| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Pharmexa A/S, Hørsholm, Denmark; and
Division of Biochemistry and Molecular Biology, John Curtin School of Medical Research, Australian National University, Canberra, Australia
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
50% in the airways of allergen-challenged mice. Most
importantly, Th-modified IL-5 DNA vaccination restores normal bronchial
hyperresponsiveness to 
-methacholine. Active vaccination against
IL-5 reduces key pathological events associated with asthma, such as
Th2 cytokine production, airways inflammation, and hyperresponsiveness,
and thus represents a novel therapeutic approach for the treatment of
asthma and other allergic conditions. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The central role of IL-5 in regulating eosinophil function (differentiation, expansion, mobilization, and activation) has identified this cytokine as a primary target for therapeutic intervention in asthma. Indeed, the importance of IL-5 in regulating eosinophilia and potentially asthma pathogenesis has been demonstrated in experimental systems that have used animal models of asthma in conjunction with IL-5-deficient mice and inhibitory mAbs (15, 16, 17). These studies have highlighted the need to develop advanced methodologies that target IL-5 function for the resolution of both inflammation and AHR in asthma.
The aim of the current investigation was to induce a therapeutic immune response directed against self-IL-5. Although anti-IL-5 mAbs are being used in clinical trials in Ag challenge studies, this cytokine has never been used as a target for active vaccination. Here we describe a novel therapeutic DNA vaccine approach for the treatment of allergy and asthma. Our strategy was to use active DNA vaccination against IL-5 to elicit polyclonal Abs that would neutralize IL-5 produced during recall responses to inhaled allergen and ameliorate disease. This therapeutic approach has the potential advantage not only of providing protection during asthma exacerbation, but also as a longitudinal anti-inflammatory therapy. We have shown previously that by incorporating a strong Th cell epitope within a self-protein, immunological tolerance against self-proteins can be bypassed (18, 19, 20). In the current investigation, we extended these studies by using a DNA vaccine encoding murine IL-5 modified to contain a promiscuous foreign Th epitope to break or bypass immunological tolerance to IL-5. In mice, Th-modified IL-5 DNA vaccination induced an immune response directed against native IL-5. Moreover, in our established models of experimental asthma, Th-modified IL-5-vaccinated mice induced an immune response directed against IL-5 that reduced both pulmonary lymphocyte infiltration and eosinophilia, reduced the levels of Th2 cytokines, and inhibited the development of AHR. These data substantiate active DNA vaccination against IL-5 as a novel therapeutic approach for the treatment of asthma and potentially other allergic diseases. In addition, our vaccine approach is a platform technology that can be applied to most self-proteins that are aberrantly or overexpressed during chronic disease.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Male C3H/Hen (H-2k) or C3H/HeJ (H-2k) mice (6–8 wk old) were obtained from M&B A/S (Ry, Denmark),or the specific-pathogen free facility at the John Curtin School of Medical Research, Australian National University. Experiments were performed according to the Danish Animal Experiments Inspectorate and John Curtin School of Medical Research institutional guidelines for animal care and use.
Modified IL-5 plasmid construction and DNA preparation
Murine IL-5 cDNA (R&D Systems, Minneapolis, MN) was cloned into pcDNA3.1 (Invitrogen, Carlsbad, CA) mammalian expression vector containing the mIL-5 signal peptide and a consensus Kozak sequence (21). The P30 tetanus toxoid (22) helper epitope (FNNFTVSFWLRVPKVSASHLE) was inserted into the first loop region of mIL-5, replacing aa R30 to L41, using sequence overlap extension PCR (sense primer, CTTCTGGCTGCGCGTGCCCAAGGTGAGCGCCAGCCACCTGGAGTGCATTGGAGAGATCTTTCAGGGGC; antisense primer, GCGCTCACCTTGGGCACGCGCAGCCAGAAGCTCACGGTGAAGTTGTTGAACATCGTCTCATTGCTTGTCAACAGAGC) and standard molecular biology techniques. Plasmid DNA was prepared using endotoxin-free purification kits (Qiagen, Valencia, CA) and was resuspended in sterile 0.9% saline.
DNA vaccination
Mice were anesthetized, and the lower back of each animal was shaved. Vaccination with mIL-5.wt (encodes the wild-type mouse IL-5 cDNA) or mIL-5.2 (encodes the mIL-5.2 Th-modified construct) was then performed by intradermal injections of 100 µl of DNA solution (1 µg/µl) into each mouse divided into two injections over the lower back. DNA injections were performed six or seven times at 2-wk intervals. At the end of the sixth vaccination, mice were sensitized to OVA to prime for subsequent induction of allergic airway inflammation (described below). Vaccinations were continued (one injection of DNA every 2 wk) during the period of induction of allergic disease of the lung.
ELISA
Anti-mIL-5 titers in sera were determined by direct ELISA. Briefly, pooled sera from vaccinated mice were titrated into 96-well flat-bottom plates (Maxisorp; Nunc, Taastrup, Denmark) precoated with mIL-5 (100 ng/well; R&D Systems). Sera were detected with goat anti-mouse-HRP polyclonal Ab (DAKO, Glostrup, Denmark). Competition ELISAs were performed by adding diluted antisera preincubated with mIL-5 for 1 h to 96-well plates coated with anti-mIL-5 mAb (TRFK5,1 µg/well; R&D Systems). Inhibition by the antisera was detected by adding biotinylated TRFK4 (R&D Systems) and streptavidin-HRP (Amersham, Hørsholm, Denmark). Serum OVA-specific IgE was detected by isotype-specific ELISA using rat anti-mouse IgE mAb, clone LO-ME-3 (BioSource International, Camarillo, CA). OVA-specific IgE was quantitated against standard mouse IgE.
Induction of allergic airway inflammation
Intranasal model. Mice were sensitized by s.c. injection of 50 µg of OVA in 0.9% sterile saline mixed 1/1 (v/v) with Adju-Phos (Superfos Biosector, Vedbaek, Denmark) weekly over 3 wk. Four days after the last sensitization the mice were challenged intranasally with 12.5 µg of OVA in 0.9% sterile saline once a day, every other day, for a total of three challenges. Bronchoaveolar lavage fluid (BALF) was collected 1 day following the last challenge.
Aeroallergen models: sensitization regimen. Mice were sensitized by i.p. injection with 50 µg of OVA/1 mg of Alhydrogel (CSL, Parkville, Australia) in 0.9% sterile saline. Nonsensitized mice received 1 mg of Alhydrogel in 0.9% saline. On days 12, 14, 16, and 18, all groups of mice were aeroallergen challenged with OVA as previously described (15, 23). Blood was collected on days 13, 15, 17, and 19. Twenty-four hours after the last aeroallergen challenge AHR was measured, and then BALF and lung tissue were collected for analysis of inflammatory infiltrates.
Generation and transfer of Th2 cells and induction of allergic disease of the lung
T cell donor mice (male C3H/Hej, 6–8 wk of age) were sensitized
by i.p. injection of 50 µg of OVA/1 mg of Alhydrogel in 0.9% sterile
saline to prime for CD4+ Th2-like cells. Six days
following sensitization donor mice were sacrificed, and their spleens
were excised. Splenocytes were then disaggregated, contaminating RBC
were lysed, and subsequently washed splenocytes were resuspended at 5
x 106 cells/ml in RPMI 1640 culture
medium. These cells were then cultured for 4 days at 37°C in
the presence of 200 µg/ml OVA, 20 ng/ml murine IL-4, and 40 µg/ml
anti-IFN-
(R46A2). CD4+ T cells were
isolated from cultures using high gradient magnetic MiniMACS separation
column (MACS separation) as described previously (23),
washed, and resuspended in PBS. CD4+ T cells
(2 x 106 cells) were adoptively transferred
to DNA-vaccinated or unvaccinated naive C3H/Hej mice or were stimulated
in vitro with mitomycin-treated APCs in the presence of OVA to
determine Th2 cytokine profiles. Twelve and 36 h later, recipients
were exposed to an aerosol of OVA (10 mg/ml) in 0.9% saline twice for
30 min each time (30-min interval between exposures). AHR to
-methacholine was determined, and blood, BALF, and lung tissue were
collected for the analysis of inflammatory infiltrates 24 h after
the last aerosol.
Characterization of lung morphology and leukocytes in blood, tissue, and BALF
Lung tissue representing the central (bronchi-bronchiole) and peripheral (alveoli) airways was fixed in 10% phosphate-buffered Formalin, sectioned, and stained with Alcian blue-periodic acid-Schiff for the enumeration of mucin-secreting cells or Carbol’s chromotrope-hematoxylin for the identification of eosinophils. Eosinophils in blood, BALF, and lung were identified by morphological criteria and quantified as previously described (15, 23).
Measurement of AHR
Responsiveness to -methacholine was assessed in conscious
unrestrained mice by barometric plethysmography using apparatus and
software supplied by Buxco (Troy, NY). This system yields a
dimensionless parameter known as enhanced pause (Penh), reflecting
changes in waveform of the pressure signal from the plethysmography
chamber combined with a timing comparison of early and late
expirations. Measurement of Penh was performed essentially as
previously described (24, 25). Briefly, mice were placed
in the plethysmograph chamber and exposed to an aerosol of water
(baseline readings) and then to cumulative concentrations of
-methacholine ranging from 3 to 50 mg/ml. The aerosol was generated
by an ultrasonic nebulizer and drawn through the chamber for 2 min. The
inlet was then closed, and Penh readings were taken for 3 min and
averaged. Values were reported as the percent increase over
baseline.
Measurement of cytokine production by peribronchial lymph nodes
Cells from the peribronchial lymph nodes were isolated and stimulated with 1 mg/ml OVA in MLC medium for 72 h as described previously (25). The concentrations of IL-4, IL-5, and IL-13 in the cell-free supernatants were measured with ELISA (25). The sensitivity of detection was 0.5 ng/ml for IL-5 and IL-13 and 0.1 ng/ml for IL-4.
RT-PCR analysis
Total RNA was isolated from lungs by standard methods with
RNAzol B (Biotecx Laboratories, Houston, TX). A RT-PCR procedure was
performed as previously described (26) to determine
relative quantities of mRNA for various cytokines. The primers and
probes for all genes were purchased from Life Technologies
(Gaithersburg, MD). Primer and probe sequences for hypoxanthine-guanine
phosphoribosyl transferase (HPRT) have been described previously
(26). Primer and probe sequences for IL-4, IL-5, IL-10,
IL-13, IFN-, and HPRT are as follows: IL-4: sense,
GAATGTACCAGGAGCCATATC; antisense, CTCAGTACTACGAGTAATCCA; probe,
AGGGCTTCCAAGGTGCTTCGCA; IL-5: sense,
GACAAGCAATGAGACACGATGAGG; antisense,
GAACTCTGCAGGTAATCCAGG; probe, GGGGGTACTGTGGAAATGCTTAT; IL-10:
sense, CGGGAAGACAATAACTG; antisense, CATTTCCGATAAGGCTTGG;
probe, GGACTGCCTTCAGCCAGGTGAAGACTTT; IL-13: sense,
CTCCCTCTGACCCTTAAGGAG; antisense, GAAGGGGCCGTGGCGAAACAG;
probe, TCCAATTGCAATGCCATCTAC; and IFN-: sense,
AACGCTACACACTGCATCTTGG; antisense, GACTTCAAAGAGTCTGAGG; probe,
GGAGGAACTGGCAAAAGGA. The cycle numbers used for amplification of each
gene product are: IL-10, 27 cycles; IL-13 and IFN-, 30 cycles; IL-4
and IL-5, 28 cycles; and HPRT, 23 cycles. After the appropriate number
of PCR cycles, the amplified DNA was analyzed by gel electrophoresis
and Southern blotting and was detected using the ECL detection system
as recommended by the manufacturer (Amersham, Arlington Heights, IL).
PCR amplification with the HPRT reference gene was performed to assess
variations in cDNA or total RNA loading between samples. Mean relative
transcript levels per group were determined from cDNA panels as
previously described (27). Briefly, values were derived by
dividing the mean of the triplicate values measured for the transcript
of interest by the mean of triplicate HPRT values for the sample.
Statistical analysis
The significance of differences between experimental groups was analyzed using Student’s unpaired t test. Values were reported as the mean ± SEM. Differences in means were considered significant at p < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A DNA vaccine encoding murine IL-5 modified to contain a
promiscuous foreign Th epitope, P30 from the tetanus toxoid
(22) (Th-modified mIL-5.2), was designed and tested for
its ability to induce a polyclonal Ab response that was cross-reactive
with nonmodified murine IL-5 (mIL-5.wt; see Fig. 1
). Before vaccination, the constructs
were tested in COS cell transient transfections to ensure that the
encoded proteins were appropriately expressed. The nonmodified
wild-type murine IL-5 (mIL-5.wt) and the murine Th-modified IL-5
(mIL-5.2) constructs were both capable of being transiently expressed,
as detected by Western blotting (data not shown).
|
A). Anti-mIL-5 (and
anti-P30) Abs could be detected after the third immunization, and
100% of the mice had seroconverted after the fourth mIL-5.2 DNA
immunization (data not shown). Antisera from mice vaccinated with
mIL-5.2 DNA were tested for its ability to compete for the binding of
native murine IL-5 by using a competition ELISA (Fig. 2B).
Antisera from vaccinated mice were preincubated with mIL-5 and were
capable of competing with an anti-mIL-5 mAb (TRFK4) for the binding
of mIL-5 protein. Thus, polyclonal Abs from mIL-5.2-vaccinated mice
efficiently blocked the interaction of neutralizing anti-murine
IL-5 mAbs TRFK4/TRFK5 with the native ligand. Together these data
suggest that the polyclonal Abs induced via mIL-5.2 DNA vaccination
recognize native murine IL-5.
|
The mIL-5.2 DNA vaccine was further characterized in three
separate mouse models of allergic airways inflammation that mimic key
pathological events characteristic of asthma (15, 28). The
first model was a simple intranasal OVA-allergen model (intranasal
model) that induces eosinophilia in the lungs of mice. This model
allowed us to rapidly assess and validate the concept that Th-modified
mIL-5.2 DNA vaccination could induce Abs that cross-react with native
mIL-5 and reduce eosinophilia in the BALF of a large number of allergic
mice. An OVA aeroallergen sensitization model (OVA sensitization model)
was then later used to look at the AHR response in vaccinated mice.
Thirdly, an adoptive transfer model (transfer model) of
allergen-specific Th2 CD4+ T cells was used to
address the ability of the vaccines to reduce disease symptoms in a
model in which sensitization to the aeroallergen was performed in an
environment free of the effects of the anti-mIL-5 immune response.
The number and frequency of eosinophils in BALF, blood, and lung tissue
were assessed in all three models of OVA-induced allergic airways
inflammation. In the intranasal model, mice were vaccinated six times
with DNA and sensitized to OVA s.c. four times at weekly intervals. One
week after the last sensitization, the mice were challenged with OVA
intranasally three times over a 6-day period. One day later, BALF was
collected for eosinophil counts. As shown in Fig. 3A, eosinophilia in BALF was
dramatically reduced in mice vaccinated with Th-modified mIL-5.2
(n = 30 mice) compared with mIL-5.wt (n
= 19 mice). Next, the effect of mIL-5.2 DNA vaccination on eosinophilia
and the subsequent induction of AHR was determined in the OVA
sensitization and transfer models of experimental asthma that employed
OVA sensitization or adoptive transfer of Ag-specific
CD4+ T cells (that secrete Th2 cytokines such as
IL-5 and IL-4) to naive mice before allergen provocation of the lung.
In the CD4+ T cell adoptive transfer model, the
Th2 T cells are sensitized to allergen (OVA) in an environment free of
neutralizing mIL-5 Abs, thus ruling out a failure to induce the model
due to the vaccinations. Eosinophil recruitment into the BALF was
inhibited in both aeroallergen models in response to inhaled allergen
after mIL-5.2 DNA vaccination (Fig. 3, B and C,
and Table I). Notably, blood eosinophilia
was completely attenuated after mIL-5.2 DNA vaccination (Fig. 4, A and B).
Moreover, active DNA vaccination with mIL-5.2 in the transfer model
ameliorated tissue eosinophilia in the lungs of all mice (Fig. 4C). The inability of mIL-5.2 DNA-vaccinated mice to mount
blood eosinophilia directly correlated with the inability of the bone
marrow pool of eosinophils to expand in response to allergen
provocation of the lung (results not shown). Lymphocyte numbers
recruited to the lungs in the OVA sensitization model were also reduced
in mIL-5.2 DNA-vaccinated mice. On day 19 after aerosol challenge,
there were significantly reduced lymphocyte numbers in the BALF of
mIL-5.2 DNA-vaccinated mice compared with wild-type mIL-5
DNA-vaccinated or nonvaccinated controls (Table I). Thus, neutralizing
IL-5 via DNA vaccination effectively inhibits the recruitment of
inflammatory cells to the sites of allergic inflammation by acting
systemically.
|
|
|
To determine the ability of mIL-5.2 DNA vaccination to reduce AHR
to cholinergic stimuli, lung reactivity to -methacholine was
measured in the OVA sensitization and T cell transfer models 24 h
after the last aeroallergen challenge (Fig. 5). Mice vaccinated with mIL-5.wt
DNA developed AHR similar to nonvaccinated OVA-sensitized controls
(Fig. 5A) and naive mice that received
CD4+ T cells (Fig. 5B) after
aeroallergen challenge. By contrast, in the OVA sensitization model AHR
in mice vaccinated with the mIL-5.2 DNA was reduced to a level similar
to that in nonsensitized saline-treated control mice (Fig. 5A). Importantly, we also demonstrated that mIL-5.2 DNA was
effective at inhibiting T cell-regulated AHR. The level of airways
reactivity to -methacholine in the T cell transfer model after
mIL-5.2 DNA vaccination (Fig. 5B) was similar to that observed in
saline-treated controls (Fig. 5A). Although there is
conflicting evidence regarding the role of IL-5 in the development of
AHR (15, 29), we show here that mIL-5.2 DNA vaccination
can inhibit AHR in both OVA sensitization and T cell transfer models of
experimental asthma.
|
To further characterize the mechanism of the mIL-5.2 DNA
vaccine-mediated inhibition of eosinophilia and AHR, we measured the
production of various cytokines in the lungs and by OVA-stimulated
peribronchial lymph node (PBLN) cells. No significant differences
between naive nontreated controls and mIL-5.wt DNA-vaccinated mice were
seen in the production of IL-4, IL-5, IL-10, or IL-13 at the level of
protein or message production. By contrast, mIL-5.2 DNA-vaccinated mice
had significant reductions in IL-5 protein (40–60%) and message
levels (Tables II and III). Surprisingly,
IL-4 and IL-10 production were also reduced at the level of protein and
message after mIL-5.2 DNA vaccination. No significant reductions were
seen in the production of OVA-specific IgE levels or IL-13 (Tables II and III and data not shown). These data
suggest that active vaccination against murine IL-5 can reduce not only
IL-5 levels, but also other key cytokines involved in the pathogenesis
of asthma, presumably by reducing the numbers of inflammatory cells
(lymphocytes and eosinophils; see Table I
) recruited to the lung that
are producing Th2 cytokines.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Immune responses against self-proteins such as IL-5 are usually not
generated due to immunological tolerance. B cell Ag receptors to
self-proteins are normally removed from the repertoire to induce
tolerance and avoid autoimmunity (33, 34). However,
immature B cells undergoing the induction of tolerance are exquisitely
sensitive to T cell help, which, if provided, can rescue B cells from
the induction of tolerance and promote B cell development
(35). Importantly, we demonstrate that vaccination with
Th-modified IL-5 DNA provides abundant T cell help that is capable of
inducing a B cell response that elicits cross-reactive immunity with
native IL-5. Our studies suggest that a portion of B cell tolerance is
maintained by the careful regulation of T cell help. Indirectly,
tolerance of the CD4 T cell compartment regulates B cell tolerance.
Vaccination with DNA encoding Th epitope-modified self-proteins (but
not DNA encoding unmodified self-proteins; see Fig. 2) that can provide
T cell help in the appropriate context bypasses B cell tolerance.
Analysis of cytokine production in draining lymph nodes revealed a
general reduction in Th2-type cytokines. Reduced levels of IL-5, IL-4,
and IL-10 were measured in mIL-5.2-vaccinated mice. Previous studies
have shown that administering short nonspecific immunostimulatory DNA
sequences could inhibit eosinophilia, IL-5, and AHR in similar models
of allergen-induced lung disease (36, 37). The proposed
mechanisms in those studies suggest that both an immediate production
of IL-12 and IFN- by the innate immune system and a general shift
from a Th2 to a Th1 immune response by the adaptive immune system
inhibit the activation of bone marrow-derived eosinophils and the
subsequent generation of AHR. Although we cannot rule out a similar
mechanism playing some role in the present studies, neither the
mIL-5.wt nor the mIL-5.2 DNA vaccine induced a detectable Th1 immune
response. IFN- levels were consistently low in all study groups
(Table II). Our data suggest that our vaccine approach is highly
specific for targeting IL-5 and that the OVA-allergen induces a Th2
immune response as seen in the cytokine profile (see Tables II and III)
and anti-OVA Ab isotypes (data not shown). DNA encoding wild-type
murine IL-5 (or vector-only controls) showed no effect on the general
Th2 environment and did induce Th1 cytokine production (Table II) or
skew Ab isotypes. In addition, it is unlikely that a general Th1
environment could skew the cytokine production by the adoptively
transferred OVA-specific Th2 CD4+ T cells in such
a short time frame. A more plausible explanation of the reduction in
Th2 cytokine levels is that by neutralizing IL-5 and thus inhibiting T
cell and eosinophil infiltrations into the lung, we have reduced the
total number of cells capable of producing these Th2 cytokines (see
Table I). The broad effects obtained by reducing IL-5 levels suggest
that IL-5 production is central to a cascade of events that eventually
results in the production of other Th2 cytokines and airways
inflammation leading to AHR.
In summary, the Th-modified vaccine approach is capable of circumventing many of the problems associated with previous vaccine techniques, namely, bypassing immune tolerance and generating a polyclonal immune response. This approach also allows for longitudinal immunotherapy and potential resolution from chronic disease. Numerous studies have validated IL-5 as a therapeutic target for the treatment of asthma (8, 10, 11, 15, 38, 39), and promising results have been seen with anti-IL-5 mAb treatment in various animal models (16, 17, 40, 41, 42, 43, 44, 45, 46). Several clinical trials are currently evaluating the efficacy of anti-IL-5 mAb therapy in man, but have shown limited success to date in allergic asthmatics (47). Additional studies are required to determine the clinical efficacy of IL-5 neutralization in asthma as well as other eosinophilic disorders. By contrast to systemic humanized anti-IL-5 mAb administration, it is conceivable that in our vaccination approach, by using autologous B cells to deliver the therapeutic Abs at high concentration at the disease sites, we access microenvironments that are critical for disease expression and neutralize the pathogenic properties of IL-5. Although our DNA vaccine did not appear to drive a Th1 immune response, the ability of DNA vaccination to deviate immune responses toward a Th1 profile could be beneficial in treating allergy and could be exploited with our vaccine by adjusting the dose, route, or frequency of the DNA vaccine administration. Preliminary safety studies monitoring organ weights and general histology of selected tissues, including trachea and airways smooth muscle, show no differences between naive untreated and Th-modified IL-5 DNA-vaccinated mice (data not shown). Preliminary observations show that by 45–50 days after the last DNA vaccination Ab levels are declining (data not shown), as expected from previous vaccination studies with other Th-modified vaccines (A. Neisig, M. Hertz, and I. Dalum, unpublished observations). In conclusion, Th-modified IL-5 DNA provides a cost-effective therapeutic vaccine method for inhibiting pulmonary inflammation and AHR in response to allergen provocation of the airways. Active vaccination against IL-5 represents a novel therapeutic approach for the treatment of asthma and other allergic conditions.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 M.H., S.M., and I.D. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. Anand Gautam, Pharmexa A/S, DK-2970 Hørsholm, Denmark. E-mail address: ag{at}pharmexa.com; or Dr. Paul S. Foster, Leukocyte Signaling and Regulation Laboratory, John Curtin School of Medical Research, Australian National University, Canberra, Australian Capital Territory 0200, Australia. E-mail address: paul.foster{at}anu.edu.au
4 Abbreviations used in this paper: AHR, airways hyperreactivity; BALF, bronchoaveolar lavage fluid; HPRT, hypoxanthine-guanine phosphoribosyltransferase; mIL, mouse IL; Penh, enhanced pause; wt, wild type; PBLN, peribronchial lymph node.
Received for publication April 10, 2001. Accepted for publication August 1, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Nat. Biotechnol. 17:666.[Medline]
mediates altered responsiveness of atopic asthmatic sensitized airway smooth muscle. J. Clin. Invest. 104:657.[Medline]
This article has been cited by other articles:
|
|
 |
|
  C. UYTTENHOVE, C. SOMMEREYNS, I. THEATE, T. MICHIELS, and J. VAN SNICK Anti-IL-17A Autovaccination Prevents Clinical and Histological Manifestations of Experimental Autoimmune Encephalomyelitis Ann. N.Y. Acad. Sci., September 1, 2007; 1110(1): 330 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Herd, S. Mahalingam, I. M. Mackay, M. Nissen, T. P. Sloots, and R. W. Tindle Cytotoxic T-Lymphocyte Epitope Vaccination Protects against Human Metapneumovirus Infection and Disease in Mice J. Virol., February 15, 2006; 80(4): 2034 - 2044. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Zheng, Y. Wang, S.-H. Xiang, Y.-C. Tay, H. Wu, D. Watson, J. Coombes, G. K. Rangan, S. I. Alexander, and D. C.H. Harris DNA Vaccination with CCL2 DNA Modified by the Addition of an Adjuvant Epitope Protects against "Nonimmune" Toxic Renal Injury J. Am. Soc. Nephrol., February 1, 2006; 17(2): 465 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. CUTLER and F. BROMBACHER Cytokine Therapy Ann. N.Y. Acad. Sci., November 1, 2005; 1056(1): 16 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Spohn, K. Schwarz, P. Maurer, H. Illges, N. Rajasekaran, Y. Choi, G. T. Jennings, and M. F. Bachmann Protection against Osteoporosis by Active Immunization with TRANCE/RANKL Displayed on Virus-Like Particles J. Immunol., November 1, 2005; 175(9): 6211 - 6218. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Steinaa, P. B. Rasmussen, A. M. Wegener, L. Sonderbye, D. R. Leach, J. Rygaard, S. Mouritsen, and A. M. Gautam Linked Foreign T-Cell Help Activates Self-Reactive CTL and Inhibits Tumor Growth J. Immunol., July 1, 2005; 175(1): 329 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Thomas, S. L. Kunkel, and N. W. Lukacs Regulation of Cockroach Antigen-Induced Allergic Airway Hyperreactivity by the CXCR3 Ligand CXCL9 J. Immunol., July 1, 2004; 173(1): 615 - 623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Jung, J. E. Foley, A. A. Erdmann, M. A. Eckhaus, and D. H. Fowler CD3/CD28-costimulated T1 and T2 subsets: differential in vivo allosensitization generates distinct GVT and GVHD effects Blood, November 1, 2003; 102(9): 3439 - 3446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Renard, L. Sonderbye, K. Ebbehoj, P. B. Rasmussen, K. Gregorius, T. Gottschalk, S. Mouritsen, A. Gautam, and D. R. Leach HER-2 DNA and Protein Vaccines Containing Potent Th Cell Epitopes Induce Distinct Protective and Therapeutic Antitumor Responses in HER-2 Transgenic Mice J. Immunol., August 1, 2003; 171(3): 1588 - 1595. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. K. Kumar and P. S. Foster Modeling Allergic Asthma in Mice: Pitfalls and Opportunities Am. J. Respir. Cell Mol. Biol., September 1, 2002; 27(3): 267 - 272. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
) or mIL-5.2 Th-modified (•) DNA
in 0.9% sterile saline. Abs that cross-react with native murine IL-5
can be detected after the third DNA vaccination, and by the fourth DNA
vaccination 100% of the mice have seroconverted. B,
Competition ELISA of TRFK4/5 (R&D Systems) anti-mIL-5 mAbs and
pooled sera from mIL-5.wt (
