. Pathol. 175:405.[Medline]
B: Pleiotropic mediator of inducible and tissue-specific gene control. Cell 58:227.[Medline]
up-regulates decay-accelerating factor gene expression in human intestinal epithelial cells. Immunology 90:358.[Medline]
This article has been cited by other articles:
![]() |
D. P. O'Brien, J. Romero-Gallo, B. G. Schneider, R. Chaturvedi, A. Delgado, E. J. Harris, U. Krishna, S. R. Ogden, D. A. Israel, K. T. Wilson, et al. Regulation of the Helicobacter pylori Cellular Receptor Decay-accelerating Factor J. Biol. Chem., August 29, 2008; 283(35): 23922 - 23930. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Carrigan, D. B. S. Pink, and A. W. Stadnyk Neutrophil transepithelial migration in response to the chemoattractant fMLP but not C5a is phospholipase D-dependent and related to the use of CD11b/CD18 J. Leukoc. Biol., December 1, 2007; 82(6): 1575 - 1584. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Cauvi, G. Cauvi, and K. M. Pollard Constitutive Expression of Murine Decay-Accelerating Factor 1 Is Controlled by the Transcription Factor Sp1 J. Immunol., September 15, 2006; 177(6): 3837 - 3847. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. I. Singh, S. M. Cruickshank, D. J. Newton, L. Wakenshaw, A. Graham, J. Lan, J. P. A. Lodge, P. J. Felsburg, and S. R. Carding Toll-like receptor-mediated responses of primary intestinal epithelial cells during the development of colitis Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G514 - G524. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. R. Holla, D. Wang, J. R. Brown, J. R. Mann, S. Katkuri, and R. N. DuBois Prostaglandin E2 Regulates the Complement Inhibitor CD55/Decay-accelerating Factor in Colorectal Cancer J. Biol. Chem., January 7, 2005; 280(1): 476 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lin, D. Spencer, D. A. Hatala, A. D. Levine, and M. E. Medof Decay-Accelerating Factor Deficiency Increases Susceptibility to Dextran Sulfate Sodium-Induced Colitis: Role for Complement in Inflammatory Bowel Disease J. Immunol., March 15, 2004; 172(6): 3836 - 3841. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Mason, Z. Ahmed, R. Mankoff, E. A. Lidington, S. Ahmad, V. Bhatia, A. Kinderlerer, A. M. Randi, and D. O. Haskard Statin-Induced Expression of Decay-Accelerating Factor Protects Vascular Endothelium Against Complement-Mediated Injury Circ. Res., October 18, 2002; 91(8): 696 - 703. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |