|
|
||||||||


*
Lineberger Comprehensive Cancer Center,
Department of Microbiology and Immunology, and
Curriculum in Oral Biology, School of Dentistry, University of North Carolina, Chapel Hill, NC 27599
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
, and invariant
chain (1, 2, 3, 4). The activity of CIITA itself and subsequent
expression of class II genes is constitutive in B cells and inducible
by IFN-
in most other cell types (5, 6, 7). Although it
does not directly bind to DNA, CIITA functions as a nuclear coactivator
by interacting with other promoter binding factors and components of
the basal transcription complex, including RFX5, NF-Y, TATA binding
factor-associated proteins, Bob1, CREB, and CBP (8, 9, 10, 11, 12, 13).
Interaction of CIITA with these factors occurs at the W/X/Y regulatory
elements in the promoters of class II target genes
(14, 15, 16, 17). The CIITA protein contains a number of
functional motifs, including an amino-terminal acidic activation
domain, a proline-serine-threonine-rich region, and a GTP-binding
motif. GTP binding of CIITA has been shown to correlate with nuclear
import; mutants defective for GTP binding fail to translocate into
the nucleus and fail to activate class II gene expression
(18). The GTP-binding motif is not a nuclear localization
signal (NLS), but most likely GTP binding causes a conformational
change that is compatible with nuclear translocation. Loss of cell surface MHC class II expression in patients leads to the development of bare lymphocyte syndrome (BLS), a severe immunodeficiency disease characterized by failure of lymphocyte proliferation and activation, multiple recurrent infections, and ultimately death in early childhood (19, 20, 21). The genetic defects leading to BLS have been grouped into four complementation groups, with each group corresponding to mutations in different transcription factors necessary for class II gene expression. These factors include RFX5 (complementation group C) (22), RFXAP (group D) (23), RFXANK/RFX-B (group B) (24, 25), as well as CIITA (26). Mutations in CIITA are responsible for complementation group A BLS patients and class II-negative cell lines derived from these patients (27, 28, 29). One group A BLS patient was found to contain a 72-bp deletion in the CIITA gene, resulting in the loss of aa 940963 (28). Recently, we found that the loss of this region results in the loss of a NLS at aa 955959, abrogating CIITA activity because the protein fails to translocate from the cytoplasm into the nucleus (30). Recently, another NLS has been identified at aa 141159 of CIITA (31). Interestingly, acetylation of this bipartite sequence increases nuclear accumulation of CIITA.
Translocation of a protein from the cytoplasm into the nucleus is
dependent on the presence of a NLS within the protein. Although
specific consensus sequences for NLS do not exist, they tend to be
short sequences rich in basic residues (32, 33) which
mediate binding to members of the importin (karyopherin)
family of
proteins in the cytoplasm (34). The NLS-containing protein
is translocated through the nuclear pore as part of a trimeric importin
-importin
-NLS protein complex in a GTP-dependent manner. Binding
of RanGTP to importin
within the nucleus leads to dissociation of
the complex and release of the NLS-containing protein (for review, see
Ref. 35). Different variations of NLS have been
identified, with the SV40 large T-Ag NLS serving as the prototype of
the "classical" NLS (36, 37). Other NLS that differ
from the classical NLS by binding to different members of the importin
family or operating in an importin
-independent manner include
the M9 sequence (38), the lymphoid enhancer factor 1 NLS
(39), and the NLS of the HIV-1 Tat protein
(40).
Similar to nuclear import, export of a protein depends on the presence
of a specific nuclear export signal (NES) (reviewed in Ref.
35). These NES are short sequences characterized as being
rich in leucine residues and have been identified in a variety of
different proteins, the best studied of which being the HIV Rev protein
(41). Nuclear export is mediated by CRM1, a importin
-like protein that exports a variety of NES-containing proteins in a
RanGTP-dependent manner (42, 43, 44, 45). CRM1-mediated nuclear
export can be blocked by treatment of cells with the export inhibitor
leptomycin B (LMB) (46, 47, 48), resulting in the nuclear
accumulation of proteins otherwise dependent on the export pathway.
In this paper, we identify an additional NLS present in CIITA. This NLS (NLS2) is located at aa 405414, amino-terminal to the NLS deleted in the group A BLS patient at aa 955959 (NLS3). Deletion of NLS2 results in cytoplasmic localization of CIITA and loss of activity, both of which can be rescued in part by replacement with the SV40 NLS. This last property differs from NLS3, which cannot be replaced by the SV40 NLS. This suggests that unlike NLS3, NLS2 can be categorized as a classical NLS. The presence of both NLS2 and NLS3 are required for CIITA to be fully functional in activating class II gene expression. Furthermore, we demonstrate that CIITA localization is sensitive to LMB, leading to increased nuclear concentrations of the protein and suggesting that the presence of CIITA in both the cytoplasm and the nucleus is dependent on NLS and NES sequences in the protein.
| Materials and Methods |
|---|
|
|
|---|
All mutants were constructed using the pCDNA3.FLAG.CIITA parent
vector containing an eight- amino acid FLAG epitope upstream of the
first methionine of CIITA (49). Carboxyl-terminal CIITA
deletion mutants were constructed by QuikChange site-directed
mutagenesis (Stratagene, La Jolla, CA), resulting in a stop codon
placed at the indicated position within the CIITA sequence. Mutations
were made at codons for aa 149, 225, 336, 446, 518, 614, 752, 853, and
932. Deletion of aa 405414 (CIITA
405414) was
constructed by overlapping PCR using four primers: primer
1(657-CCTGAATCTCCCTGAGGGACC-677); primer 2
(CCGGACCGACTCCACGACAACCGACGGTAGCTACACTAACG-1250); primer 3
(GGCTGCCATCGATGTGATTGCTGTGCTGGGCAAAGCTGG-1268); and primer 4
(2105-GTCTCAGGCTCGACCGGAAGG-2125). Products from initial PCR using
primers 1/2 and 3/4 were combined and reamplified with primers 1/4. The
resulting product inserted a ClaI site and
deleted bp 12121242 of CIITA. To generate CIITA
405414/NLS,
double-stranded, annealed oligonucleotides (5'-CCAAAGAAAAAGCGCAAGGTG)
containing ClaI-compatible ends encoding the SV40 NLS
were inserted into ClaI-digested CIITA
405414.
955959 (CIITA-5aa) and
955959/NLS (CIITA-5aa/NLS) have been
described previously (30). Mutation of codons for
residues 408 and 409 were also generated by QuikChange site-directed
mutagenesis, substituting the CGG codon with GCG in the PCR primers.
All constructs were confirmed by sequencing.
Cell culture and reporter assays
COS-7 and HeLa cells were grown in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FCS, 300 mg/L L-glutamine, and 1% penicillin/streptomycin. All transfections were performed using Fugene 6 (Roche Molecular Biochemicals, Durham, NC) according to the instructions of the manufacturer. Cells were split to six-well plates 12 h before transfection. One microgram of each plasmid was transfected into cells, and cells were harvested at 24 h posttransfection in 200 µl of 1x reporter lysis buffer (Promega, Madison, WI). Forty microliters was assayed for luciferase activity as previously described (50). Extracts were normalized to protein concentration. Each transfection was performed in triplicate. LMB was added to cultured cells at a final concentration of 5 nM, 3 h before harvest. Actinomycin D (2.5 µg/ml; Sigma, St. Louis, MO) was also added to cells where indicated at 3 h before harvest.
Immunofluorescence
FLAG-tagged wild-type CIITA (1 µg) or the indicated CIITA mutants were transfected into COS-7 cells growing in two-well chamber slides and assayed for subcellular localization. Where indicated, 2.5 µg/ml actinomycin D (Sigma) and 5 nM LMB (a gift from B. Wolff, Novartis Forschunginstitut, Austria) was added to the cells 3 h before harvesting. At 24 h posttransfection, slides were rinsed in PBS, fixed in 3:2 acetone:PBS for 4 min, incubated for 1 h with M5 anti-FLAG mouse mAb (Sigma) diluted 1/500 in PBS/1% BSA, rinsed, incubated for 1 h with FITC-conjugated goat anti-mouse secondary Ab (1/500 dilution; BD PharMingen, San Diego, CA), then rinsed and mounted in Vectashield mounting medium with 4',6'-diamidino-2-phenylindole (Vector Laboratories, Burlingame, CA), and observed at x50 magnification. Fluorescence indicates FLAG-CIITA protein localization or Hoechst dye-stained nuclei of the same field.
Green fluorescent protein (GFP) analysis
Fusion proteins were constructed in which double-stranded oligonucleotides encoding aa 405414 of CIITA were subcloned in-frame to the carboxyl terminus of GFP using the pEGFP-C1 parent vector (CLONTECH Laboratories, Palo Alto, CA). Insertions of one or two copies of aa 405414 were confirmed by sequence analysis. The SV40 T-Ag NLS (CCTAAGAAGAAGAGGAAGGTT) was fused to GFP (GFP-NLS) as a positive control. COS-7 cells (6 x 104) were plated into two-well chamber slides 12 h before transfection. One microgram of GFP plasmids was transfected into cells, rinsed 24 h later with PBS, and fixed for 5 min with 4% paraformaldehyde. Fluorescence of the fusion protein was observed using an Olympus BX40 microscope (Melville, NY) at x50 magnification.
| Results |
|---|
|
|
|---|
Previously we have shown that CIITA contains a NLS at aa 955959
(30). Loss of the 24-aa exon that contains this region
results in the abrogation of CIITA activity and loss of MHC class II
surface expression, leading to the BLS (28). However, we
reasoned that because of the size and complexity of CIITA, it might
contain additional NLS, similar to the multiple NLS seen for other
transcription factors such as NF-AT (51), the retinoblastoma
protein (52), c-myc (53),
and Myo-D (54). Deletion of 200 or 278 residues from the
carboxyl terminus, including the aa 955959 NLS3 (CIITA1931 and
CIITA1852, respectively), causes CIITA to be localized to the
cytoplasm as demonstrated by subcellular immunofluorescence assays
(Fig. 1
A). However,
CIITA1751 shows a low level of nuclear presence, while shorter
forms 1444, 1518, and 1613 (predicted molecular mass of 49, 57,
and 67 kDa, respectively) demonstrate nuclear localization stronger
than that seen for the wild-type CIITA. Shorter forms of CIITA <336 aa
all show protein distribution throughout the cytoplasm and nucleus,
likely due to the fact that these are of small enough size (<40 kDa)
to diffuse through the nuclear pore complex without the need for a
specific NLS. The smallest of the nuclear CIITA deletion mutants,
1444, has a predicted molecular mass of 49 kDa, well above the
maximum size of molecules that can undergo nonselective passive
diffusion through the nuclear pore (55). The high
concentration of CIITA1444 in the nucleus compared with the more even
distribution of the 1335 mutant indicates the possible presence of a
NLS between aa 336 and 444. In addition, since 1852 is restricted to
the cytoplasm while 1751 and 1613 show steadily increasing
concentrations of the protein in the nucleus, there may exist a NES
between aa 613 and 852. The presence of any such signal within this
region may be sufficient to drive the export of CIITA1852 from the
nucleus to the cytoplasm. Therefore, loss of an NES C-terminal to aa
613, combined with the remaining presence of a possible NLS between aa
336 and 444, would account for CIITA1613, 1518, and 1444 to
localize more strongly to the nucleus. Despite the presence in the
nucleus of these mutant proteins, loss of any portion of the carboxyl
terminus eliminates the ability of CIITA to activate reporter gene
expression from the class II DR promoter (Fig. 1
B), likely
due to the loss of a carboxyl-terminal leucine-rich region necessary
for self-interaction (56).
|
|
Deletion of entire portions of the carboxyl terminus identified
the general location of the NLS and sequence analysis pinpointed a
specific domain that fit the residue requirements of a NLS motif. To
demonstrate that this domain does indeed function as a NLS, it was
necessary to specifically determine the effects that deleting aa
405414 has on protein localization and CIITA activity. Although
wild-type CIITA localized to both the cytoplasm and the nucleus, CIITA
missing the 10 aa of the putative NLS (CIITA
405414) was only
present in the cytoplasm (Fig. 3
A). It is important to note
that this construct still retains the NLS1 (aa 141159) and the NLS3
site present in the BLS domain (aa 955959). Despite the presence of
these NLS however, CIITA
405414 did not enter the nucleus,
suggesting that NLS2 is critical for normal protein localization. When
tested in reporter activation assays using the class II DR promoter
fused to luciferase, deletion of aa 405414 severely inhibited the
ability of CIITA to activate gene expression relative to the wild-type
form (Fig. 3
B). Western blots indicated that expression of
the mutant CIITA was equivalent to wild type with no evidence of
decreased protein stability (data not shown). Therefore, the failure of
CIITA to localize to the nucleus results from a loss of the 10-aa
domain, which in turns impairs the ability of CIITA to function as a
transcriptional coactivator.
|
Amino acids 405414 drive the nuclear localization of a heterologous protein
One characteristic of previously identified NLS is their capacity
to mediate the nuclear translocation of a heterologous protein
(39, 40, 57). To determine whether the upstream putative
NLS of CIITA could function in a similar manner, we fused the
10-residue motif of aa 405414 to the GFP. The 28-kDa GFP by itself
localizes to both the cytoplasm and the nucleus (Fig. 4
). Fusion of the control SV40 NLS
to GFP results in strong nuclear localization of the protein. When
fused to one copy of the aa 405414, GFP shows a moderate increase in
nuclear translocation, although not as intense as that seen for
GFP-SV40NLS. However, fusion to two copies of aa 405414 significantly
increases the nuclear localization of GFP, such that very little GFP
remains in the cytoplasm. This suggests that aa 405414
can function independently as a NLS, inducing the nuclear translocation
of both CIITA and an unrelated protein. Furthermore, the nuclear
localization function imparted by the CIITA motif appears to be only
slightly weaker than that provided by the well-defined SV40
NLS.
|
The absence of aa 405414 results in the localization of CIITA to
the cytoplasm. However, an alternative explanation for this observation
is that the loss of this region allows the mutated CIITA protein to be
exported from the nucleus more rapidly than is the wild-type protein.
Therefore, blocking nuclear export should reveal whether the
cytoplasmic localization of mutant CIITA constructs is due to excessive
nuclear export or due to the failure of the protein to enter the
nucleus in the first place. Several pieces of evidence indicate that
CIITA undergoes not only nuclear import, but also nuclear export. The
localization of the wild-type protein in both the cytoplasm and the
nucleus indicated by immunofluorescence and immunoblot studies
(30) suggests that CIITA resides in both compartments.
Additionally, treatment of cells with LMB, an inhibitor of nuclear
export, causes the accumulation of nuclear CIITA (Fig. 5
, ad). This nuclear
accumulation is first evident 15 min after LMB addition and increases
over the course of 1 h. Residual cytoplasmic CIITA is still
observed at later time points in these transfected cells. We reasoned
that this cytoplasmic CIITA might be due to de novo synthesis from the
transfected gene. Actinomycin D is capable of blocking de novo
synthesis by inhibiting gene transcription. To determine whether this
residual cytoplasmic CIITA is the result of de novo synthesis, we
blocked new gene transcription by pretreating cells for 3 h with
actinomycin D. This approach allows current mRNA translation to be
carried through to completion, resulting in full-length protein, but
blocks additional transcription, therefore ensuring that all proteins
detected by the Ab are indeed full-length CIITA peptides. Pretreating
CIITA-transfected cells with actinomycin D in the presence of LMB shows
nearly complete nuclear localization of CIITA protein over time (Fig. 5
, eh). This nuclear localization occurs rapidly, as at 15
min following LMB treatment, there was only a low level of
cytoplasmic CIITA present, with the majority localized to the nucleus
(Fig. 5
f), whereas by 30 min to1 h following LMB treatment,
all CIITA was present in the nucleus (Fig. 5
, gh). This
indicates that CIITA in the cytoplasm is primarily the result of
nuclear export and that only the residual amount of cytoplasmic CIITA
seen in Fig. 5
, c and d, is due to de novo
synthesis.
|
405414 is nuclear import, not export
Having demonstrated that CIITA protein is susceptible to nuclear
export that can be blocked by the addition of LMB, it became possible
to further determine whether the cytoplasmic localization of
CIITA
405414 is due to the loss of a NLS or to an increase in
export from the nucleus. If the latter was true, then any increase in
the export of the mutant CIITA should be inhibited by LMB treatment and
the resulting pattern of protein localization should be nearly
indistinguishable from wild-type CIITA treated with LMB. However, in
cells transfected with CIITA
405414 and treated with LMB, the
mutant CIITA protein remained predominantly in the cytoplasm, in
contrast to both wild-type CIITA and CIITA with an N-terminal SV40
NLS (NLSCIITA), which are present primarily in the nucleus (Fig. 6
). All cells were pretreated with
actinomycin D to inhibit additional gene transcription. This indicates
that CIITA
405414 fails to ever enter the nucleus due to the
deletion of the NLS2 motif.
|
405414 activity
We wished to determine whether loss of the NLS motif at aa
405414 can be functionally rescued by the insertion of a classical
SV40 NLS (PKKKRKV) into the same region of the protein.
Immunofluorescence detection of the NLS-corrected protein shows little
increase in nuclear CIITA
405414/NLS, with the majority of the
protein restricted to the cytoplasm (Fig. 6
). However, following
treatment with LMB plus actinomycin D, CIITA
405414/NLS is clearly
present in both the nucleus and the cytoplasm. This suggests that
insertion of the heterologous NLS into the deleted 405414 domain is
sufficient to partially rescue CIITA localization, most likely by
inducing nuclear translocation of the protein at a reduced
rate.
To determine whether the inserted heterologous NLS can rescue
CIITA
405414 activity as well as localization, cells were
cotransfected with the DR promoter-luciferase reporter plus
CIITA
405414 or CIITA
405414/NLS. COS cells represent an
overexpressed system, while HeLa cells express significantly lower
levels of CIITA. Although CIITA
405414 showed minimal ability to
activate expression from the DR promoter, cells transfected with
CIITA
405414/NLS displayed reporter activity approaching that seen
for cells transfected with wild-type CIITA (Fig. 7
). DR activation by CIITA
405414/NLS
in COS cells was restored to >90% of the level of wild-type CIITA,
while HeLa cell activation of DR by CIITA
405414/NLS was 65% that
of wild type. This was in contrast to the downstream NLS3 motif present
in the BLS domain at aa 955959, where substitution with the SV40 NLS
fails to rescue CIITA activity, thereby confirming previous results
(30). These data suggest that the basic residue-rich
domain in CIITA from aa 405414 functions like a classical NLS in
directing the CIITA protein to the nucleus where it can then activate
target gene expression.
|
LMB inhibits CRM1-mediated nuclear export, and CRM1 specifically
binds to leucine-rich NES. Since treatment of CIITA-transfected cells
with LMB increased the nuclear concentration of CIITA, suggesting
that CIITA undergoes CRM1-mediated nuclear export, we analyzed the
CIITA sequence for motifs with similarity to a consensus NES
(58). CIITA contains 10 motifs that show varying degrees
of similarity to the consensus NES (Fig. 8
A). To test the function of
each of these motifs, they were initially fused to GFP. Fusion of each
of these sequences to GFP yielded no changes in GFP subcellular
localization, with the exception of the CIITA sequence of residues
10351051, which resulted in a cytoplasmic pattern (Fig. 8
B). Leucine residues are critical to the function of NES,
the mutation of which would be expected to result in increased nuclear
concentration of the NES-containing protein. However, mutation of a
conserved leucine residue within this region at aa 1049 did
not increase the nuclear concentration of CIITA but instead inhibited
nuclear translocation of the protein. Similar results
were obtained with mutations of leucines at aa 1046 and 1051.
Thus, although these regions bear similarity to an NES
motif, our initial analysis indicates that CIITA may contain other
NES domains not identified in our screen or that multiple NES of
overlapping function may be present in CIITA.
|
| Discussion |
|---|
|
|
|---|
Fine mapping of CIITA using carboxyl-terminal deletion mutants
restricted the second CIITA NLS to a smaller region. Deletion mutants
1444, 1518, and 1612 all localize strongly to the nucleus in
immunofluorescence studies, whereas 1335 and smaller CIITA constructs
are distributed evenly throughout the cytoplasm and nucleus. Therefore,
the 110-aa region between residues 336 and 444 appeared likely to
contain a NLS. The equal subcellular distribution of the CIITA
constructs shorter than 336 aa in length is likely due to passive
diffusion of these proteins through the nuclear membrane, although
these observations do completely preclude the possibility of another
NLS upstream of aa 335. To be consistent with our observations of
equivalent distribution of CIITA1335 between the cytoplasmic and
nuclear compartments, the rate of import due to a NLS in this position
would have to be equally balanced by the rate of export or passive
diffusion out of the nucleus. Sequence analysis of the region between
aa 336 and 444 reveals a single motif that is rich in basic residues,
one of the general hallmarks of a NLS (60). This motif at
aa 405414, KEHRRPRETR, is located just upstream from the GTP
homology region of CIITA. NLS motifs have traditionally been identified
on the basis of three functional characteristics: 1) deletion of the
putative NLS results in a protein restricted to cytoplasmic expression
and incapable of entering the nucleus; 2) addition of the NLS to a
heterologous protein is sufficient to drive the nuclear translocation
of that protein; and 3) the NLS is interchangeable with other defined
NLS. The CIITA NLS motif at aa 405414 meets all of these criteria. An
internal deletion of aa 405414 causes the resulting CIITA protein to
be expressed only in the cytoplasm. Arginine to alanine mutations at
residues 408 and 409 result in decreased nuclear translocation of CIITA
as compared with the wild-type protein. Fusion of this 10-aa motif to
GFP in one or two copies induces the nuclear localization of GFP.
Finally, substitution of the classical SV40 NLS into the region deleted
for aa 405414 in CIITA causes partial restoration of CIITA
localization and function. The failure to reach a full 100%
restoration of activity by substitution of the SV40 NLS for aa 405414
may be due to slight differences in charge, size, or sequence between
the two NLS, causing a decrease in the rate of nuclear import compared
with wild-type CIITA. CIITA that is translocated more slowly into the
nucleus could lead to a reduced nuclear accumulation and leave the
protein more susceptible to the nuclear export machinery. If the rate
of nuclear export of CIITA
405414/NLS is greater than
the rate of nuclear import, this would account for the observation
of predominantly cytoplasmic CIITA
405414 in untreated cells. This
ability of the SV40 NLS to rescue CIITA activity suggests that the
functional domain deleted in CIITA
405414 is a NLS and
that this region is normally exposed on the surface of the CIITA
protein in the proper context such that it is capable of being
recognized by the nuclear import machinery of the cell.
The data presented here indicate that CIITA contains three identified
NLS, one at aa 405414 as well as the previously identified NLS at
residues 141159 (31) and 955959 (30). We
propose that these NLS regions be referred to by the more simplified
names of NLS1 (aa 141159), NLS2 (aa 405414), and NLS3 (aa
955959). It is clear that loss of either NLS2 or NLS3 inhibits the
ability of CIITA to translocate to the nucleus and activate gene
expression. In the absence of a crystallographic structure of
CIITA, it is difficult to know how these NLS are aligned relative to
one another. It may be that all are part of a pocket domain that
stabilizes interaction with importin
or alternatively the NLS
may be entirely distinct domains that mediate interactions with
separate importin protein family members. Interestingly, the SV40 NLS
cannot substitute for NLS3 of CIITA (30). Therefore, while
NLS2 is similar to the classical NLS, NLS3 is a distinct form likely to
interact with a separate subset of importin family members. Six
different isoforms of importin
have been described in humans
thus far (61, 62, 63, 64, 65, 66) and there is evidence that different
isoforms show different affinities for specific NLS-containing
substrates (67). Correlating the exact kinetics and
binding affinities of different importin
isoforms with different
NLS remains to be determined. A number of proteins contain two or more
NLS, either sequentially within the protein as part of a bipartite NLS
or distributed throughout the protein, including NF-AT, Rb, c-myc, and
Myo-D (32).
Bipartite sequences are separated by 10- to 12-aa spacers, although NLS in other proteins may also be separated by >100 residues, as in the case of the influenza NS1 nuclear protein (68). In this case, NLS1 is a bipartite NLS, whereas the more carboxyl-terminal NLS of CIITA are reminiscent of the latter, with NLS2 and NLS3 likely mediating binding to two different importin molecules, both of which are necessary for nuclear import. Our data suggest that deletion of either NLS alone is sufficient to impair CIITA translocation, resulting in cytoplasmic localization of the protein and loss of gene expression from MHC class II promoters. Because CIITA is a relatively large protein at 140 kDa, multiple NLS may be more efficient at translocating it into the nucleus. The regulation of CIITA must be very tightly controlled to effect MHC class II gene transcription at the proper time in response to cellular stimulation. Control of CIITA translocation mediated by interaction with multiple importin family members may be one of a number of mechanisms by which cells carefully regulate CIITA activity.
Immunofluorescence studies demonstrate that CIITA is present in both the cytoplasm and the nucleus, a finding confirmed by treatment of cells with LMB. As an inhibitor of CRM1-mediated nuclear export (46, 48), LMB increases the nuclear concentration of CIITA, demonstrating that the CIITA protein is normally exported back into the cytoplasm. This accumulation of nuclear CIITA occurs very rapidly following LMB addition, indicating that CRM1-mediated export of CIITA is a highly active process. Despite our initial attempts however, we were unable to definitely identify specific NES motifs in the CIITA protein. Two different possibilities exist that may explain the failure in our initial identification of a CIITA NES. First, the NES exists within another region of CIITA or has an unusual sequence that was not identified by initial sequence homology comparisons to known NES. Second, CIITA may in fact lack a NES but is exported from the nucleus in complex with another NES-containing protein. Because CIITA has been shown to interact with a number of proteins within the nucleus (26), we cannot eliminate this possibility. Several scenarios may exemplify the significance of CIITA being present in both the cytoplasm and the nucleus. It is possible that export is necessary to down-regulate CIITA activity following gene activation; CIITA may be modified in the cytoplasm and reimported into the nucleus; cycling of CIITA between the nucleus and the cytoplasm may allow for the specific import or export of CIITA-associated proteins; or alternatively CIITA may be specifically degraded in the cytoplasm. The identification of the domain responsible for CIITA export, combined with the present identification of the two NLS, will help clarify the function of this dual subcellular localization of CIITA.
Note added in proof:
After this paper was accepted, Kretsovali
et al. (69) published data showing that aa 1114 and 550850 of CIITA
bind CRMI. These regions may correspond to the potential NES sites
identified in Fig. 8
.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Drew E. Cressman at the current address: Department of Biology, Sarah Lawrence College, 1 Mead Way, Bronxville, NY 10708. E-mail address: dcressma{at}mail.slc.edu ![]()
3 Abbreviations used in this paper: CIITA, class II transactivator; BLS, bare lymphocyte syndrome; NLS, nuclear localization signal; NES, nuclear export signal; LMB leptomycin B; GFP, green fluorescent protein. ![]()
Received for publication September 25, 2000. Accepted for publication July 18, 2001.
| References |
|---|
|
|
|---|
mediated by the transactivator gene CIITA. Science 265:106.
mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity 1:687.[Medline]
/DO
heterodimer. J. Immunol. 165:1410.
recognition and nuclear transport by nuclear localization signals within the high-mobility-group DNA binding domains of lymphoid enhancer factor 1 and T-cell factor 1. Mol. Cell. Biol. 18:4819.
, STAT1, and TGF-
-regulated expression of the class II transactivator gene. J. Immunol. 160:233.
subunits and analysis of the expression pattern of the importin-
protein family. FEBS Lett. 417:104.[Medline]
, a tissue-specific nuclear transport factor. Proc. Natl. Acad. Sci. USA 95:582.
homologue, Qip1: discrimination of Qip1 and Rch1 from hSrp1 by their ability to interact with DNA helicase Q1/RecQL. Biochim. Biophys. Acta 234:48.
as a functional receptor for nuclear localization sequences. Science 268:1049.
family members in nuclear protein import. Mol. Cell. Biol. 19:7782.This article has been cited by other articles:
![]() |
L. N. Voong, A. R. Slater, S. Kratovac, and D. E. Cressman Mitogen-activated Protein Kinase ERK1/2 Regulates the Class II Transactivator J. Biol. Chem., April 4, 2008; 283(14): 9031 - 9039. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Tang, K. A. Trzaska, S. V. Smirnov, S. V. Kotenko, S. K. Schwander, J. J. Ellner, and P. Rameshwar Down-Regulation of MHC II in Mesenchymal Stem Cells at High IFN-{gamma} Can Be Partly Explained by Cytoplasmic Retention of CIITA J. Immunol., February 1, 2008; 180(3): 1826 - 1833. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Herrmann, R. S. Agrawal, S. F. Connolly, R. L. McCaffrey, J. Schlomann, and D. J. Kusner MHC Class II levels and intracellular localization in human dendritic cells are regulated by calmodulin kinase II J. Leukoc. Biol., September 1, 2007; 82(3): 686 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tosi, E. Pilotti, L. Mortara, A. D. L. Barbaro, C. Casoli, and R. S. Accolla Inhibition of human T cell leukemia virus type 2 replication by the suppressive action of class II transactivator and nuclear factor Y PNAS, August 22, 2006; 103(34): 12861 - 12866. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Zika, L. Fauquier, L. Vandel, and J. P.-Y. Ting Interplay among coactivator-associated arginine methyltransferase 1, CBP, and CIITA in IFN-{gamma}-inducible MHC-II gene expression PNAS, November 8, 2005; 102(45): 16321 - 16326. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Conti, B. K. Davis, J. Zhang, W. O'Connor Jr., K. L. Williams, and J. P.-Y. Ting CATERPILLER 16.2 (CLR16.2), a Novel NBD/LRR Family Member That Negatively Regulates T Cell Function J. Biol. Chem., May 6, 2005; 280(18): 18375 - 18385. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Greer, J. A. Harton, M. W. Linhoff, C. A. Janczak, J. P.-Y. Ting, and D. E. Cressman Serine Residues 286, 288, and 293 within the CIITA: A Mechanism for Down-Regulating CIITA Activity through Phosphorylation J. Immunol., July 1, 2004; 173(1): 376 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Camacho-Carvajal, S. Klingler, F. Schnappauf, S. B. Hake, and V. Steimle Importance of class II transactivator leucine-rich repeats for dominant-negative function and nucleo-cytoplasmic transport Int. Immunol., January 1, 2004; 16(1): 65 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Zika, S. F. Greer, X.-S. Zhu, and J. P.-Y. Ting Histone Deacetylase 1/mSin3A Disrupts Gamma Interferon-Induced CIITA Function and Major Histocompatibility Complex Class II Enhanceosome Formation Mol. Cell. Biol., May 1, 2003; 23(9): 3091 - 3102. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Raval, J. D. Weissman, T. K. Howcroft, and D. S. Singer The GTP-Binding Domain of Class II Transactivator Regulates Its Nuclear Export J. Immunol., January 15, 2003; 170(2): 922 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Barbieri, V. Deffrennes, T. Prod'homme, J. Vedrenne, F. Baton, C. Cortes, A. Fischer, M.-R. Bono, B. Lisowska-Grospierre, D. Charron, et al. Isoforms of the class II transactivator protein Int. Immunol., August 1, 2002; 14(8): 839 - 848. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Pai, D. Askew, W. H. Boom, and C. V. Harding Regulation of Class II MHC Expression in APCs: Roles of Types I, III, and IV Class II Transactivator J. Immunol., August 1, 2002; 169(3): 1326 - 1333. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |