The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cressman, D. E.
Right arrow Articles by Ting, J. P.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cressman, D. E.
Right arrow Articles by Ting, J. P.-Y.
The Journal of Immunology, 2001, 167: 3626-3634.
Copyright © 2001 by The American Association of Immunologists

Mechanisms of Nuclear Import and Export That Control the Subcellular Localization of Class II Transactivator1

Drew E. Cressman2,*, William J. O’Connor{dagger}, Susanna F. Greer*, Xin-Sheng Zhu{ddagger} and Jenny P.-Y. Ting*

* Lineberger Comprehensive Cancer Center, {dagger} Department of Microbiology and Immunology, and {ddagger} Curriculum in Oral Biology, School of Dentistry, University of North Carolina, Chapel Hill, NC 27599


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The presence of the class II transactivator (CIITA) activates the transcription of all MHC class II genes. Previously, we reported that deletion of a carboxyl-terminal nuclear localization signal (NLS) results in the cytoplasmic localization of CIITA and one form of the type II bare lymphocyte syndrome. However, further sequential carboxyl-terminal deletions of CIITA resulted in mutant forms of the protein that localized predominantly to the nucleus, suggesting the presence of one or more additional NLS in the remaining sequence. We identified a 10-aa motif at residues 405–414 of CIITA that contains strong residue similarity to the classical SV40 NLS. Deletion of this region results in cytoplasmic localization of CIITA and loss of transactivation activity, both of which can be rescued by replacement with the SV40 NLS. Fusion of this sequence to a heterologous protein results in its nuclear translocation, confirming the identification of a NLS. In addition to nuclear localization sequences, CIITA is also controlled by nuclear export. Leptomycin B, an inhibitor of export, blocked the nuclear to cytoplasmic translocation of CIITA; however, leptomycin did not alter the localization of the NLS mutant, indicating that this region mediates only the rate of import and does not affect CIITA export. Several candidate nuclear export sequences were also found in CIITA and one affected the export of a heterologous protein. In summary, we have demonstrated that CIITA localization is balanced between the cytoplasm and nucleus due to the presence of NLS and nuclear export signal sequences in the CIITA protein.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Class II transactivator (CIITA)3 plays a central role in initiating an immune response by activating the expression of a variety of genes necessary for the presentation of peptides on the cell surface in association with molecules of the class II MHC. CIITA activates the expression of all MHC class II genes as well as the class II-associated molecules DM, DN{alpha}, and invariant chain (1, 2, 3, 4). The activity of CIITA itself and subsequent expression of class II genes is constitutive in B cells and inducible by IFN-{gamma} in most other cell types (5, 6, 7). Although it does not directly bind to DNA, CIITA functions as a nuclear coactivator by interacting with other promoter binding factors and components of the basal transcription complex, including RFX5, NF-Y, TATA binding factor-associated proteins, Bob1, CREB, and CBP (8, 9, 10, 11, 12, 13). Interaction of CIITA with these factors occurs at the W/X/Y regulatory elements in the promoters of class II target genes (14, 15, 16, 17). The CIITA protein contains a number of functional motifs, including an amino-terminal acidic activation domain, a proline-serine-threonine-rich region, and a GTP-binding motif. GTP binding of CIITA has been shown to correlate with nuclear import; mutants defective for GTP binding fail to translocate into the nucleus and fail to activate class II gene expression (18). The GTP-binding motif is not a nuclear localization signal (NLS), but most likely GTP binding causes a conformational change that is compatible with nuclear translocation.

Loss of cell surface MHC class II expression in patients leads to the development of bare lymphocyte syndrome (BLS), a severe immunodeficiency disease characterized by failure of lymphocyte proliferation and activation, multiple recurrent infections, and ultimately death in early childhood (19, 20, 21). The genetic defects leading to BLS have been grouped into four complementation groups, with each group corresponding to mutations in different transcription factors necessary for class II gene expression. These factors include RFX5 (complementation group C) (22), RFXAP (group D) (23), RFXANK/RFX-B (group B) (24, 25), as well as CIITA (26). Mutations in CIITA are responsible for complementation group A BLS patients and class II-negative cell lines derived from these patients (27, 28, 29). One group A BLS patient was found to contain a 72-bp deletion in the CIITA gene, resulting in the loss of aa 940–963 (28). Recently, we found that the loss of this region results in the loss of a NLS at aa 955–959, abrogating CIITA activity because the protein fails to translocate from the cytoplasm into the nucleus (30). Recently, another NLS has been identified at aa 141–159 of CIITA (31). Interestingly, acetylation of this bipartite sequence increases nuclear accumulation of CIITA.

Translocation of a protein from the cytoplasm into the nucleus is dependent on the presence of a NLS within the protein. Although specific consensus sequences for NLS do not exist, they tend to be short sequences rich in basic residues (32, 33) which mediate binding to members of the importin (karyopherin) {alpha} family of proteins in the cytoplasm (34). The NLS-containing protein is translocated through the nuclear pore as part of a trimeric importin {alpha}-importin {beta}-NLS protein complex in a GTP-dependent manner. Binding of RanGTP to importin {beta} within the nucleus leads to dissociation of the complex and release of the NLS-containing protein (for review, see Ref. 35). Different variations of NLS have been identified, with the SV40 large T-Ag NLS serving as the prototype of the "classical" NLS (36, 37). Other NLS that differ from the classical NLS by binding to different members of the importin {alpha} family or operating in an importin {alpha}-independent manner include the M9 sequence (38), the lymphoid enhancer factor 1 NLS (39), and the NLS of the HIV-1 Tat protein (40).

Similar to nuclear import, export of a protein depends on the presence of a specific nuclear export signal (NES) (reviewed in Ref. 35). These NES are short sequences characterized as being rich in leucine residues and have been identified in a variety of different proteins, the best studied of which being the HIV Rev protein (41). Nuclear export is mediated by CRM1, a importin {beta}-like protein that exports a variety of NES-containing proteins in a RanGTP-dependent manner (42, 43, 44, 45). CRM1-mediated nuclear export can be blocked by treatment of cells with the export inhibitor leptomycin B (LMB) (46, 47, 48), resulting in the nuclear accumulation of proteins otherwise dependent on the export pathway.

In this paper, we identify an additional NLS present in CIITA. This NLS (NLS2) is located at aa 405–414, amino-terminal to the NLS deleted in the group A BLS patient at aa 955–959 (NLS3). Deletion of NLS2 results in cytoplasmic localization of CIITA and loss of activity, both of which can be rescued in part by replacement with the SV40 NLS. This last property differs from NLS3, which cannot be replaced by the SV40 NLS. This suggests that unlike NLS3, NLS2 can be categorized as a classical NLS. The presence of both NLS2 and NLS3 are required for CIITA to be fully functional in activating class II gene expression. Furthermore, we demonstrate that CIITA localization is sensitive to LMB, leading to increased nuclear concentrations of the protein and suggesting that the presence of CIITA in both the cytoplasm and the nucleus is dependent on NLS and NES sequences in the protein.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Plasmids

All mutants were constructed using the pCDNA3.FLAG.CIITA parent vector containing an eight- amino acid FLAG epitope upstream of the first methionine of CIITA (49). Carboxyl-terminal CIITA deletion mutants were constructed by QuikChange site-directed mutagenesis (Stratagene, La Jolla, CA), resulting in a stop codon placed at the indicated position within the CIITA sequence. Mutations were made at codons for aa 149, 225, 336, 446, 518, 614, 752, 853, and 932. Deletion of aa 405–414 (CIITA{Delta}405–414) was constructed by overlapping PCR using four primers: primer 1(657-CCTGAATCTCCCTGAGGGACC-677); primer 2 (CCGGACCGACTCCACGACAACCGACGGTAGCTACACTAACG-1250); primer 3 (GGCTGCCATCGATGTGATTGCTGTGCTGGGCAAAGCTGG-1268); and primer 4 (2105-GTCTCAGGCTCGACCGGAAGG-2125). Products from initial PCR using primers 1/2 and 3/4 were combined and reamplified with primers 1/4. The resulting product inserted a ClaI site and deleted bp 1212–1242 of CIITA. To generate CIITA{Delta}405–414/NLS, double-stranded, annealed oligonucleotides (5'-CCAAAGAAAAAGCGCAAGGTG) containing ClaI-compatible ends encoding the SV40 NLS were inserted into ClaI-digested CIITA{Delta}405–414. {Delta}955–959 (CIITA-5aa) and {Delta}955–959/NLS (CIITA-5aa/NLS) have been described previously (30). Mutation of codons for residues 408 and 409 were also generated by QuikChange site-directed mutagenesis, substituting the CGG codon with GCG in the PCR primers. All constructs were confirmed by sequencing.

Cell culture and reporter assays

COS-7 and HeLa cells were grown in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FCS, 300 mg/L L-glutamine, and 1% penicillin/streptomycin. All transfections were performed using Fugene 6 (Roche Molecular Biochemicals, Durham, NC) according to the instructions of the manufacturer. Cells were split to six-well plates 12 h before transfection. One microgram of each plasmid was transfected into cells, and cells were harvested at 24 h posttransfection in 200 µl of 1x reporter lysis buffer (Promega, Madison, WI). Forty microliters was assayed for luciferase activity as previously described (50). Extracts were normalized to protein concentration. Each transfection was performed in triplicate. LMB was added to cultured cells at a final concentration of 5 nM, 3 h before harvest. Actinomycin D (2.5 µg/ml; Sigma, St. Louis, MO) was also added to cells where indicated at 3 h before harvest.

Immunofluorescence

FLAG-tagged wild-type CIITA (1 µg) or the indicated CIITA mutants were transfected into COS-7 cells growing in two-well chamber slides and assayed for subcellular localization. Where indicated, 2.5 µg/ml actinomycin D (Sigma) and 5 nM LMB (a gift from B. Wolff, Novartis Forschunginstitut, Austria) was added to the cells 3 h before harvesting. At 24 h posttransfection, slides were rinsed in PBS, fixed in 3:2 acetone:PBS for 4 min, incubated for 1 h with M5 anti-FLAG mouse mAb (Sigma) diluted 1/500 in PBS/1% BSA, rinsed, incubated for 1 h with FITC-conjugated goat anti-mouse secondary Ab (1/500 dilution; BD PharMingen, San Diego, CA), then rinsed and mounted in Vectashield mounting medium with 4',6'-diamidino-2-phenylindole (Vector Laboratories, Burlingame, CA), and observed at x50 magnification. Fluorescence indicates FLAG-CIITA protein localization or Hoechst dye-stained nuclei of the same field.

Green fluorescent protein (GFP) analysis

Fusion proteins were constructed in which double-stranded oligonucleotides encoding aa 405–414 of CIITA were subcloned in-frame to the carboxyl terminus of GFP using the pEGFP-C1 parent vector (CLONTECH Laboratories, Palo Alto, CA). Insertions of one or two copies of aa 405–414 were confirmed by sequence analysis. The SV40 T-Ag NLS (CCTAAGAAGAAGAGGAAGGTT) was fused to GFP (GFP-NLS) as a positive control. COS-7 cells (6 x 104) were plated into two-well chamber slides 12 h before transfection. One microgram of GFP plasmids was transfected into cells, rinsed 24 h later with PBS, and fixed for 5 min with 4% paraformaldehyde. Fluorescence of the fusion protein was observed using an Olympus BX40 microscope (Melville, NY) at x50 magnification.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
C-terminal truncations cause nuclear translocation of CIITA and identify a putative NLS

Previously we have shown that CIITA contains a NLS at aa 955–959 (30). Loss of the 24-aa exon that contains this region results in the abrogation of CIITA activity and loss of MHC class II surface expression, leading to the BLS (28). However, we reasoned that because of the size and complexity of CIITA, it might contain additional NLS, similar to the multiple NLS seen for other transcription factors such as NF-AT (51), the retinoblastoma protein (52), c-myc (53), and Myo-D (54). Deletion of 200 or 278 residues from the carboxyl terminus, including the aa 955–959 NLS3 (CIITA1–931 and CIITA1–852, respectively), causes CIITA to be localized to the cytoplasm as demonstrated by subcellular immunofluorescence assays (Fig. 1GoA). However, CIITA1–751 shows a low level of nuclear presence, while shorter forms 1–444, 1–518, and 1–613 (predicted molecular mass of 49, 57, and 67 kDa, respectively) demonstrate nuclear localization stronger than that seen for the wild-type CIITA. Shorter forms of CIITA <336 aa all show protein distribution throughout the cytoplasm and nucleus, likely due to the fact that these are of small enough size (<40 kDa) to diffuse through the nuclear pore complex without the need for a specific NLS. The smallest of the nuclear CIITA deletion mutants, 1–444, has a predicted molecular mass of 49 kDa, well above the maximum size of molecules that can undergo nonselective passive diffusion through the nuclear pore (55). The high concentration of CIITA1–444 in the nucleus compared with the more even distribution of the 1–335 mutant indicates the possible presence of a NLS between aa 336 and 444. In addition, since 1–852 is restricted to the cytoplasm while 1–751 and 1–613 show steadily increasing concentrations of the protein in the nucleus, there may exist a NES between aa 613 and 852. The presence of any such signal within this region may be sufficient to drive the export of CIITA1–852 from the nucleus to the cytoplasm. Therefore, loss of an NES C-terminal to aa 613, combined with the remaining presence of a possible NLS between aa 336 and 444, would account for CIITA1–613, 1–518, and 1–444 to localize more strongly to the nucleus. Despite the presence in the nucleus of these mutant proteins, loss of any portion of the carboxyl terminus eliminates the ability of CIITA to activate reporter gene expression from the class II DR promoter (Fig. 1GoB), likely due to the loss of a carboxyl-terminal leucine-rich region necessary for self-interaction (56).



View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 1. Localization of carboxyl-terminal deletion mutants of CIITA that fail to activate class II gene expression. A, Immunofluorescent analysis of COS cells transfected with wild-type CIITA or CIITA carboxylterminal deletion mutants containing only the indicated amino acid residues. All constructs were tagged with the FLAG epitope, and protein detection was performed at 24 h posttransfection using an anti-FLAG primary Ab and a secondary FITC-conjugated Ab. B, Activation of class II gene expression by CIITA carboxyl-terminal deletion mutants. COS cells were transfected with 1 µg of pCDNA3 or the indicated CIITA constructs plus 1 µg of a luciferase reporter under the control of the class II DR gene promoter. Luciferase activity of cell extracts was determined at 24 h posttransfection, and values were normalized for protein concentration. Activation of the DR-luciferase by all constructs is reported relative to activation of DR-luciferase by wild-type CIITA, defined as 100% activity. Assays were repeated three times and performed in triplicate.

 
Sequence analysis of the region between aa 336 and 444 of CIITA revealed a single motif rich in basic residues (Fig. 2Go), the hallmark of a NLS (32). Within a 10-aa sequence between aa 405 and 414, there are 6 basic residues dominated by arginine. This degree of basic residue concentration is similar to that of the classical NLS identified in the SV40 large T Ag (36). The putative NLS region is located just upstream of the GTP-binding motif of CIITA. The GTP-binding motif itself has been shown to be necessary for proper CIITA localization and activity, although it likely achieves this through changes in the conformation of CIITA rather than serving as an authentic NLS (18). We have designated this sequence as NLS2 and the NLS we have previously defined in the BLS patient as NLS3.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 2. Schematic of the CIITA protein indicating the location of the upstream NLS at aa 405–414. The acidic activation, PST-rich, NLS1 and 2, GTP homology and leucine-rich domains are indicated as well as NLS3, the 24-aa region missing in a group A BLS patient. The amino acid sequence is given for the region from aa 336 to 444 defined by CIITA deletion mutants as likely to contain a NLS. The 10-aa basic residue-rich motif is shaded and specific basic residues (bold) are aligned compared with the classical SV40 NLS and NLS3.

 
Failure of CIITA nuclear import and transactivation by deletion of aa 405–414

Deletion of entire portions of the carboxyl terminus identified the general location of the NLS and sequence analysis pinpointed a specific domain that fit the residue requirements of a NLS motif. To demonstrate that this domain does indeed function as a NLS, it was necessary to specifically determine the effects that deleting aa 405–414 has on protein localization and CIITA activity. Although wild-type CIITA localized to both the cytoplasm and the nucleus, CIITA missing the 10 aa of the putative NLS (CIITA{Delta}405–414) was only present in the cytoplasm (Fig. 3GoA). It is important to note that this construct still retains the NLS1 (aa 141–159) and the NLS3 site present in the BLS domain (aa 955–959). Despite the presence of these NLS however, CIITA{Delta}405–414 did not enter the nucleus, suggesting that NLS2 is critical for normal protein localization. When tested in reporter activation assays using the class II DR promoter fused to luciferase, deletion of aa 405–414 severely inhibited the ability of CIITA to activate gene expression relative to the wild-type form (Fig. 3GoB). Western blots indicated that expression of the mutant CIITA was equivalent to wild type with no evidence of decreased protein stability (data not shown). Therefore, the failure of CIITA to localize to the nucleus results from a loss of the 10-aa domain, which in turns impairs the ability of CIITA to function as a transcriptional coactivator.



View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 3. Deletion of aa 405–414 restricts CIITA protein to the cytoplasm and inhibits activation from a class II promoter. A, Localization of wild-type CIITA protein or CIITA with deleted aa 405–414. COS cells were transfected with 1 µg of either plasmid, harvested 24 h later, and stained for protein localization with anti-FLAG primary Ab and FITC-conjugated secondary Ab. Top panels, CIITA or CIITA{Delta}405–414 protein presence in nuclear or cytoplasmic compartments; bottom panels, all 4',6'-diamidino-2-phenylindole (DAPI)-stained nuclei in the field. B, CIITA{Delta}405–414 fails to activate expression from the DR-luciferase promoter. COS cells were transfected with 1 µg of CIITA and 1 µg of DR-luciferase and extracts were assayed for luciferase activity 24 h later. Activities are shown relative to CIITA. pCDNA3 plus DR-luciferase was used as a negative control. Extracts were normalized to protein concentration and all assays were repeated three times and performed in triplicate. C, Mutation of arginine residues decreases nuclear localization of CIITA. COS cells were transfected with wild-type CIITA or CIITA containing arginine to alanine single point mutations at amino acid residues 408 or 409. Protein localization was detected as in A.

 
To delineate specific amino acids functioning in the putative NLS, we made arginine to alanine point mutations of the central arginine amino acids at residues 408 and 409 and assayed for localization (Fig. 3GoC). Compared with wild-type CIITA, R408A and R409A both show decreased presence in the nucleus. Double mutants demonstrated a similar pattern (data not shown). This suggests that mutations of individual amino acids within this region are enough to disrupt the normal localization of CIITA to the nucleus.

Amino acids 405–414 drive the nuclear localization of a heterologous protein

One characteristic of previously identified NLS is their capacity to mediate the nuclear translocation of a heterologous protein (39, 40, 57). To determine whether the upstream putative NLS of CIITA could function in a similar manner, we fused the 10-residue motif of aa 405–414 to the GFP. The 28-kDa GFP by itself localizes to both the cytoplasm and the nucleus (Fig. 4Go). Fusion of the control SV40 NLS to GFP results in strong nuclear localization of the protein. When fused to one copy of the aa 405–414, GFP shows a moderate increase in nuclear translocation, although not as intense as that seen for GFP-SV40NLS. However, fusion to two copies of aa 405–414 significantly increases the nuclear localization of GFP, such that very little GFP remains in the cytoplasm. This suggests that aa 405–414 can function independently as a NLS, inducing the nuclear translocation of both CIITA and an unrelated protein. Furthermore, the nuclear localization function imparted by the CIITA motif appears to be only slightly weaker than that provided by the well-defined SV40 NLS.



View larger version (72K):
[in this window]
[in a new window]
  		FIGURE 4. The putative NLS motif induces nuclear translocation when fused to a heterologous protein. Oligonucleotides encoding the peptide region for aa 405–414 of CIITA were fused in-frame to GFP in one (GFP-405/414 x 1) or two (GFP-405/414 x 2) copies. All GFP constructs were transfected into COS cells and subcellular localization of GFP proteins was observed 24 h posttransfection. The SV40 NLS fused to GFP served as a positive control for nuclear translocation. Note nuclear and cytoplasmic presence of GFP vs predominantly nuclear staining of GFP-SV40NLS.

 
LMB inhibits the export of CIITA from the nucleus

The absence of aa 405–414 results in the localization of CIITA to the cytoplasm. However, an alternative explanation for this observation is that the loss of this region allows the mutated CIITA protein to be exported from the nucleus more rapidly than is the wild-type protein. Therefore, blocking nuclear export should reveal whether the cytoplasmic localization of mutant CIITA constructs is due to excessive nuclear export or due to the failure of the protein to enter the nucleus in the first place. Several pieces of evidence indicate that CIITA undergoes not only nuclear import, but also nuclear export. The localization of the wild-type protein in both the cytoplasm and the nucleus indicated by immunofluorescence and immunoblot studies (30) suggests that CIITA resides in both compartments. Additionally, treatment of cells with LMB, an inhibitor of nuclear export, causes the accumulation of nuclear CIITA (Fig. 5Go, a–d). This nuclear accumulation is first evident 15 min after LMB addition and increases over the course of 1 h. Residual cytoplasmic CIITA is still observed at later time points in these transfected cells. We reasoned that this cytoplasmic CIITA might be due to de novo synthesis from the transfected gene. Actinomycin D is capable of blocking de novo synthesis by inhibiting gene transcription. To determine whether this residual cytoplasmic CIITA is the result of de novo synthesis, we blocked new gene transcription by pretreating cells for 3 h with actinomycin D. This approach allows current mRNA translation to be carried through to completion, resulting in full-length protein, but blocks additional transcription, therefore ensuring that all proteins detected by the Ab are indeed full-length CIITA peptides. Pretreating CIITA-transfected cells with actinomycin D in the presence of LMB shows nearly complete nuclear localization of CIITA protein over time (Fig. 5Go, e–h). This nuclear localization occurs rapidly, as at 15 min following LMB treatment, there was only a low level of cytoplasmic CIITA present, with the majority localized to the nucleus (Fig. 5Gof), whereas by 30 min to1 h following LMB treatment, all CIITA was present in the nucleus (Fig. 5Go, g–h). This indicates that CIITA in the cytoplasm is primarily the result of nuclear export and that only the residual amount of cytoplasmic CIITA seen in Fig. 5Go, c and d, is due to de novo synthesis.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 5. LMB inhibits export of CIITA from the nucleus. COS cells transfected with CIITA were assayed for the ability of CIITA to export from the nucleus. Twenty-four hours posttransfection, cells were treated with LMB (+LMB) or LMB and actinomycin D together (+LMB/Act. D). Actinomycin D was added to cells 3 h prior to harvest. LMB was added 15 min, 30 min, or 1 h before harvest. Treatment time of 0 min indicates the harvest of cells in the absence of any LMB treatment; in the case of 0 min (+LMB/Act. D, e) cells were treated for 3 h with actinomycin D alone before harvest. At 24 h, cells were rinsed, fixed, and stained for CIITA by FITC-conjugated subcellular protein localization.

 
The defect in CIITA{Delta}405–414 is nuclear import, not export

Having demonstrated that CIITA protein is susceptible to nuclear export that can be blocked by the addition of LMB, it became possible to further determine whether the cytoplasmic localization of CIITA{Delta}405–414 is due to the loss of a NLS or to an increase in export from the nucleus. If the latter was true, then any increase in the export of the mutant CIITA should be inhibited by LMB treatment and the resulting pattern of protein localization should be nearly indistinguishable from wild-type CIITA treated with LMB. However, in cells transfected with CIITA{Delta}405–414 and treated with LMB, the mutant CIITA protein remained predominantly in the cytoplasm, in contrast to both wild-type CIITA and CIITA with an N-terminal SV40 NLS (NLSCIITA), which are present primarily in the nucleus (Fig. 6Go). All cells were pretreated with actinomycin D to inhibit additional gene transcription. This indicates that CIITA{Delta}405–414 fails to ever enter the nucleus due to the deletion of the NLS2 motif.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 6. SV40 NLS partially rescues CIITA{Delta}405–414 localization and activation ability. Immunofluorescence of COS cell transfected with FLAG-tagged wild-type CIITA, NLSCIITA (positive control), CIITA{Delta}405–414, or CIITA{Delta}405–414/NLS. Three hours before harvest, cells were pretreated with actinomycin D to inhibit additional gene transcription. All cells were fixed and stained with anti-FLAG Ab at 24 h posttransfection. In the right panels of each pair, cells were treated with LMB for 3 h before harvesting to block any CRM1-mediated protein export from the nucleus. Note the even distribution of protein between cytoplasmic and nuclear compartments in CIITA{Delta}405–414/NLS-transfected cells treated with LMB.

 
The SV40 NLS rescues CIITA{Delta}405–414 activity

We wished to determine whether loss of the NLS motif at aa 405–414 can be functionally rescued by the insertion of a classical SV40 NLS (PKKKRKV) into the same region of the protein. Immunofluorescence detection of the NLS-corrected protein shows little increase in nuclear CIITA{Delta}405–414/NLS, with the majority of the protein restricted to the cytoplasm (Fig. 6Go). However, following treatment with LMB plus actinomycin D, CIITA{Delta}405–414/NLS is clearly present in both the nucleus and the cytoplasm. This suggests that insertion of the heterologous NLS into the deleted 405–414 domain is sufficient to partially rescue CIITA localization, most likely by inducing nuclear translocation of the protein at a reduced rate.

To determine whether the inserted heterologous NLS can rescue CIITA{Delta}405–414 activity as well as localization, cells were cotransfected with the DR promoter-luciferase reporter plus CIITA{Delta}405–414 or CIITA{Delta}405–414/NLS. COS cells represent an overexpressed system, while HeLa cells express significantly lower levels of CIITA. Although CIITA{Delta}405–414 showed minimal ability to activate expression from the DR promoter, cells transfected with CIITA{Delta}405–414/NLS displayed reporter activity approaching that seen for cells transfected with wild-type CIITA (Fig. 7Go). DR activation by CIITA{Delta}405–414/NLS in COS cells was restored to >90% of the level of wild-type CIITA, while HeLa cell activation of DR by CIITA{Delta}405–414/NLS was 65% that of wild type. This was in contrast to the downstream NLS3 motif present in the BLS domain at aa 955–959, where substitution with the SV40 NLS fails to rescue CIITA activity, thereby confirming previous results (30). These data suggest that the basic residue-rich domain in CIITA from aa 405–414 functions like a classical NLS in directing the CIITA protein to the nucleus where it can then activate target gene expression.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 7. Activation of the DR-luciferase promoter by CIITA deleted for NLS2 or NLS3 and rescue of activity by substitution with the SV40 NLS. COS cells ({blacksquare}) or HeLa cells () were transfected with 1 µg each of the indicated CIITA plasmids plus 1 µg of DR-luciferase reporter. Extracts were prepared and assayed for relative luciferase at 24 h posttransfection. {Delta}405–414 refers to CIITA deleted for NLS2 at aa 415–414. {Delta}955–959 refers to CIITA deleted for NLS3 at aa 955–959, while {Delta}955–959/NLS refers to the SV40 NLS inserted into this same deleted motif region, analogous to the CIITA {Delta}405–414/NLS. {Delta}955–959 is the same as the -5-aa constructs described previously (30 ). pGL2 Control is used as positive control for transfections. Extracts were normalized to protein concentration and luciferase activities were compared with CIITA activity set to 100% for each cell type. All experiments were repeated three times and performed in triplicate.

 
CIITA contains multiple putative NES motifs

LMB inhibits CRM1-mediated nuclear export, and CRM1 specifically binds to leucine-rich NES. Since treatment of CIITA-transfected cells with LMB increased the nuclear concentration of CIITA, suggesting that CIITA undergoes CRM1-mediated nuclear export, we analyzed the CIITA sequence for motifs with similarity to a consensus NES (58). CIITA contains 10 motifs that show varying degrees of similarity to the consensus NES (Fig. 8GoA). To test the function of each of these motifs, they were initially fused to GFP. Fusion of each of these sequences to GFP yielded no changes in GFP subcellular localization, with the exception of the CIITA sequence of residues 1035–1051, which resulted in a cytoplasmic pattern (Fig. 8GoB). Leucine residues are critical to the function of NES, the mutation of which would be expected to result in increased nuclear concentration of the NES-containing protein. However, mutation of a conserved leucine residue within this region at aa 1049 did not increase the nuclear concentration of CIITA but instead inhibited nuclear translocation of the protein. Similar results were obtained with mutations of leucines at aa 1046 and 1051. Thus, although these regions bear similarity to an NES motif, our initial analysis indicates that CIITA may contain other NES domains not identified in our screen or that multiple NES of overlapping function may be present in CIITA.



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 8. Identification of motifs in CIITA with sequence similarity to a consensus NES. A, Putative NES sites were identified by alignment with the consensus NES present in PKI. Location of each sequence within CIITA is identified by amino acid number. Hydrophobic residues are indicated in bold. B, Fusion of residues 1035–1051 to GFP results in cytoplasmic localization of the protein. Note the punctate staining in the cytoplasm of 1035–1051/GFP as compared with GFP alone evenly distributed throughout the cell. C, Leucine to alanine mutation of residue 1049 causes cytoplasmic localization of CIITA. Wild-type CIITA protein and L1049A were FLAG-tagged and detected by immunofluorescence of cells at 24 h posttransfection.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
CIITA has been well characterized as the transcriptional coactivator responsible for initiating the expression of the MHC class II genes as well as genes for DM and invariant chain involved in exogenous Ag processing and presentation (1, 2, 3). Although CIITA itself fails to directly bind DNA at the promoters of class II genes, it does interact in the nucleus with other transcription factors at these regions (13, 59). Therefore, for full functionality, CIITA must be able to enter the nucleus to activate target gene expression. Previously we have identified a NLS within CIITA capable of mediating nuclear translocation of the protein (30). This NLS (NLS3) is located toward the carboxyl terminus of CIITA, at aa 955–959, and has been shown to be necessary for CIITA nuclear translocation, as its deletion results in a cytoplasmic-restricted protein and is the molecular basis for one form of complementation group A type II BLS. However, subsequent carboxyl-terminal deletions of CIITA revealed shorter forms of the protein that again displayed the ability to enter the nucleus. The C terminus contains leucine-rich regions that can interact with other regions of the molecule (56), thereby potentially covering up specific motifs within the molecule that are otherwise exposed under particular conditions within the cell. It is possible that deletion of the carboxyl-terminal region of CIITA exposes a previously covered NLS or eliminates an NES, in either case resulting in the increased nuclear translocation of the CIITA mutants. These deletion mutant proteins must be specifically directed into the nucleus by a NLS or by association with another NLS-containing protein, as the mutants themselves are too large (>40 kDa) to pass through the nuclear pore complexes by simple diffusion. This observation led to the possibility that CIITA may contain one or more additional NLS amino-terminal to NLS3.

Fine mapping of CIITA using carboxyl-terminal deletion mutants restricted the second CIITA NLS to a smaller region. Deletion mutants 1–444, 1–518, and 1–612 all localize strongly to the nucleus in immunofluorescence studies, whereas 1–335 and smaller CIITA constructs are distributed evenly throughout the cytoplasm and nucleus. Therefore, the 110-aa region between residues 336 and 444 appeared likely to contain a NLS. The equal subcellular distribution of the CIITA constructs shorter than 336 aa in length is likely due to passive diffusion of these proteins through the nuclear membrane, although these observations do completely preclude the possibility of another NLS upstream of aa 335. To be consistent with our observations of equivalent distribution of CIITA1–335 between the cytoplasmic and nuclear compartments, the rate of import due to a NLS in this position would have to be equally balanced by the rate of export or passive diffusion out of the nucleus. Sequence analysis of the region between aa 336 and 444 reveals a single motif that is rich in basic residues, one of the general hallmarks of a NLS (60). This motif at aa 405–414, KEHRRPRETR, is located just upstream from the GTP homology region of CIITA. NLS motifs have traditionally been identified on the basis of three functional characteristics: 1) deletion of the putative NLS results in a protein restricted to cytoplasmic expression and incapable of entering the nucleus; 2) addition of the NLS to a heterologous protein is sufficient to drive the nuclear translocation of that protein; and 3) the NLS is interchangeable with other defined NLS. The CIITA NLS motif at aa 405–414 meets all of these criteria. An internal deletion of aa 405–414 causes the resulting CIITA protein to be expressed only in the cytoplasm. Arginine to alanine mutations at residues 408 and 409 result in decreased nuclear translocation of CIITA as compared with the wild-type protein. Fusion of this 10-aa motif to GFP in one or two copies induces the nuclear localization of GFP. Finally, substitution of the classical SV40 NLS into the region deleted for aa 405–414 in CIITA causes partial restoration of CIITA localization and function. The failure to reach a full 100% restoration of activity by substitution of the SV40 NLS for aa 405–414 may be due to slight differences in charge, size, or sequence between the two NLS, causing a decrease in the rate of nuclear import compared with wild-type CIITA. CIITA that is translocated more slowly into the nucleus could lead to a reduced nuclear accumulation and leave the protein more susceptible to the nuclear export machinery. If the rate of nuclear export of CIITA{Delta}405–414/NLS is greater than the rate of nuclear import, this would account for the observation of predominantly cytoplasmic CIITA{Delta}405–414 in untreated cells. This ability of the SV40 NLS to rescue CIITA activity suggests that the functional domain deleted in CIITA{Delta}405–414 is a NLS and that this region is normally exposed on the surface of the CIITA protein in the proper context such that it is capable of being recognized by the nuclear import machinery of the cell.

The data presented here indicate that CIITA contains three identified NLS, one at aa 405–414 as well as the previously identified NLS at residues 141–159 (31) and 955–959 (30). We propose that these NLS regions be referred to by the more simplified names of NLS1 (aa 141–159), NLS2 (aa 405–414), and NLS3 (aa 955–959). It is clear that loss of either NLS2 or NLS3 inhibits the ability of CIITA to translocate to the nucleus and activate gene expression. In the absence of a crystallographic structure of CIITA, it is difficult to know how these NLS are aligned relative to one another. It may be that all are part of a pocket domain that stabilizes interaction with importin {alpha} or alternatively the NLS may be entirely distinct domains that mediate interactions with separate importin protein family members. Interestingly, the SV40 NLS cannot substitute for NLS3 of CIITA (30). Therefore, while NLS2 is similar to the classical NLS, NLS3 is a distinct form likely to interact with a separate subset of importin family members. Six different isoforms of importin {alpha} have been described in humans thus far (61, 62, 63, 64, 65, 66) and there is evidence that different isoforms show different affinities for specific NLS-containing substrates (67). Correlating the exact kinetics and binding affinities of different importin {alpha} isoforms with different NLS remains to be determined. A number of proteins contain two or more NLS, either sequentially within the protein as part of a bipartite NLS or distributed throughout the protein, including NF-AT, Rb, c-myc, and Myo-D (32).

Bipartite sequences are separated by 10- to 12-aa spacers, although NLS in other proteins may also be separated by >100 residues, as in the case of the influenza NS1 nuclear protein (68). In this case, NLS1 is a bipartite NLS, whereas the more carboxyl-terminal NLS of CIITA are reminiscent of the latter, with NLS2 and NLS3 likely mediating binding to two different importin molecules, both of which are necessary for nuclear import. Our data suggest that deletion of either NLS alone is sufficient to impair CIITA translocation, resulting in cytoplasmic localization of the protein and loss of gene expression from MHC class II promoters. Because CIITA is a relatively large protein at 140 kDa, multiple NLS may be more efficient at translocating it into the nucleus. The regulation of CIITA must be very tightly controlled to effect MHC class II gene transcription at the proper time in response to cellular stimulation. Control of CIITA translocation mediated by interaction with multiple importin family members may be one of a number of mechanisms by which cells carefully regulate CIITA activity.

Immunofluorescence studies demonstrate that CIITA is present in both the cytoplasm and the nucleus, a finding confirmed by treatment of cells with LMB. As an inhibitor of CRM1-mediated nuclear export (46, 48), LMB increases the nuclear concentration of CIITA, demonstrating that the CIITA protein is normally exported back into the cytoplasm. This accumulation of nuclear CIITA occurs very rapidly following LMB addition, indicating that CRM1-mediated export of CIITA is a highly active process. Despite our initial attempts however, we were unable to definitely identify specific NES motifs in the CIITA protein. Two different possibilities exist that may explain the failure in our initial identification of a CIITA NES. First, the NES exists within another region of CIITA or has an unusual sequence that was not identified by initial sequence homology comparisons to known NES. Second, CIITA may in fact lack a NES but is exported from the nucleus in complex with another NES-containing protein. Because CIITA has been shown to interact with a number of proteins within the nucleus (26), we cannot eliminate this possibility. Several scenarios may exemplify the significance of CIITA being present in both the cytoplasm and the nucleus. It is possible that export is necessary to down-regulate CIITA activity following gene activation; CIITA may be modified in the cytoplasm and reimported into the nucleus; cycling of CIITA between the nucleus and the cytoplasm may allow for the specific import or export of CIITA-associated proteins; or alternatively CIITA may be specifically degraded in the cytoplasm. The identification of the domain responsible for CIITA export, combined with the present identification of the two NLS, will help clarify the function of this dual subcellular localization of CIITA.

Note added in proof:

After this paper was accepted, Kretsovali et al. (69) published data showing that aa 1–114 and 550–850 of CIITA bind CRMI. These regions may correspond to the potential NES sites identified in Fig. 8Go.


   Acknowledgments
 
We thank B. Wolff for the generous gift of the LMB and M. Linhoff for assistance with preparation of constructs.


   Footnotes
 
1 This work was supported by grants from the National Institutes of Health (AI29564, AI45580, and AI41751 to J.P.-Y.T.) and the Milton J. Petrie-Irvington Institute Fellowship (to D.E.C.). Back

2 Address correspondence and reprint requests to Dr. Drew E. Cressman at the current address: Department of Biology, Sarah Lawrence College, 1 Mead Way, Bronxville, NY 10708. E-mail address: dcressma{at}mail.slc.edu Back

3 Abbreviations used in this paper: CIITA, class II transactivator; BLS, bare lymphocyte syndrome; NLS, nuclear localization signal; NES, nuclear export signal; LMB leptomycin B; GFP, green fluorescent protein. Back

Received for publication September 25, 2000. Accepted for publication July 18, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Steimle, V., C. A. Siegrist, A. Mottet, B. Lisowska-Grospierre, B. Mach. 1994. Regulation of MHC class II expression by interferon-{gamma} mediated by the transactivator gene CIITA. Science 265:106.[Abstract/Free Full Text]
  2. Chin, K. C., C. Mao, C. Skinner, J. L. Riley, K. L. Wright, C. S. Moreno, G. R. Stark, J. M. Boss, J. P. Ting. 1994. Molecular analysis of G1B and G3A IFN {gamma} mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity 1:687.[Medline]
  3. Chang, C. H., R. A. Flavell. 1995. Class II transactivator regulates the expression of multiple genes involved in antigen presentation. J. Exp. Med. 181:765.[Abstract/Free Full Text]
  4. Taxman, D. J., D. E. Cressman, J. P. Ting. 2000. Identification of class II transcriptional activator-induced genes by representational difference analysis: discoordinate regulation of the DN{alpha}/DO{beta} heterodimer. J. Immunol. 165:1410.[Abstract/Free Full Text]
  5. Kara, C. J., L. H. Glimcher. 1991. In vivo footprinting of MHC class II genes: bare promoters in the bare lymphocyte syndrome. Science 252:709.[Abstract/Free Full Text]
  6. Ting, J. P., A. S. Baldwin. 1993. Regulation of MHC gene expression. Curr. Opin. Immunol. 5:8.[Medline]
  7. Mach, B., V. Steimle, E. Martinez-Soria, W. Reith. 1996. Regulation of MHC class II genes: lessons from a disease. Annu. Rev. Immunol. 14:301.[Medline]
  8. Scholl, T., S. K. Mahanta, J. L. Strominger. 1997. Specific complex formation between the type II bare lymphocyte syndrome-associated transactivators CIITA and RFX5. Proc. Natl. Acad. Sci. USA 94:6330.[Abstract/Free Full Text]
  9. Mahanta, S. K., T. Scholl, F. C. Yang, J. L. Strominger. 1997. Transactivation by CIITA, the type II bare lymphocyte syndrome-associated factor, requires participation of multiple regions of the TATA box binding protein. Proc. Natl. Acad. Sci. USA 94:6324.[Abstract/Free Full Text]
  10. Fontes, J. D., N. Jabrane-Ferrat, C. R. Toth, B. M. Peterlin. 1996. Binding and cooperative interactions between two B cell-specific transcriptional coactivators. J. Exp. Med. 183:2517.[Abstract/Free Full Text]
  11. Kretsovali, A., T. Agalioti, C. Spilianakis, E. Tzortzakaki, M. Merika, J. Papamatheakis. 1998. Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with the class II transactivator. Mol. Cell. Biol. 18:6777.[Abstract/Free Full Text]
  12. Fontes, J. D., B. Jiang, B. M. Peterlin. 1997. The class II trans-activator CIITA interacts with the TBP-associated factor TAFII32. Nucleic Acids Res. 25:2522.[Abstract/Free Full Text]
  13. Zhu, X.-S., M. W. Linhoff, G. Li, K.-C. Chin, J. P.-Y. Ting. 2000. Transcriptional scaffold: CIITA interacts with NF-Y, RFX and CREB to cause stereospecific regulation of class II MHC promoter. Mol. Cell. Biol. 20:6051.[Abstract/Free Full Text]
  14. Abdulkadir, S. A., S. J. Ono. 1995. How are class II MHC genes turned on and off?. FASEB J. 9:1429.[Abstract]
  15. Riley, J. L., S. D. Westerheide, J. A. Price, J. A. Brown, J. M. Boss. 1995. Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA). Immunity 2:533.[Medline]
  16. Boss, J. M.. 1997. Regulation of transcription of MHC class II genes. Curr. Opin. Immunol. 9:107.[Medline]
  17. Westerheide, S. D., P. Louis-Plence, D. Ping, X. F. He, J. M. Boss. 1997. HLA-DMA and HLA-DMB gene expression functions through the conserved S-X-Y region. J. Immunol. 158:4812.[Abstract]
  18. Harton, J. A., D. E. Cressman, K. C. Chin, C. J. Der, J. P. Ting. 1999. GTP binding by class II transactivator: role in nuclear import. Science 285:1402.[Abstract/Free Full Text]
  19. Hume, C. R., L. A. Shookster, N. Collins, R. O’Reilly, J. S. Lee. 1989. Bare lymphocyte syndrome: altered HLA class II expression in B cell lines derived from two patients. Hum. Immunol. 25:1.[Medline]
  20. Reith, W., V. Steimle, B. Mach. 1995. Molecular defects in the bare lymphocyte syndrome and regulation of MHC class II genes. Immunol. Today 16:539.[Medline]
  21. Arens, M. Q., A. P. Knutsen, K. B. Schwarz, S. T. Roodman, E. M. Swierkosz. 1987. Multiple and persistent viral infections in a patient with bare lymphocyte syndrome. J. Infect. Dis. 156:837.[Medline]
  22. Steimle, V., B. Durand, E. Barras, M. Zufferey, M. R. Hadam, B. Mach, W. Reith. 1995. A novel DNA-binding regulatory factor is mutated in primary MHC class II deficiency (bare lymphocyte syndrome). Genes Dev. 9:1021.[Abstract/Free Full Text]
  23. Durand, B., P. Sperisen, P. Emery, E. Barras, M. Zufferey, B. Mach, W. Reith. 1997. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J. 16:1045.[Medline]
  24. Masternak, K., E. Barras, M. Zufferey, B. Conrad, G. Corthals, R. Aebersold, J. C. Sanchez, D. F. Hochstrasser, B. Mach, W. Reith. 1998. A gene encoding a novel RFX-associated transactivator is mutated in the majority of MHC class II deficiency patients. Nat. Genet. 20:273.[Medline]
  25. Nagarajan, U. M., P. Louis-Plence, A. DeSandro, R. Nilsen, A. Bushey, J. M. Boss. 1999. RFX-B is the gene responsible for the most common cause of the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity 10:153.[Medline]
  26. Harton, J. A., J. P. Ting. 2000. Class II transactivator: mastering the art of major histocompatibility complex expression. Mol. Cell. Biol. 20:6185.[Free Full Text]
  27. Accolla, R. S.. 1983. Human B cell variants immunoselected against a single Ia antigen subset have lost expression of several Ia antigen subsets. J. Exp. Med. 157:1053.[Abstract/Free Full Text]
  28. Steimle, V., L. A. Otten, M. Zufferey, B. Mach. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 75:135.[Medline]
  29. Bontron, S., V. Steimle, C. Ucla, M. M. Eibl, B. Mach. 1997. Two novel mutations in the MHC class II transactivator CIITA in a second patient from MHC class II deficiency complementation group A. Hum. Genet. 99:541.[Medline]
  30. Cressman, D. E., K. C. Chin, D. J. Taxman, J. P. Ting. 1999. A defect in the nuclear translocation of CIITA causes a form of type II bare lymphocyte syndrome. Immunity 10:163.[Medline]
  31. Spilianakis, C., J. Papamatheakis, A. Kretsovali. 2000. Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes. Mol. Cell. Biol. 20:8489.[Abstract/Free Full Text]
  32. Jans, D. A., S. Hubner. 1996. Regulation of protein transport to the nucleus: central role of phosphorylation. Physiol. Rev. 76:651.[Abstract/Free Full Text]
  33. Yoneda, Y.. 1997. How proteins are transported from cytoplasm to the nucleus. J. Biochem. 121:811.[Abstract/Free Full Text]
  34. Adam, S. A., L. Gerace. 1991. Cytosolic proteins that specifically bind nuclear location signals are receptors for nuclear import. Cell 66:837.[Medline]
  35. Gorlich, D., U. Kutay. 1999. Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell. Dev. Biol. 15:607.[Medline]
  36. Kalderon, D., B. L. Roberts, W. D. Richardson, A. E. Smith. 1984. A short amino acid sequence able to specify nuclear location. Cell 39:499.[Medline]
  37. Lanford, R. E., J. S. Butel. 1984. Construction and characterization of an SV40 mutant defective in nuclear transport of T antigen. Cell 37:801.[Medline]
  38. Siomi, H., G. Dreyfuss. 1995. A nuclear localization domain in the hnRNP A1 protein. J. Cell Biol. 129:551.[Abstract/Free Full Text]
  39. Prieve, M. G., K. L. Guttridge, J. Munguia, M. L. Waterman. 1998. Differential importin-{alpha} recognition and nuclear transport by nuclear localization signals within the high-mobility-group DNA binding domains of lymphoid enhancer factor 1 and T-cell factor 1. Mol. Cell. Biol. 18:4819.[Abstract/Free Full Text]
  40. Efthymiadis, A., L. J. Briggs, D. A. Jans. 1998. The HIV-1 Tat nuclear localization sequence confers novel nuclear import properties. J. Biol. Chem. 273:1623.[Abstract/Free Full Text]
  41. Pollard, V. W., M. H. Malim. 1998. The HIV-1 Rev protein. Annu. Rev. Microbiol. 52:491.[Medline]
  42. Fornerod, M., M. Ohno, M. Yoshida, I. W. Mattaj. 1997. CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 90:1051.[Medline]
  43. Fukuda, M., S. Asano, T. Nakamura, M. Adachi, M. Yoshida, M. Yanagida, E. Nishida. 1997. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 390:308.[Medline]
  44. Stade, K., C. S. Ford, C. Guthrie, K. Weis. 1997. Exportin 1 (Crm1p) is an essential nuclear export factor. Cell 90:1041.[Medline]
  45. Askjaer, P., T. H. Jensen, J. Nilsson, L. Englmeier, J. Kjems. 1998. The specificity of the CRM1-Rev nuclear export signal interaction is mediated by RanGTP. J. Biol. Chem. 273:33414.[Abstract/Free Full Text]
  46. Kudo, N., B. Wolff, T. Sekimoto, E. P. Schreiner, Y. Yoneda, M. Yanagida, S. Horinouchi, M. Yoshida. 1998. Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1. Exp. Cell Res. 242:540.[Medline]
  47. Ossareh-Nazari, B., F. Bachelerie, C. Dargemont. 1997. Evidence for a role of CRM1 in signal-mediated nuclear protein export. Science 278:141.[Abstract/Free Full Text]
  48. Wolff, B., J. J. Sanglier, Y. Wang. 1997. Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem. Biol. 4:139.[Medline]
  49. Chin, K. C., G. G. Li, J. P. Ting. 1997. Importance of acidic, proline/serine/threonine-rich, and GTP-binding regions in the major histocompatibility complex class II transactivator: generation of transdominant-negative mutants. Proc. Natl. Acad. Sci. USA 94:2501.[Abstract/Free Full Text]
  50. Piskurich, J. F., Y. Wang, M. W. Linhoff, L. C. White, J. P. Ting. 1998. Identification of distinct regions of 5' flanking DNA that mediate constitutive, IFN-{gamma}, STAT1, and TGF-{beta}-regulated expression of the class II transactivator gene. J. Immunol. 160:233.[Abstract/Free Full Text]
  51. Beals, C. R., N. A. Clipstone, S. N. Ho, G. R. Crabtree. 1997. Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin-sensitive intramolecular interaction. Genes Dev. 11:824.[Abstract/Free Full Text]
  52. Efthymiadis, A., H. Shao, S. Hubner, D. A. Jans. 1997. Kinetic characterization of the human retinoblastoma protein bipartite nuclear localization sequence (NLS) in vivo and in vitro: a comparison with the SV40 large T-antigen NLS. J. Biol. Chem. 272:22134.[Abstract/Free Full Text]
  53. Dang, C. V., W. M. Lee. 1988. Identification of the human c-myc protein nuclear translocation signal. Mol. Cell. Biol. 8:4048.[Abstract/Free Full Text]
  54. Vandromme, M., J. C. Cavadore, A. Bonnieu, A. Froeschle, N. Lamb, A. Fernandez. 1995. Two nuclear localization signals present in the basic-helix 1 domains of MyoD promote its active nuclear translocation and can function independently. Proc. Natl. Acad. Sci. USA 92:4646.[Abstract/Free Full Text]
  55. Yoneda, Y.. 1996. Nuclear pore-targeting complex and its role on nuclear protein transport. Arch. Histol. Cytol. 59:97.[Medline]
  56. Linhoff, M. W., J. A. Harton, D. E. Cressman, B. K. Martin, J. P. Ting. 2001. Two distinct domains within CIITA mediate self-association: involvement of the GTP-binding and leucine-rich repeat domains. Mol. Cell. Biol. 21:3001.[Abstract/Free Full Text]
  57. Antoine, M., K. Reimers, C. Dickson, P. Kiefer. 1997. Fibroblast growth factor 3, a protein with dual subcellular localization, is targeted to the nucleus and nucleolus by the concerted action of two nuclear localization signals and a nucleolar retention signal. J. Biol. Chem. 272:29475.[Abstract/Free Full Text]
  58. Gerace, L.. 1995. Nuclear export signals and the fast track to the cytoplasm. Cell 82:341.[Medline]
  59. Masternak, K., A. Muhlethaler-Mottet, J. Villard, M. Zufferey, V. Steimle, W. Reith. 2000. CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev. 14:1156.[Abstract/Free Full Text]
  60. Gorlich, D.. 1997. Nuclear protein import. Curr. Opin. Cell Biol. 9:412.[Medline]
  61. Cortes, P., Z. S. Ye, D. Baltimore. 1994. RAG-1 interacts with the repeated amino acid motif of the human homologue of the yeast protein SRP1. Proc. Natl. Acad. Sci. USA 91:7633.[Abstract/Free Full Text]
  62. Cuomo, C. A., S. A. Kirch, J. Gyuris, R. Brent, M. A. Oettinger. 1994. Rch1, a protein that specifically interacts with the RAG-1 recombination-activating protein. Proc. Natl. Acad. Sci. USA 91:6156.[Abstract/Free Full Text]
  63. Kohler, M., S. Ansieau, S. Prehn, A. Leutz, H. Haller, E. Hartmann. 1997. Cloning of two novel human importin-{alpha} subunits and analysis of the expression pattern of the importin-{alpha} protein family. FEBS Lett. 417:104.[Medline]
  64. Nachury, M. V., U. W. Ryder, A. I. Lamond, K. Weis. 1998. Cloning and characterization of hSRP1{gamma}, a tissue-specific nuclear transport factor. Proc. Natl. Acad. Sci. USA 95:582.[Abstract/Free Full Text]
  65. Seki, T., S. Tada, T. Katada, T. Enomoto. 1997. Cloning of a cDNA encoding a novel importin-{alpha} homologue, Qip1: discrimination of Qip1 and Rch1 from hSrp1 by their ability to interact with DNA helicase Q1/RecQL. Biochim. Biophys. Acta 234:48.
  66. Weis, K., I. W. Mattaj, A. I. Lamond. 1995. Identification of hSRP1{alpha} as a functional receptor for nuclear localization sequences. Science 268:1049.[Abstract/Free Full Text]
  67. Kohler, M., C. Speck, M. Christiansen, F. R. Bischoff, S. Prehn, H. Haller, D. Gorlich, E. Hartmann. 1999. Evidence for distinct substrate specificities of importin {alpha} family members in nuclear protein import. Mol. Cell. Biol. 19:7782.[Abstract/Free Full Text]
  68. Greenspan, D., P. Palese, M. Krystal. 1988. Two nuclear location signals in the influenza virus NS1 nonstructural protein. J. Virol. 62:3020.[Abstract/Free Full Text]
  69. Kretsovali, A., C. Spilianakis, A. Dimakopoulos, T. Makatounakis, J. Papamatheakis. 2001. Self-association of class II transactivator correlates with its intracellular localization and transactivation. J. Biol. Chem. 276:32191.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
L. N. Voong, A. R. Slater, S. Kratovac, and D. E. Cressman
Mitogen-activated Protein Kinase ERK1/2 Regulates the Class II Transactivator
J. Biol. Chem., April 4, 2008; 283(14): 9031 - 9039.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. C. Tang, K. A. Trzaska, S. V. Smirnov, S. V. Kotenko, S. K. Schwander, J. J. Ellner, and P. Rameshwar
Down-Regulation of MHC II in Mesenchymal Stem Cells at High IFN-{gamma} Can Be Partly Explained by Cytoplasmic Retention of CIITA
J. Immunol., February 1, 2008; 180(3): 1826 - 1833.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
T. L. Herrmann, R. S. Agrawal, S. F. Connolly, R. L. McCaffrey, J. Schlomann, and D. J. Kusner
MHC Class II levels and intracellular localization in human dendritic cells are regulated by calmodulin kinase II
J. Leukoc. Biol., September 1, 2007; 82(3): 686 - 699.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. Tosi, E. Pilotti, L. Mortara, A. D. L. Barbaro, C. Casoli, and R. S. Accolla
Inhibition of human T cell leukemia virus type 2 replication by the suppressive action of class II transactivator and nuclear factor Y
PNAS, August 22, 2006; 103(34): 12861 - 12866.
[Abstract] [Full Text] [PDF]