| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
4/V
1 T Cells in an Adriamycin-Induced Progressive Renal Failure Model1
*
Center for Kidney Research, Royal Alexandra Hospital for Children, Westmead, Sydney, Australia; and
Second Department of Internal Medicine, Kyushu University, Fukuoka, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells in Adriamycin-induced progressive glomerulosclerosis in
the rat kidney. The TCR repertoire and sequences used by these T
cells have now been studied. Two injections of Adriamycin 14 days apart
caused segmental glomerulosclerosis, massive interstitial infiltration
of mononuclear cells, and end-stage renal failure. Flow cytometry of
lymphocyte subpopulations with Abs to CD3, the TCR, and the
TCR showed that T cells as a proportion of
CD3+ cells were increased in Adriamycin-treated kidneys
(8.5 ± 5.4%), but not in lymph nodes (1.3 ± 0.4%). A
semiquantitative score of glomerular damage (r =
0.65; p < 0.01) and creatinine
(r = 0.62; p < 0.01)
correlated significantly with the presence of T cells. TCR V
repertoire analysis by RT-PCR and Southern blotting showed that V2
was the dominant subfamily in lymph nodes, whereas V4 became the
predominant subfamily in advanced stages of the rat Adriamycin-treated
kidney. Sequencing of the V4-J junctional region showed an
invariant sequence. The amino acid sequence of the junctional region of
the V4 TCR was the same as the reported mouse canonical V4 TCR
sequence. Analysis of the kidney V repertoire showed dominant
expression of V1, and sequencing again revealed the selective
expression of a canonical V1 gene. Semiquantitative RT-PCR for
cytokine gene expression showed that T cells from the kidneys
expressed TGF-, but not IL-4, IL-10, or IFN-. These results
suggest that the predominant T cells in the Adriamycin kidney
use an invariant V4/V1 receptor. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TCR gene organization, our understanding of
the role of cells bearing these receptors in inflammatory diseases in
general and in renal diseases in particular is quite limited. We have
reported previously that in human IgA nephropathy T cells are
detectable (by immunohistochemical and RT-PCR analysis) only in the
kidneys of those patients who progress to renal failure
(1). This finding led us to examine T cell
infiltration in an animal model of renal inflammation in the hope of
learning more about this class of T cells and the Ags that they may
recognize in the kidney.
Adriamycin (ADR3; Pharmacia and Upjohn, Perth,
Australia) is a commonly used antineoplastic antibiotic that
damages the renewal systems of highly proliferative cells such as the
epithelium of the gastrointestinal tract and hemopoietic cells. In
addition, it has nephrotoxic effects in experimental animals
(2). A long term study demonstrated severe renal damage
with extensive glomerular sclerosis and tubulointerstitial degeneration
in ADR-treated rats (3). ADR-induced glomerulosclerosis in
the rat is a progressive glomerulosclerosis model similar to human
focal segmental glomerulosclerosis (3, 4). In the advanced
stages of the ADR model there is a severe interstitial infiltration of
mononuclear cells (3), and in our preliminary experiments
we found that there is also a significant infiltration of T
cells in the ADR kidney (4). Such infiltrates can be due
to a generalized inflammatory process or to a proliferative response to
a specific Ag. In this study we focused on characterizing these
T cells: their Ag receptor gene usage repertoire and the specific
sequences of the VDJ complementarity-determining region that they
express.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Experimental progressive glomerulosclerosis was induced in male Sprague Dawley rats, weighing 250–300 g, by two i.v. injections of Adriamycin (2.5 mg/kg body weight in 0.9% saline) as previously described (3). Control rats were given two i.v. injections of the same volume of 0.9% saline. Rats were kept in individual cages and allowed free access to water and regular rat chow ad libitum. Two injections were given 14 days apart, and rats were sacrificed 18–24 wk after the second injection. Before excision the kidneys were extensively perfused in situ via the aorta with saline to remove circulating blood. Renal capsules were removed, and the renal cortex from both ADR rats and control rats were saved for lymphocyte extraction and for RNA extraction by snap-freezing in liquid nitrogen. The protocol was approved by the conjoint animal ethics committee of the Children’s Medical Research Institute and the Royal Alexandra Hospital for Children.
Lymphocyte preparation
Renal cortex was minced and sieved through a 75-mm pore size sieve (Sigma, St. Louis, MO), and the flow-through was collected in HBSS. Cells were collected by centrifugation, resuspended in 40% Percoll (Sigma) in RPMI 1640, and overlaid on 66.7% Percoll solution. Gradient separation was conducted at 2100 rpm for 20 min at room temperature. Separated cells were washed extensively with medium before use. Lymph node cells and spleen cells were also isolated from Sprague Dawley rats using standard methods.
Flow cytometric analysis and cell sorting
The following Abs were used for immunofluorescence staining:
anti-rat TCR mAb (clone R73) conjugated with FITC,
anti-rat TCR mAb (clone V65) conjugated with FITC, and
anti-rat CD3 mAb (clone G4.18) conjugated with biotin. All mAbs
were purchased from PharMingen (San Diego, CA). Mononuclear cells
extracted from kidneys were stained first with FITC-anti- TCR
or anti- TCR and biotin-anti-CD3 and then with
PE-streptavidin (Life Technologies, Grand Island, NY). All samples were
analyzed on a FACScan analyzer (BD Biosciences, Mountain View, CA).
Fluorescence intensity was recorded as a two-dimensional display on a
log scale. To purify T cells for cytokine expression,
mononuclear cells extracted from kidneys and from lymph nodes were
stained first with FITC-anti TCR and biotin-anti-CD3 and
then with PE-streptavidin. T cells were sorted using a FACStar
(BD Biosciences). The purity of T cells was >96%.
Histological examination
Kidneys were fixed in neutral buffered formalin and embedded in paraffin for the light microscopic study. Sections of 2-mm thickness were stained with periodic acid-Schiff reagent. Histological evaluation was made independently by two pathologists without prior knowledge of the assignment of animals to experimental or control groups. A semiquantitative score (the glomerular sclerosis index) was used to evaluate the degree of glomerular scarring as described previously (5).
Reverse transcription
RNA was extracted from the renal cortex or sorted T cells
by the single-step acid guanidinium thiocyanate-phenol-chloroform
extraction method using TRIzol (Life Technologies) (6). RT
was performed using superscript reverse transcriptase (Life
Technologies) according to the manufacturer’s instructions. Reactions
were performed in a total volume of 20 µl and consisted of reaction
buffer (10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 5 mM
Mg2Cl2), 2.5 µM random
hexamers (Promega, Madison, WI), 40 U RNase inhibitor (Promega), and 1
mM dNTP (Roche, Mannheim, Germany). Reactions were conducted at 42°C
for 60 min and at 99°C for 5 min in a thermal cycler 9600
(PerkinElmer, Norwalk, CT).
PCR and Southern blot for TCR repertoire
For rat TCR analysis, primers and probes were
designed as previously described (7) or from our own
sequencing results (8). The nomenclature used is according
to Garman et al. (9). The V primers are as follows:
V1.1, ctacaatcactccccttagac; V1.2, cgagtatttctccacacagct; V2,
gggtcgacgaagaaccctggctcacaagc; V3, tcctggatatctcaggatcag; V4,
acgtcacctctggggtcatat; V5, ggtcctctgctataatgactt; C2a,
gcaaaggtatgtcccagtct; C probe, ggcttgggrgaaatgtc; and C
sequencing primer, gggcttgggggaaatgtctg. The V primers were: V1,
caaaaggcaacaatgaaag; V2, cctcagtctctgacaatccaa; V3,
ttcctcttcagggtccagaat; V4, cgagatctccgactcgcagct; V5,
gtgagcggcagcaaagtaac; V6, gagtcttccagaaatcactca; V7,
tcctgtgtccttggttctg; V8, ttggcttcaggaacaaaggag; C,
cgctgggggagatgactat; and C probe, cctgccaaaccatctgtctt.
cDNA was amplified by PCR in a total volume of 50 µl. Reactions consisted of reaction buffer (10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1.5 mM MgCl), 20 pmol of each primer, 200 µM dNTP (Roche), and 2.5 U Taq polymerase (Roche). PCR reactions were performed in a thermal cycler 9600 (PerkinElmer) and consisted of an initial denaturation step at 94°C for 5 min, followed by 40 cycles of denaturation at 95°C for 1 min, annealing at 54°C for 1 min, and extension at 72°C for 1 min, with a final extension at 72°C for 10 min. A 10-µl aliquot of PCR products was electrophoresed on 2% agarose gel.
For Southern blot analysis of the V repertoire, gels were denatured
in NaOH/1.5 M NaCl for 10 min, neutralized in Tris/1.5 M NaCl, and
blotted onto a 
-probe nylon membrane (Bio-Rad, Hercules, CA). The
synthesized oligonucleotide probes were 5' end-labeled with
[-32P]ATP using T4 polynucleotide kinase
(Bresatec, Tel-Test, Friendswood, TX). After hybridization for 18
h at 55°C in hybridization solution (1 mM EDTA, 0.5 M
NaH2PO4 (pH 7.2), and 7% SDS), the
membranes were washed in 2x SSC and in 2x SSC/1% SDS.
Autoradiography was performed by the standard method.
Semiquantitive RT-PCR for cytokine genes
Semiquantitive RT-PCR for cytokine genes was performed as
previously described (10). Briefly, oligonucleotide
primers used for rat cytokine genes IL-10, IL-4, IFN-, and TGF-
were those previously described (11, 12, 13). GAPDH gene
primers served as the internal control. The PCR profile used was 1 min
each at 95, 55, and 72°C for 32 cycles for GAPDH, 35 cycles for
TGF- and IFN-, and 40 cycles for IL-10 and IL-4. RT-PCR fragments
of cytokine genes were electrophoresed on a 2% agarose gel and stained
with ethidium bromide. The gel was photographed using a Molecular
Analyst image system (Bio-Rad, Hercules, CA).
Sequencing
PCR products of the V or V subpopulation of interest were
extracted from the 1.8% agarose gel using a QIAquick gel extraction
kit (Qiagen, Hilden, Germany) and inserted into the EcoRV
site of pBluescript II SK(-) vector (Stratagene, La Jolla, CA) to
which had been added one dTTP to both 5' ends by Taq polymerase. Dye
terminator sequencing reactions of subclones were conducted by Sydney
University Prince Alfred Macromolecular Analysis Center and analyzed on
an APL377 sequencer (PE Applied Biosystems, Foster City, CA).
Statistical analysis
StatView software (Abacus Concepts, Berkeley, CA) was used for
statistic analysis. Student’s t tests were used to
determine whether changes in renal function and cell
population were significantly different. Correlation coefficients were
determined by the method of Pearson.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As reported previously (3), the ADR rat model showed
massive proteinuria immediately after ADR injection, which continue for
>20 wk and progressed to end-stage renal failure. In the ADR rat at 20
wk extensive glomerular sclerosis, hyalinosis, tubular atrophy, and
interstitial fibrosis with massive mononuclear cell infiltration were
observed histologically. Fig. 1
shows a
representative result of flow cytometric analysis of the renal
infiltrating lymphocytes. As expected, the majority of infiltrating T
cells bore TCRs. More interestingly, there were a significant
number of T cells bearing TCRs. There was a significant increase
in the proportion of T cells compared with that in lymph
nodes.
|
T cell infiltration and renal
damage
Table I summarizes the relationship
between some clinical parameters of renal function and the proportion
of T cells in the kidney, expressed as a percentage of total
(CD3+) T cells measured by flow cytometry.
T cells were not seen in control kidneys and were approximately 8 times
more numerous in the ADR kidney than in lymph nodes. There were no
significant changes in the percentage of T cells in the lymph
nodes of the ADR rat compared with that in normal Sprague Dawley
rats.
|
demonstrates that there was a
positive correlation between the number of interstitial T cells
and serum creatinine (r = 0.56; p <
0.01), urea (r = 0.62; p < 0.01), and
glomerular sclerosis index (r = 0. 65;
p < 0.01).
|
repertoire in kidney-infiltrating lymphocytes
To characterize the T cells infiltrating the ADR kidney, we
analyzed the TCR V repertoire by RT-PCR and Southern blot analysis.
Fig. 3 shows a representative result in
the ADR kidney and in normal lymph nodes. In normal lymph nodes the
V2 subfamily is the dominant subfamily; however, in the kidney of
the advanced ADR model, V4 becomes the predominant subfamily.
|
4-N-J junctional sequence analysis
To further characterize the V4 T cells seen in the ADR
kidney, we performed V4-N-J junctional sequence analysis by
subcloning PCR products into the pBluescript SK(-) T vector.
Surprisingly, all in-frame clones from the kidneys of three different
rats showed exactly the same sequence (Fig. 4). The amino acid sequences of these
clones were the same as that of the mouse canonical V4 TCR
(14), although there were some nucleotide substitutions
between rat and mouse (indicated by underlining in Fig. 4).
|
repertoire of kidney-infiltrating lymphocytes
Similarly, we analyzed the TCR V repertoire by RT-PCR with
specific primers for V subfamilies. As the sequence for the rat V
region was not available in GenBank, we used RACE with constant
region gene-specific primers to determine cDNA sequences of 80 TCR
clones (8). We then used PCR primers and probes designed
from these sequences to determine the V repertoire in the rat. A
variety of V gene families were expressed in lymph nodes. However,
it was clear that V1 T cells were the predominant subfamily in the
advanced stage ADR kidney (Fig. 3
).
TCR V1-N-J junctional sequence analysis
To further characterize these V1 T cells, we subcloned V1
PCR products and determined the V1 junctional sequences. Most of the
in-frame clones from the ADR kidney used an invariant V1 junctional
sequence whose amino acid sequence was the same as the canonical
sequence described in the mouse (7) (Fig. 5). These results strongly suggest that
the predominant T cell population infiltrating the kidney in
ADR-induced renal inflammation comprises cells expressing an invariant,
canonical heterodimer of V4 and V1.
|
T cells infiltrating kidney
To investigate the functions of these T cells, we analyzed
cytokine gene expression of purified T cells from kidney and
lymph nodes using a semiquantitative RT-PCR method as previously
described (10). As shown in Fig. 6, T cells from the kidneys from
five rats expressed TGF-, whereas T cells from lymph nodes
expressed high levels of IFN- and low levels of TGF-. IL-10 and
IL-4 mRNA were not detected.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells. Most of these studies are related to
infections such as Listeria monocytogenes, Salmonella
choleraesuis, Mycobacterium tuberculosis, M.
leprae, influenza virus, and Candida albicans
(15, 16, 17, 18, 19, 20, 21, 22, 23, 24). In these circumstances it is not always clear
whether T cell Ag receptors are recognizing foreign Ags or
interacting with self-ligands whose expression is induced by
infection.
T cells clearly can also play a role in inflammatory processes
that do not involve infectious agents. For example, our data
demonstrate that interstitial infiltration of lymphoid cells is a
distinct histological feature of progressive renal failure both in
human glomerulonephritis and in a rodent model of toxic renal damage,
although the major proportion of the infiltrating lymphocytes are
T cells (Fig. 1, Table I). In the oxidant inhalation model,
T cells proliferate in the lung epithelia (25). In
the testicular cell-induced autoimmune orchitis model, V4/V1
T cells infiltrate the testis in the absence of bacteria or
bacterial products (26).
We have shown that there is positive correlation between the presence
of an infiltrating T cell population and both deterioration of
renal function and histological damage in the rat Adriamycin model.
Molecular characterization of the TCR has demonstrated that the
increase in T cell is primarily due to an increase in a
V4/V1 canonical T cell subset that does not normally exist
in kidney and is also rare in normal peripheral lymphoid tissue.
Canonical T cell populations are usually described as residing
in epithelia (27). V5/V1 T cells localize as
dendritic epithelial cell in the skin (28, 29), and
V4/V1 T cells can be found in mucosal epithelial sites
such as tongue (30), female reproductive tract (31, 32), and resident pulmonary lymphocytes (33). In
distinction from V5/V1 cells, V4/V1 T cells
localize in nonontogenic organs (34).
The ligand of the V4/V1 T cells we have demonstrated in
the ADR model is not known. Some types of T cells have been
reported to respond to evolutionarily conserved heat shock protein
(35), but in our ADR model there was no significant
increase in 60-kDa heat shock protein expression by Northern blot
analysis (data not shown). Therefore, 60-kDa heat shock protein is
unlikely to be the ligand of V4/V1 T cells in our
model.
The function of the canonical V4/V1 T cells in the ADR model
therefore remains unclear. Our functional studies demonstrated that
T cells from ADR-treated kidney expressed only TGF-. They did
not express IL-4, IL-10, or IFN-. TGF- contributes to the
development of the renal fibrosis and sclerosis seen in this model
(36) and other models of progressive glomerulonephritis
(37, 38, 39, 40, 41, 42). It is possible that the production of TGF-
may be involved in the progressive renal failure. However, TGF- may
also have a suppressive effect on immune responses (43).
In the L. monocytogenes infection system, T cells
also expressed high levels of TGF- (44), yet
experiments with knockout mice or depletion of T cells
with specific mAbs suggest that canonical V4/V1 T cells
may play a role in down-regulating the responses of other lymphocytes
to bacterial infection (44, 45, 46, 47). We speculate that the
canonical T cells that infiltrate the kidney in the ADR model
may also have a regulatory function rather than a direct effector
function, but further studies are needed.
A better understanding of the role of T cells bearing this
specific heterodimeric Ag receptor molecule may shed new light on the
regulation of the inflammatory response in the kidney.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. John F. Knight, Center for Kidney Research, Royal Alexandra Hospital for Children, Westmead, New South Wales 2145, Australia. E-mail address: jfk{at}xodkonja.com
3 Abbreviations used in this paper: ADR, Adriamycin.
Received for publication September 5, 2000. Accepted for publication July 25, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and T cells: effect on progression in IgA nephropathy. Kidney Int. 47:177.[Medline]
4/V1 T cells in Adriamycin-induced progressive glomerulosclerosis. J. Am. Soc. Nephrol. 10:506.a.
T cells is highly conserved between rats and mice. Eur. J. Immunol. 26:3092.[Medline]
T-cell receptor. Immunogenetics 51:714.[Medline]
2 interferon) functions as a second signal for interleukin 2 production by mature murine T cells. Proc. Natl. Acad. Sci. USA 84:7629.2-macroglobulin receptor-associated protein. Proc. Natl. Acad. Sci. USA 94:7521. antigen receptors. Annu. Rev. Immunol. 9:679.[Medline]
/ T cells in murine salmonellosis by an avirulent but not by a virulent strain of Salmonella choleraesuis. J. Exp. Med. 176:363./ T cells and their role in resistance to bacterial infection. J. Exp. Med. 178:971. and T cells. J. Immunol. 155:2047.[Abstract]
T lymphocytes in acquired immunity to Mycobacterium tuberculosis. J. Immunol. 158:1217.[Abstract]
T cells. TCR junctions reveal differences in heat shock protein-60-reactive cells in liver and spleen. J. Immunol. 150:4867.[Abstract]
T cell response to Listeria monocytogenes: V6.3+ cells are a major component of the T cell response to Listeria monocytogenes. J. Immunol. 156:4280.[Abstract]
T cells in the primary immune response to Mycobacterium tuberculosis. Science 244:713./+ T cells. J. Exp. Med. 172:1225./ T cells in response to a human pathogen. J. Exp. Med. 174:683. T cell-induced nitric oxide production enhances resistance to mucosal candidiasis. Nat. Med. 1:552.[Medline]
T lymphocytes. J. Immunol. 162:5033. T cell subset. J. Immunol. 162:4910. of peripheral blood mononuclear cells stimulated by enterotoxins A and B. J. Dermatol. Sci. 13:63.[Medline]
-chain expression of murine Thy-1+ dendritic epidermal cells revealed by V3-specific monoclonal antibody. Proc. Natl. Acad. Sci. USA 86:4185. antigen receptors. Science 252:1430. thymocyte subset with homogeneous T-cell receptors to mucosal epithelia. Nature 343:754.[Medline]
T lymphocytes at the maternal-fetal interface. J. Immunol. 149:2872.[Abstract]
-T cell receptor repertoire of murine T cells associated with the vaginal epithelium. J. Immunol. 147:1773.[Abstract]
T cell repertoire. J. Immunol. 156:2723.[Abstract]
T cells in murine epithelia: origin, repertoire, and function. Adv. Exp. Med. Biol. 292:63.[Medline]
T-cell reactivity. Proc. Natl. Acad. Sci. USA 87:1767.1 in glomerulosclerosis and interstitial fibrosis of Adriamycin nephropathy. Kidney Int. 45:525.[Medline]
1 underlies development of progressive kidney fibrosis. Kidney Int. 45:916.[Medline]
with latent TGF- binding protein in the progressive process in Adriamycin-induced nephropathy. Lab. Invest. 73:81.[Medline]
1-induced glomerular disorder is associated with impaired concentrating ability mimicking primary glomerular disease with renal failure in man. Lab. Invest. 80:1855.[Medline]
and the pathogenesis of glomerular diseases. Curr. Opin. Nephrol. Hypertension 3:54.[Medline]
in kidney fibrosis: a target for gene therapy. Kidney Int. 51:1388.[Medline]
in diabetic nephropathy. Diabetes Metab. Rev. 12:309.[Medline]
. Annu. Rev. Immunol. 16:137.[Medline]
T cells. Immunology 102:94.[Medline]
+ T cell receptor invariant subset during bacterial infection. J. Immunol. 156:2214.[Abstract]
and T cells in immunity against an intracellular bacterial pathogen. Nature 365:53.[Medline]
T cells. J. Immunol. 153:3101.[Abstract]This article has been cited by other articles:
|
|
 |
|
  H. Wu, Y. M. Wang, Y. Wang, M. Hu, G. Y. Zhang, J. F. Knight, D. C.H. Harris, and S. I. Alexander Depletion of {gamma}{delta} T Cells Exacerbates Murine Adriamycin Nephropathy J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1180 - 1189. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. L. Simonian, C. L. Roark, F. Diaz del Valle, B. E. Palmer, I. S. Douglas, K. Ikuta, W. K. Born, R. L. O'Brien, and A. P. Fontenot Regulatory Role of {gamma}{delta} T Cells in the Recruitment of CD4+ and CD8+ T Cells to Lung and Subsequent Pulmonary Fibrosis J. Immunol., October 1, 2006; 177(7): 4436 - 4443. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Wyburn, H. Wu, J. Yin, M. Jose, J. Eris, and S. Chadban Macrophage-derived interleukin-18 in experimental renal allograft rejection Nephrol. Dial. Transplant., April 1, 2005; 20(4): 699 - 706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Aydintug, C. L. Roark, X. Yin, J. M. Wands, W. K. Born, and R. L. O'Brien Detection of Cell Surface Ligands for the {gamma}{delta} TCR Using Soluble TCRs J. Immunol., April 1, 2004; 172(7): 4167 - 4175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Roark, M. K. Aydintug, J. Lewis, X. Yin, M. Lahn, Y.-S. Hahn, W. K. Born, R. E. Tigelaar, and R. L. O'Brien Subset-specific, uniform activation among V{gamma}6/V{delta}1+ {gamma}{delta} T cells elicited by inflammation J. Leukoc. Biol., January 1, 2004; 75(1): 68 - 75. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
8 times
more numerous in the ADR kidney (B) than in lymph nodes
(E).
