HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Takeshita, F. Articles by Klinman, D. M. Search for Related Content PubMed PubMed Citation Articles by Takeshita, F. Articles by Klinman, D. M.

Cutting Edge: Role of Toll-Like Receptor 9 in CpG DNA-Induced Activation of Human Cells¹

Section of Retroviral Immunology, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Unmethylated CpG motifs present in bacterial DNA stimulate a rapid and robust innate immune response. Human cell lines and PBMC that recognize CpG DNA express membrane-bound human Toll-like receptor 9 (hTLR9). Cells that are not responsive to CpG DNA become responsive when transfected with hTLR9. Expression of hTLR9 dramatically increases uptake of CpG (but not control) DNA into endocytic vesicles. Upon cell stimulation, hTLR9 and CpG DNA are found in the same endocytic vesicles. Cells expressing hTLR9 are stimulated by CpG motifs that are active in primates but not rodents, suggesting that evolutionary divergence between TLR9 molecules underlies species-specific differences in the recognition of bacterial DNA. These findings indicate that hTLR9 plays a critical role in the CpG DNA-mediated activation of human cells.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Members of the Toll-like receptor (TLR)⁵ family respond to pathogen-associated molecular patterns expressed by a diverse group of infectious microorganisms (1), thereby triggering the host’s innate immune system. TLRs contain an extracellular domain with leucine-rich repeats and an intracytoplasmic domain homologous to the IL-1R (2). Cellular activation by TLR proceeds through a signaling cascade involving myeloid differentiation marker 88, IL-1R-associated kinase (IRAK), TNFR-associated factor 6 (TRAF6), and NF-B translocation, culminating in the up-regulation of genes involved in host defense (2).

Unmethylated CpG motifs are present at a 20-fold higher frequency in bacterial than mammalian DNA, due to a combination of CpG suppression and CpG methylation (3, 4). CpG motifs trigger an innate immune response characterized by the activation of Ig-, cytokine-, and chemokine-secreting cells (3, 5). This response confers protection against a variety of intracellular pathogens consistent with unmethylated CpG motifs acting as pathogen-associated molecular patterns. Preclinical and clinical studies indicate that synthetic oligodeoxynucleotides (ODN) containing CpG motifs may have therapeutic value as immune adjuvants and anti-infectious agents (4, 6).

Recent studies indicate that TLR9 plays a critical role in the recognition of CpG motifs in mice. Dominant-negative (DN) versions of myeloid differentiation marker 88, IRAK, and TRAF6 inhibit CpG ODN-mediated cellular activation, and TLR9-knockout mice fail to mount an immune response when stimulated with CpG ODN (7, 8). Despite 76% identity at the amino acid level between murine and human TLR9 (hTLR9) (7), the CpG motifs that are most active in mice have little effect on human cells, and vice versa (9). Moreover, the type of CpG motif expressed by various pathogens influences the type and magnitude of immune response elicited in different mammalian species (10). The present work examines whether CpG recognition in humans is also mediated by TLR9 and explores the nature of the receptor-ligand interaction.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Reagents

Phosphorothioate ODNs were synthesized at the Center for Biologics Evaluation and Research core facility (Bethesda, MD). Sequences of the ODN (5'3') were: K3 CpG ODN, ATCGACTCTCGAGCGTTCTC; K3-flip control ODN, ATGCACTCTGCAGGCTTCTC; K3-methyl, AT^mCGACTCT^mCGAG^mCGTTCTC; 2006, TCGTCGTTTTGTCGTTTTGCTGTT (11); 1466, TCAACGTTGA; 1555, GCTAGACGTTAGCGT; and 1612, GCTAGATGTTAGCGT, where ^mC indicates a methyl cytosine. Cy3 was conjugated to the 5' end of some ODN. LPS was purchased from Sigma (St. Louis, MO). Human IFN- was purchased from Life Technologies (Gaithersburg, MD).

Cells and cell cultures

Cell lines (obtained from American Type Culture Collection, Manassas, VA) were maintained in complete DMEM (10% FCS, 50 mg/ml penicillin/streptomycin, 2 mM L-glutamine, 10 mM HEPES buffer, 0.11 mg/ml sodium pyruvate, and 0.5 mM 2-ME). Elutriated monocytes and PBMC were obtained from the National Institutes of Health Blood Bank (Bethesda, MD).

Plasmid construction

Human TLR9 cDNA (the gift of Dr. B. Beutler, Scripps Research Institute, La Jolla, CA) (12) was inserted into pCIneo (Promega, Madison, WI). Human TLR9B (amino acids 58–1032), hTLR9 5 deletion mutant 1–1000(1–1000), and hTLR9 intracellular domain (ICD) deletion mutant 1–860(1–860) were PCR generated from this cDNA. TLR9 26–1032(26–1032) was cloned into pDisplay (Invitrogen, Carlsbad, CA), which generated a hemagglutinin (HA) tag. PCR-amplified DN IRAK1 1–96(1–96) and DN TRAF6 287–523(287–523) were cloned into pFlagCMV4 (Sigma).

Cell transfection and luciferase assay

Cells (5 x 10⁴) were transfected using FuGENE 6 (Roche Molecular Biochemicals, Indianapolis, IN) plus 0.1 µg p5xNF-B-luc (Stratagene, La Jolla, CA), 0.1 µg pSV--galactosidase (Promega), and 0.2–0.8 µg of various expression vectors for 18 h. Luciferase assays were performed as recommended by the manufacturer (Promega) after 24 h. -Galactosidase activity was used to normalize the data.

RT-PCR

PCR (33–40 cycles)-amplified products from 1 to 5 µg of reverse-transcribed RNA were visualized by ethidium bromide staining on agarose gels.

Confocal microscopy

Transfected 293T cells were treated with Cy3-labeled ODN for 10–120 min at 37°C. Cells were washed, fixed, permeabilized, and stained for HA-TLR9 protein using FITC-anti-HA Ab (clone 3F10; Roche Molecular Biochemicals). Subcellular localization of Cy3 and FITC signals were determined by confocal microscopy (LSM5 PASCAL; Carl Zeiss, Thornwood, NY).

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
CpG responsiveness of human cells correlates with TLR9 mRNA expression

TLR9 mRNA was expressed in CpG-responsive human monocytes and RPMI 8226 cells, but not by unresponsive cells (such as Jurkat or 293; Fig. 1). Human PBMC constitutively expressed low levels of TLR9 mRNA. IFN- treatment significantly increased both TLR9 mRNA expression and CpG DNA responsiveness of PBMC (Fig. 1 and data not shown). Therefore, TLR9 expression is a prerequisite for cell activation by CpG DNA, and factors that increase TLR9 mRNA levels also increase responsiveness to CpG DNA.

View larger version (33K): [in this window] [in a new window]   FIGURE 1. TLR9 mRNA expression correlates with CpG ODN responsiveness. RT-PCR specific for TLR9 or GAPDH (left panel) was performed on RNA isolated from various human cell lines, elutriated primary monocytes, and the pCIneo-TLR9 plasmid (no reverse transcription). Fresh human PBMC also expressed TLR9 mRNA (right panel). When stimulated with 1000 U/ml IFN- for 18 h, the responsiveness of these PBMC and their levels of TLR9 mRNA both increased.

To examine the importance of TLR9 in the CpG-mediated activation of human cells, 293 cells were transiently cotransfected with a NF-B-dependent luciferase reporter (p5xNF-B-luc) plus hTLR9 (hereafter referred to as 293^Trans). 293^Trans stimulated with CpG ODN that activate human PBMC (9, 10) significantly increased NF-B dependent luciferase activity (Fig. 2A). This stimulation was abrogated if the critical CpG motif was disrupted by inversion or methylation (Fig. 2A). Moreover, CpG ODN known to trigger rodent but not primate cells (ODN 1555 and 1466) were uniformly inactive (Fig. 2A). The response of TLR9 was CpG specific, because 293^Trans did not respond to LPS (Fig. 2A), and 293 cells transfected with TLR4 did not respond to CpG ODN (data not shown). These findings indicate that 1) TLR9 is involved in the recognition of human CpG motifs, and 2) differences in CpG recognition between species may reflect evolutionary divergence between TLR9 molecules.

View larger version (25K): [in this window] [in a new window]   FIGURE 2. Expression of hTLR9 confers CpG ODN responsiveness. A, Luciferase activity of transfected cells 24 h after treatment with 1 µM of the following ODN: human-stimulatory CpG ODN (2006 and K3), ODN in which the critical CpG dinucleotide was inverted or methylated (K3-flip and K3-methyl), murine-stimulatory CpG ODN (1466 and 1555), control ODN (1612), or 1 µg/ml LPS. Results represent the mean + SEM of three to five independent experiments; *, p .01, and **, p .001 compared with identically treated cells cultured in medium. B, IL-8 mRNA expression by 293 cells transfected with vector or TLR9 and stimulated for 24 h with 1 µM CpG or control ODN as detected by PCR.

IRAK1 and TRAF6 participate in the TLR9-dependent signaling cascade

DN forms of IRAK1 or TRAF6 inhibited TLR9-mediated luciferase activity in a dose-dependent manner (Fig. 3A). Although previous studies established that IRAK1 and TRAF6 were critical for CpG ODN-mediated cell signaling (8), current findings establish that their activation proceeds through TLR9 engagement. In contrast, cofactors known to stabilize cell membrane expression of other members of the TLR family, such as MD1 and MD2 (13), did not influence CpG ODN-mediated activation of 293^Trans (data not shown).

View larger version (21K): [in this window] [in a new window]   FIGURE 3. CpG ODN-mediated TLR9 signaling. A, The 293 cells were cotransfected with p5xNF-B-luc, TLR9, and varying amounts of DN IRAK1 or TRAF6 plus vector to yield a constant 0.8 µg DNA/reaction. Data show luciferase activity 24 h after incubation in medium () or 1 µM CpG ODN (). B, Same as in A except 293 cells were cotransfected with p5xNF-B-luc, TLR9/B, and/or 0.2–0.8 µg of ICD-deleted TLR9 mutants (5 del or ICD del). The diagram shows TLR9 and truncation mutants. SP, signal peptide; TMD, transmembrane domain. Results represent the mean + SEM of three independent experiments; *, p 0.05, and **, p 0.01 compared with cells transfected with TLR9 alone.

To identify those regions of the TLR9 molecule critical to cell signaling, deletion mutants were generated (Fig. 3B). Cells transfected with TLR9B (lacking the NH₂-portion of TLR9; Ref. 12) did not respond to CpG ODN (Fig. 3B). As expected, eliminating the entire ICD also abrogated CpG ODN-mediated NF-B activation (Fig. 3B). Interestingly, a TLR9 construct lacking only the C-terminal 32 amino acids of the ICD was also inactive, suggesting that this region plays a critical role in cell signaling.

Because eliminating the extracellular domain (ECD) can constitutively activate TLRs (14), 293 cells were cotransfected with TLR9 plus an ICD deletion mutant to examine the contribution of the ECD to TLR9-mediated signaling/activation. CpG ODN-dependent cellular activation was suppressed in a dose-dependent fashion by both the 5 and ICD deletion mutants (Fig. 3B). This effect was most likely mediated by ECD interactions, because cotransfection did not alter TLR9 mRNA expression (data not shown). Thus, similar to other members of the TLR family, TLR9 signaling appears to involve the generation of multimers through ECD interactions (15, 16).

Cellular localization of CpG ODN and TLR9

Several members of the TLR family are expressed on the plasma membrane (13, 17). Signaling through TLR2 involves the redistribution of the receptor from the membrane into phagosomal vesicles (17). Although uptake by acidified endocytic vesicles may be required for CpG-mediated signaling (18, 19), recent reports suggest that CpG ODN can bind to the plasma membrane and need not be internalized to trigger (20).

To examine the relationship between CpG binding, endocytosis, and signaling, a TLR9 construct encoding a HA tag (HA-TLR9) was generated. Cells transfected with HA-TLR9 specifically bound FITC-anti-HA Ab (Fig. 4A) and activated NF-B in response to CpG but not control ODN (data not shown). Cell surface staining of HA-TLR9 transfectants showed that a fraction of the TLR9 is on the cell surface (data not shown). Because transfected 293T cells over-express HA-TLR9, the location of this molecule under physiologic conditions requires further study.

View larger version (38K): [in this window] [in a new window]   FIGURE 4. Cellular localization of TLR9 and CpG ODN. The 293T cells were transfected with HA-TLR9 (A and B), vector (C and D), or HA-TLR9 ICD deletion mutant (E and F) and treated for 2 h with Cy3-CpG ODN (red; A, C, and E) or Cy3-control ODN (B, D, and F). Cells were then fixed, stained with FITC-conjugated anti-HA Ab (green), and analyzed by confocal microscopy. Arrows show larger yellow/orange vesicles, indicating colocalization; and arrowheads show smaller, more peripheral red vesicles. Representative sections from one of six independent experiments (magnification, x1000) are shown.

Control (non-CpG) ODN also rapidly gained access to the nucleus and formed small vesicles near the surface of HA-TLR9-transfected cells. However, these vesicles did not change in size or number over time, nor did they relocate within the cell (Fig. 4B). Similarly, ODN reached the nucleus of cells transfected with vector alone, but induced minimal vesicle formation (Fig. 4, C and D). Thus, cells that lack TLR9 can internalize DNA in a sequence-nonspecific manner, but TLR9 enhances vesicular uptake, vesicle relocation, and cellular activation in the presence of CpG motifs.

To verify these conclusions, 293T cells were transiently transfected with HA-TLR9 ICD deletion mutant, a mutant TLR9 lacking the cytoplasmic tail. This mutant does not signal, instead acting as a DN when coexpressed with hTLR9 (Fig. 3). Similar to vector-transfected cells, ODN gained access to the nucleus but formed only small peripheral vesicles in cells transfected with the HA-TLR9 ICD deletion mutant (Fig. 4, E and F). Prolonged incubation did not increase in the number or size of CpG-containing vesicles and rarely triggered their relocation. Thus, cellular activation through TLR9 was linked to enhanced vesicular uptake of CpG ODN.

Conclusions

This work provides three fundamental insights into the role of hTLR9 in CpG-mediated activation of human cells. First, expression of TLR9 is a prerequisite for CpG ODN responsiveness. This supports and extends observations in mice that TLR9 plays a critical role in CpG recognition (7). Our results demonstrate that hTLR9 is a cell surface receptor expressed by CpG-responsive cells, and that hTLR9 transfection confers CpG reactivity to cells that are otherwise nonresponsive. Second, hTLR9 enhances vesicular uptake of CpG but not control ODN. In some cases, TLR9 and CpG ODN colocalize within the same vesicles. Although ODN enters cells that lack TLR9 (or express signal-defective TLR9 mutants), this uptake is sequence independent and does not influence vesicle formation. Together, these observations suggest that vesicular uptake of CpG ODN is associated with cell signaling. Third, the recognition of CpG DNA by hTLR9 is exquisitely sequence specific. Eliminating the CpG dinucleotide by inversion or methylation abrogates responsiveness. Moreover, the CpG flanking region determines whether an ODN will activate human cells, and concomitantly, whether it will trigger through hTLR9. These findings suggest that species-specific differences in the recognition of bacterial DNA evolved through diversification of TLR9.

	Footnotes

 
¹ This work was supported in part by a grant from the National Vaccine Program and by Military Interdepartmental Purchase Request MM8926. The assertions herein are the private ones of the authors and are not to be construed as official or as reflecting the views of the Food and Drug Administration at large.

² F.T. and C.A.L. contributed equally to this work.

³ Current address: Department of Microbiology, National Institute of Infectious Diseases, 4-2-1 Aoba-cho, Higashimurayama, Tokyo 189-002, Japan.

⁴ Address correspondence and reprint requests to Dr. Dennis M. Klinman, Building 29A, Room 3 D 10, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892. E-mail address: Klinman{at}cber.fda.gov

⁵ Abbreviations used in this paper: TLR, Toll-like receptor; IRAK, IL-1R-associated kinase; TRAF6, TNFR-associated factor 6; ODN, oligodeoxynucleotides; hTLR9, human TLR9; DN, dominant negative; HA, hemagglutinin; ICD, intracellular domain; ECD, extracellular domain.

Received for publication April 4, 2001. Accepted for publication August 6, 2001.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Medzhitov, R., C. A. Janeway. 1998. Innate immunity: the virtues of a nonclonal system of recognition. Cell 91:295.
2. Aderem, A., R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782.[Medline]
3. Krieg, A. M., A. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
4. Bird, A. P.. 1987. CpG-rich islands and the function of DNA methylation. Trends Genet. 3:342.
5. Klinman, D. M., A. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12 and IFN. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
6. Klinman, D. M.. 1998. Therapeutic applications of CpG-containing oligodeoxynucleotides. Antisense Nucleic Acid Drug Dev. 8:181.[Medline]
7. Hemmi, H., O. Takeuchi, T. Kawai, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
8. Hacker, H., R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, H. Wagner. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF)6. J. Exp. Med. 192:595.[Abstract/Free Full Text]
9. Hartmann, G., A. M. Krieg. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164:944.[Abstract/Free Full Text]
10. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, D. M. Klinman. 2001. Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs. J. Immunol. 166:2372.[Abstract/Free Full Text]
11. Hartmann, G., R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldshmidt, D. Sajuthi, R. H. Purcell, H. L. Davis, A. M. Krieg. 2000. Delineation of a CpG phosphorothioate oligodeoxinucleotide for activating primate immune responses in vitro and in vivo. J. Immunol. 164:1617.[Abstract/Free Full Text]
12. Du, X., A. Poltorak, Y. Wei, B. Beutler. 2000. Three novel mammalian Toll-like receptors: gene structure, expression, and evolution. Eur. Cytokine Netw. 11:362.[Medline]
13. Shimazu, R., S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, M. Kimoto. 1999. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J. Exp. Med. 189:1777.[Abstract/Free Full Text]
14. Medzhitov, R., P. Preston, C. A. Janeway. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394.[Medline]
15. Hajjar, A. M., D. S. O’Mahony, A. Ozinsky, D. M. Underhill, A. Aderem, S. J. Klebanoff, C. B. Wilson. 2001. Functional interactions between Toll-like receptor (TLR) 2 and TLR1 or TLR6 in response to phenol-soluble modulin. J. Immunol. 166:15.[Abstract/Free Full Text]
16. Willie, D. H., E. Kiss-Toth, A. Visintin, S. C. Smith, S. Boussouf, D. M. Segal, G. W. Duff, S. K. Dower. 2000. Evidence for an accessory protein function for Toll-like receptor 1 in antibacterial responses. J. Immunol. 165:7125.[Abstract/Free Full Text]
17. Underhill, D. M., A. Ozinski, A. M. Hajjar, A. Stevens, C. B. Wilson, M. Bassetti, A. Aderem. 1999. The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 401:811.[Medline]
18. Yi, A., R. Tuetken, T. Redford, M. Waldschmidt, J. Kirsch, A. M. Krieg. 1998. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.[Abstract/Free Full Text]
19. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, H. Wagner. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17:6230.[Medline]
20. Liang, H., Y. Nishioka, C. F. Reich, D. S. Pisetsky, H. Wagner, K. Heeg. 1996. Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin. Invest. 98:1119.[Medline]

This article has been cited by other articles:

				C. Berchtold, K. Panthel, S. Jellbauer, B. Kohn, E. Roider, M. Partilla, J. Heesemann, S. Endres, C. Bourquin, and H. Russmann Superior Protective Immunity against Murine Listeriosis by Combined Vaccination with CpG DNA and Recombinant Salmonella enterica Serovar Typhimurium Infect. Immun., December 1, 2009; 77(12): 5501 - 5508. [Abstract] [Full Text] [PDF]

				L.-Y. Huang, J. L. DuMontelle, M. Zolodz, A. Deora, N. M. Mozier, and B. Golding Use of Toll-Like Receptor Assays To Detect and Identify Microbial Contaminants in Biological Products J. Clin. Microbiol., November 1, 2009; 47(11): 3427 - 3434. [Abstract] [Full Text] [PDF]

				L. Gil, C. Lopez, L. Lazo, I. Valdes, E. Marcos, R. Alonso, A. Gambe, J. Martin, Y. Romero, M. G. Guzman, et al. Recombinant nucleocapsid-like particles from dengue-2 virus induce protective CD4+ and CD8+ cells against viral encephalitis in mice Int. Immunol., October 1, 2009; 21(10): 1175 - 1183. [Abstract] [Full Text] [PDF]

				S. Kippenberger, J. Muller, M. Schultz, A. Dorn, A. Bock, H. Aygun, D. Thaci, M. Hofmann, R. Kaufmann, and A. Bernd Oligonucleotides suppress PKB/Akt and act as superinductors of apoptosis in human keratinocytes Nucleic Acids Res., July 1, 2009; 37(12): 3850 - 3864. [Abstract] [Full Text] [PDF]

				G. Chikh, S. D. de Jong, L. Sekirov, S. G. Raney, M. Kazem, K. D. Wilson, P. R. Cullis, J. P. Dutz, and Y. K. Tam Synthetic methylated CpG ODNs are potent in vivo adjuvants when delivered in liposomal nanoparticles Int. Immunol., July 1, 2009; 21(7): 757 - 767. [Abstract] [Full Text] [PDF]

				S. Klaschik, D. Tross, and D. M. Klinman Inductive and suppressive networks regulate TLR9-dependent gene expression in vivo J. Leukoc. Biol., May 1, 2009; 85(5): 788 - 795. [Abstract] [Full Text] [PDF]

				W. Chen, X. Liang, A. J. Peterson, D. H. Munn, and B. R. Blazar The Indoleamine 2,3-Dioxygenase Pathway Is Essential for Human Plasmacytoid Dendritic Cell-Induced Adaptive T Regulatory Cell Generation J. Immunol., October 15, 2008; 181(8): 5396 - 5404. [Abstract] [Full Text] [PDF]

				D. Tross and D. M. Klinman Effect of CpG Oligonucleotides on Vaccine-Induced B Cell Memory J. Immunol., October 15, 2008; 181(8): 5785 - 5790. [Abstract] [Full Text] [PDF]

				D. Klinman, H. Shirota, D. Tross, T. Sato, and S. Klaschik Synthetic oligonucleotides as modulators of inflammation J. Leukoc. Biol., October 1, 2008; 84(4): 958 - 964. [Abstract] [Full Text] [PDF]

				J. M. Ilvesaro, M. A. Merrell, L. Li, S. Wakchoure, D. Graves, S. Brooks, E. Rahko, A. Jukkola-Vuorinen, K. S. Vuopala, K. W. Harris, et al. Toll-Like Receptor 9 Mediates CpG Oligonucleotide-Induced Cellular Invasion Mol. Cancer Res., October 1, 2008; 6(10): 1534 - 1543. [Abstract] [Full Text] [PDF]

				U. Bhan, N. W. Lukacs, J. J. Osterholzer, M. W. Newstead, X. Zeng, T. A. Moore, T. R. McMillan, A. M. Krieg, S. Akira, and T. J. Standiford TLR9 Is Required for Protective Innate Immunity in Gram-Negative Bacterial Pneumonia: Role of Dendritic Cells J. Immunol., September 15, 2007; 179(6): 3937 - 3946. [Abstract] [Full Text] [PDF]

				S. Saha, F. Takeshita, T. Matsuda, N. Jounai, K. Kobiyama, T. Matsumoto, S. Sasaki, A. Yoshida, K.-Q. Xin, D. M. Klinman, et al. Blocking of the TLR5 Activation Domain Hampers Protective Potential of Flagellin DNA Vaccine J. Immunol., July 15, 2007; 179(2): 1147 - 1154. [Abstract] [Full Text] [PDF]

				G. Alter, T. J. Suscovich, N. Teigen, A. Meier, H. Streeck, C. Brander, and M. Altfeld Single-Stranded RNA Derived from HIV-1 Serves as a Potent Activator of NK Cells J. Immunol., June 15, 2007; 178(12): 7658 - 7666. [Abstract] [Full Text] [PDF]

				K. Schroder, M. Lichtinger, K. M. Irvine, K. Brion, A. Trieu, I. L. Ross, T. Ravasi, K. J. Stacey, M. Rehli, D. A. Hume, et al. PU.1 and ICSBP control constitutive and IFN-{gamma}-regulated Tlr9 gene expression in mouse macrophages J. Leukoc. Biol., June 1, 2007; 81(6): 1577 - 1590. [Abstract] [Full Text] [PDF]

				J. Kindrachuk, J. E. Potter, R. Brownlie, A. D. Ficzycz, P. J. Griebel, N. Mookherjee, G. K. Mutwiri, L. A. Babiuk, and S. Napper Nucleic Acids Exert a Sequence-independent Cooperative Effect on Sequence-dependent Activation of Toll-like Receptor 9 J. Biol. Chem., May 11, 2007; 282(19): 13944 - 13953. [Abstract] [Full Text] [PDF]

				J. B. Ewaschuk, J. L. Backer, T. A. Churchill, F. Obermeier, D. O. Krause, and K. L. Madsen Surface Expression of Toll-Like Receptor 9 Is Upregulated on Intestinal Epithelial Cells in Response to Pathogenic Bacterial DNA Infect. Immun., May 1, 2007; 75(5): 2572 - 2579. [Abstract] [Full Text] [PDF]

				A. Ertesvag, H.-C. Aasheim, S. Naderi, and H. K. Blomhoff Vitamin A potentiates CpG-mediated memory B-cell proliferation and differentiation: involvement of early activation of p38MAPK Blood, May 1, 2007; 109(9): 3865 - 3872. [Abstract] [Full Text] [PDF]

				S. Hamm, A. Heit, M. Koffler, K. M. Huster, S. Akira, D. H. Busch, H. Wagner, and S. Bauer Immunostimulatory RNA is a potent inducer of antigen-specific cytotoxic and humoral immune response in vivo Int. Immunol., March 1, 2007; 19(3): 297 - 304. [Abstract] [Full Text] [PDF]

				C. A. Leifer, J. C. Brooks, K. Hoelzer, J. Lopez, M. N. Kennedy, A. Mazzoni, and D. M. Segal Cytoplasmic Targeting Motifs Control Localization of Toll-like Receptor 9 J. Biol. Chem., November 17, 2006; 281(46): 35585 - 35592. [Abstract] [Full Text] [PDF]

				M. Gursel, I. Gursel, H. S. Mostowski, and D. M. Klinman CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation J. Immunol., August 1, 2006; 177(3): 1575 - 1580. [Abstract] [Full Text] [PDF]

				J. Wang, H. Zhou, J. Zheng, J. Cheng, W. Liu, G. Ding, L. Wang, P. Luo, Y. Lu, H. Cao, et al. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release. Antimicrob. Agents Chemother., July 1, 2006; 50(7): 2420 - 2427. [Abstract] [Full Text] [PDF]

				A. Sato, M. Ohtsuki, M. Hata, E. Kobayashi, and T. Murakami Antitumor Activity of IFN-{lambda} in Murine Tumor Models. J. Immunol., June 15, 2006; 176(12): 7686 - 7694. [Abstract] [Full Text] [PDF]

				Y. Adachi, A. L. Kindzelskii, A. R. Petty, J.-B. Huang, N. Maeda, S. Yotsumoto, Y. Aratani, N. Ohno, and H. R. Petty IFN-{gamma} Primes RAW264 Macrophages and Human Monocytes for Enhanced Oxidant Production in Response to CpG DNA via Metabolic Signaling: Roles of TLR9 and Myeloperoxidase Trafficking. J. Immunol., April 15, 2006; 176(8): 5033 - 5040. [Abstract] [Full Text] [PDF]

				M. Suzuki, K. Kasai, and Y. Saeki Plasmid DNA sequences present in conventional herpes simplex virus amplicon vectors cause rapid transgene silencing by forming inactive chromatin. J. Virol., April 1, 2006; 80(7): 3293 - 3300. [Abstract] [Full Text] [PDF]

				T. Querec, S. Bennouna, S. Alkan, Y. Laouar, K. Gorden, R. Flavell, S. Akira, R. Ahmed, and B. Pulendran Yellow fever vaccine YF-17D activates multiple dendritic cell subsets via TLR2, 7, 8, and 9 to stimulate polyvalent immunity J. Exp. Med., February 21, 2006; 203(2): 413 - 424. [Abstract] [Full Text] [PDF]

				A. Dalpke, J. Frank, M. Peter, and K. Heeg Activation of Toll-Like Receptor 9 by DNA from Different Bacterial Species Infect. Immun., February 1, 2006; 74(2): 940 - 946. [Abstract] [Full Text] [PDF]

				C. Mayr, M. R. Speicher, D. M. Kofler, R. Buhmann, J. Strehl, R. Busch, M. Hallek, and C.-M. Wendtner Chromosomal translocations are associated with poor prognosis in chronic lymphocytic leukemia Blood, January 15, 2006; 107(2): 742 - 751. [Abstract] [Full Text] [PDF]

				T. P. Carroll, C. M. Greene, C. C. Taggart, A. G. Bowie, S. J. O'Neill, and N. G. McElvaney Viral Inhibition of IL-1- and Neutrophil Elastase-Induced Inflammatory Responses in Bronchial Epithelial Cells J. Immunol., December 1, 2005; 175(11): 7594 - 7601. [Abstract] [Full Text] [PDF]

				J. M. Kim, N. I. Kim, Y.-K. Oh, Y.-J. Kim, J. Youn, and M.-J. Ahn CpG oligodeoxynucleotides induce IL-8 expression in CD34+ cells via mitogen-activated protein kinase-dependent and NF-{kappa}B-independent pathways Int. Immunol., December 1, 2005; 17(12): 1525 - 1531. [Abstract] [Full Text] [PDF]

				S. B. Su, P. B. Silver, R. S. Grajewski, R. K. Agarwal, J. Tang, C.-C. Chan, and R. R. Caspi Essential Role of the MyD88 Pathway, but Nonessential Roles of TLRs 2, 4, and 9, in the Adjuvant Effect Promoting Th1-Mediated Autoimmunity J. Immunol., November 15, 2005; 175(10): 6303 - 6310. [Abstract] [Full Text] [PDF]

				A. Fedulov, E. Silverman, Y. Xiang, A. Leme, and L. Kobzik Immunostimulatory CpG Oligonucleotides Abrogate Allergic Susceptibility in a Murine Model of Maternal Asthma Transmission J. Immunol., October 1, 2005; 175(7): 4292 - 4300. [Abstract] [Full Text] [PDF]

				L.-Y. Huang, K. J. Ishii, S. Akira, J. Aliberti, and B. Golding Th1-Like Cytokine Induction by Heat-Killed Brucella abortus Is Dependent on Triggering of TLR9 J. Immunol., September 15, 2005; 175(6): 3964 - 3970. [Abstract] [Full Text] [PDF]

				C. Coban, K. J. Ishii, M. Gursel, D. M. Klinman, and N. Kumar Effect of plasmid backbone modification by different human CpG motifs on the immunogenicity of DNA vaccine vectors J. Leukoc. Biol., September 1, 2005; 78(3): 647 - 655. [Abstract] [Full Text] [PDF]

				M. Blank and Y. Shoenfeld Experimental models of systemic lupus erythematosus: anti-dsDNA in murine lupus Rheumatology, September 1, 2005; 44(9): 1086 - 1089. [Full Text] [PDF]

				S. Ito, K. J. Ishii, A. Ihata, and D. M. Klinman Contribution of Nitric Oxide to CpG-Mediated Protection against Listeria monocytogenes Infect. Immun., June 1, 2005; 73(6): 3803 - 3805. [Abstract] [Full Text] [PDF]

				Y. Maeda, T. Mukai, J. Spencer, and M. Makino Identification of an Immunomodulating Agent from Mycobacterium leprae Infect. Immun., May 1, 2005; 73(5): 2744 - 2750. [Abstract] [Full Text] [PDF]

				R. F. Ashman, J. A. Goeken, J. Drahos, and P. Lenert Sequence requirements for oligodeoxyribonucleotide inhibitory activity Int. Immunol., April 1, 2005; 17(4): 411 - 420. [Abstract] [Full Text] [PDF]

				I. B. Bekeredjian-Ding, M. Wagner, V. Hornung, T. Giese, M. Schnurr, S. Endres, and G. Hartmann Plasmacytoid Dendritic Cells Control TLR7 Sensitivity of Naive B Cells via Type I IFN J. Immunol., April 1, 2005; 174(7): 4043 - 4050. [Abstract] [Full Text] [PDF]

				T. Sugiyama, M. Gursel, F. Takeshita, C. Coban, J. Conover, T. Kaisho, S. Akira, D. M. Klinman, and K. J. Ishii CpG RNA: Identification of Novel Single-Stranded RNA That Stimulates Human CD14+CD11c+ Monocytes J. Immunol., February 15, 2005; 174(4): 2273 - 2279. [Abstract] [Full Text] [PDF]

				B. Jahrsdorfer, L. Muhlenhoff, S. E. Blackwell, M. Wagner, H. Poeck, E. Hartmann, R. Jox, T. Giese, B. Emmerich, S. Endres, et al. B-Cell Lymphomas Differ in their Responsiveness to CpG Oligodeoxynucleotides Clin. Cancer Res., February 15, 2005; 11(4): 1490 - 1499. [Abstract] [Full Text] [PDF]

				T. L. Roberts, M. J. Sweet, D. A. Hume, and K. J. Stacey Cutting Edge: Species-Specific TLR9-Mediated Recognition of CpG and Non-CpG Phosphorothioate-Modified Oligonucleotides J. Immunol., January 15, 2005; 174(2): 605 - 608. [Abstract] [Full Text] [PDF]

				S. Ito, K. J. Ishii, M. Gursel, H. Shirotra, A. Ihata, and D. M. Klinman CpG Oligodeoxynucleotides Enhance Neonatal Resistance to Listeria Infection J. Immunol., January 15, 2005; 174(2): 777 - 782. [Abstract] [Full Text] [PDF]

				K. U. Saikh, T. L. Kissner, A. Sultana, G. Ruthel, and R. G. Ulrich Human Monocytes Infected with Yersinia pestis Express Cell Surface TLR9 and Differentiate into Dendritic Cells J. Immunol., December 15, 2004; 173(12): 7426 - 7434. [Abstract] [Full Text] [PDF]

				R. Schindler, W. Beck, R. Deppisch, M. Aussieker, A. Wilde, H. Gohl, and U. Frei Short Bacterial DNA Fragments: Detection in Dialysate and Induction of Cytokines J. Am. Soc. Nephrol., December 1, 2004; 15(12): 3207 - 3214. [Abstract] [Full Text] [PDF]

				Y. J. Chang, M. S. Wu, J. T. Lin, B. S. Sheu, T. Muta, H. Inoue, and C.-C. Chen Induction of Cyclooxygenase-2 Overexpression in Human Gastric Epithelial Cells by Helicobacter pylori Involves TLR2/TLR9 and c-Src-Dependent Nuclear Factor-{kappa}B Activation Mol. Pharmacol., December 1, 2004; 66(6): 1465 - 1477. [Abstract] [Full Text] [PDF]

				H. Shirota, M. Gursel, and D. M. Klinman Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling J. Immunol., October 15, 2004; 173(8): 5002 - 5007. [Abstract] [Full Text] [PDF]

				J. Vollmer, R. D. Weeratna, M. Jurk, H. L. Davis, C. Schetter, M. Wullner, T. Wader, M. Liu, A. Kritzler, and A. M. Krieg Impact of modifications of heterocyclic bases in CpG dinucleotides on their immune-modulatory activity J. Leukoc. Biol., September 1, 2004; 76(3): 585 - 593. [Abstract] [Full Text] [PDF]

				J. Li, Z. Ma, Z.-L. Tang, T. Stevens, B. Pitt, and S. Li CpG DNA-mediated immune response in pulmonary endothelial cells Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L552 - L558. [Abstract] [Full Text] [PDF]

				F. Takeshita, K. Suzuki, S. Sasaki, N. Ishii, D. M. Klinman, and K. J. Ishii Transcriptional Regulation of the Human TLR9 Gene J. Immunol., August 15, 2004; 173(4): 2552 - 2561. [Abstract] [Full Text] [PDF]

				C. C. N. Wu, J. Lee, E. Raz, M. Corr, and D. A. Carson Necessity of Oligonucleotide Aggregation for Toll-like Receptor 9 Activation J. Biol. Chem., August 6, 2004; 279(32): 33071 - 33078. [Abstract] [Full Text] [PDF]

				C. A. Leifer, M. N. Kennedy, A. Mazzoni, C. Lee, M. J. Kruhlak, and D. M. Segal TLR9 Is Localized in the Endoplasmic Reticulum Prior to Stimulation J. Immunol., July 15, 2004; 173(2): 1179 - 1183. [Abstract] [Full Text] [PDF]

				J. Platz, C. Beisswenger, A. Dalpke, R. Koczulla, O. Pinkenburg, C. Vogelmeier, and R. Bals Microbial DNA Induces a Host Defense Reaction of Human Respiratory Epithelial Cells J. Immunol., July 15, 2004; 173(2): 1219 - 1223. [Abstract] [Full Text] [PDF]

				S. Sivori, M. Falco, M. D. Chiesa, S. Carlomagno, M. Vitale, L. Moretta, and A. Moretta CpG and double-stranded RNA trigger human NK cells by Toll-like receptors: Induction of cytokine release and cytotoxicity against tumors and dendritic cells PNAS, July 6, 2004; 101(27): 10116 - 10121. [Abstract] [Full Text] [PDF]

				S.-i. Ito, K. J. Ishii, H. Shirota, and D. M. Klinman CpG Oligodeoxynucleotides Improve the Survival of Pregnant and Fetal Mice following Listeria monocytogenes Infection Infect. Immun., June 1, 2004; 72(6): 3543 - 3548. [Abstract] [Full Text] [PDF]

				H. Tsujimura, T. Tamura, H. J. Kong, A. Nishiyama, K. J. Ishii, D. M. Klinman, and K. Ozato Toll-Like Receptor 9 Signaling Activates NF-{kappa}B through IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein in Dendritic Cells J. Immunol., June 1, 2004; 172(11): 6820 - 6827. [Abstract] [Full Text] [PDF]

				R. M. Cisco, Z. Abdel-Wahab, J. Dannull, S. Nair, D. S. Tyler, E. Gilboa, J. Vieweg, Y. Daaka, and S. K. Pruitt Induction of Human Dendritic Cell Maturation Using Transfection with RNA Encoding a Dominant Positive Toll-Like Receptor 4 J. Immunol., June 1, 2004; 172(11): 7162 - 7168. [Abstract] [Full Text] [PDF]

				C. Scheller, A. Ullrich, K. McPherson, B. Hefele, J. Knoferle, S. Lamla, A. R. M. Olbrich, H. Stocker, K. Arasteh, V. t. Meulen, et al. CpG Oligodeoxynucleotides Activate HIV Replication in Latently Infected Human T Cells J. Biol. Chem., May 21, 2004; 279(21): 21897 - 21902. [Abstract] [Full Text] [PDF]

				H. Poeck, M. Wagner, J. Battiany, S. Rothenfusser, D. Wellisch, V. Hornung, B. Jahrsdorfer, T. Giese, S. Endres, and G. Hartmann Plasmacytoid dendritic cells, antigen, and CpG-C license human B cells for plasma cell differentiation and immunoglobulin production in the absence of T-cell help Blood, April 15, 2004; 103(8): 3058 - 3064. [Abstract] [Full Text] [PDF]

				S. Cornelie, J. Hoebeke, A.-M. Schacht, B. Bertin, J. Vicogne, M. Capron, and G. Riveau Direct Evidence that Toll-like Receptor 9 (TLR9) Functionally Binds Plasmid DNA by Specific Cytosine-phosphate-guanine Motif Recognition J. Biol. Chem., April 9, 2004; 279(15): 15124 - 15129. [Abstract] [Full Text] [PDF]

				T. Storni, C. Ruedl, K. Schwarz, R. A. Schwendener, W. A. Renner, and M. F. Bachmann Nonmethylated CG Motifs Packaged into Virus-Like Particles Induce Protective Cytotoxic T Cell Responses in the Absence of Systemic Side Effects J. Immunol., February 1, 2004; 172(3): 1777 - 1785. [Abstract] [Full Text] [PDF]

				M. Wagner, H. Poeck, B. Jahrsdoerfer, S. Rothenfusser, D. Prell, B. Bohle, E. Tuma, T. Giese, J. W. Ellwart, S. Endres, et al. IL-12p70-Dependent Th1 Induction by Human B Cells Requires Combined Activation with CD40 Ligand and CpG DNA J. Immunol., January 15, 2004; 172(2): 954 - 963. [Abstract] [Full Text] [PDF]

				C. Coban, K. J. Ishii, A. W. Stowers, D. B. Keister, D. M. Klinman, and N. Kumar Effect of CpG Oligodeoxynucleotides on the Immunogenicity of Pfs25, a Plasmodium falciparum Transmission-Blocking Vaccine Antigen Infect. Immun., January 1, 2004; 72(1): 584 - 588. [Abstract] [Full Text] [PDF]

				T. Goldammer, H. Zerbe, A. Molenaar, H.-J. Schuberth, R. M. Brunner, S. R. Kata, and H.-M. Seyfert Mastitis Increases Mammary mRNA Abundance of {beta}-Defensin 5, Toll-Like-Receptor 2 (TLR2), and TLR4 but Not TLR9 in Cattle Clin. Vaccine Immunol., January 1, 2004; 11(1): 174 - 185. [Abstract] [Full Text] [PDF]

				P. Lundberg, P. Welander, X. Han, and E. Cantin Herpes Simplex Virus Type 1 DNA Is Immunostimulatory In Vitro and In Vivo J. Virol., October 15, 2003; 77(20): 11158 - 11169. [Abstract] [Full Text] [PDF]

				H. Xu, H. An, Y. Yu, M. Zhang, R. Qi, and X. Cao Ras Participates in CpG Oligodeoxynucleotide Signaling through Association with Toll-like Receptor 9 and Promotion of Interleukin-1 Receptor-associated Kinase/Tumor Necrosis Factor Receptor-associated Factor 6 Complex Formation in Macrophages J. Biol. Chem., September 19, 2003; 278(38): 36334 - 36340. [Abstract] [Full Text] [PDF]

				I. Gursel, M. Gursel, H. Yamada, K. J. Ishii, F. Takeshita, and D. M. Klinman Repetitive Elements in Mammalian Telomeres Suppress Bacterial DNA-Induced Immune Activation J. Immunol., August 1, 2003; 171(3): 1393 - 1400. [Abstract] [Full Text] [PDF]

				L.-Y. Huang, J. Aliberti, C. A. Leifer, D. M. Segal, A. Sher, D. T. Golenbock, and B. Golding Heat-Killed Brucella abortus Induces TNF and IL-12p40 by Distinct MyD88-Dependent Pathways: TNF, Unlike IL-12p40 Secretion, Is Toll-Like Receptor 2 Dependent J. Immunol., August 1, 2003; 171(3): 1441 - 1446. [Abstract] [Full Text] [PDF]

				E. Bourke, D. Bosisio, J. Golay, N. Polentarutti, and A. Mantovani The toll-like receptor repertoire of human B lymphocytes: inducible and selective expression of TLR9 and TLR10 in normal and transformed cells Blood, August 1, 2003; 102(3): 956 - 963. [Abstract] [Full Text] [PDF]

				T. J. Kemp, B. D. Elzey, and T. S. Griffith Plasmacytoid Dendritic Cell-Derived IFN-{alpha} Induces TNF-Related Apoptosis-Inducing Ligand/Apo-2L-Mediated Antitumor Activity by Human Monocytes Following CpG Oligodeoxynucleotide Stimulation J. Immunol., July 1, 2003; 171(1): 212 - 218. [Abstract] [Full Text] [PDF]

				N. L. Bernasconi, N. Onai, and A. Lanzavecchia A role for Toll-like receptors in acquired immunity: up-regulation of TLR9 by BCR triggering in naive B cells and constitutive expression in memory B cells Blood, June 1, 2003; 101(11): 4500 - 4504. [Abstract] [Full Text] [PDF]

				U. Kumaraguru, C. D. Pack, and B. T. Rouse Toll-like receptor ligand links innate and adaptive immune responses by the production of heat-shock proteins J. Leukoc. Biol., May 1, 2003; 73(5): 574 - 583. [Abstract] [Full Text] [PDF]

				A.-K. Yi, J.-G. Yoon, and A. M. Krieg Convergence of CpG DNA- and BCR-mediated signals at the c-Jun N-terminal kinase and NF-{kappa}B activation pathways: regulation by mitogen-activated protein kinases Int. Immunol., May 1, 2003; 15(5): 577 - 591. [Abstract] [Full Text] [PDF]

				D. Verthelyi, M. Gursel, R. T. Kenney, J. D. Lifson, S. Liu, J. Mican, and D. M. Klinman CpG Oligodeoxynucleotides Protect Normal and SIV-Infected Macaques from Leishmania Infection J. Immunol., May 1, 2003; 170(9): 4717 - 4723. [Abstract] [Full Text] [PDF]

				S. E. Blackwell and A. M. Krieg CpG-A-Induced Monocyte IFN-{gamma}-Inducible Protein-10 Production Is Regulated by Plasmacytoid Dendritic Cell-Derived IFN-{alpha} J. Immunol., April 15, 2003; 170(8): 4061 - 4068. [Abstract] [Full Text] [PDF]

				H. Hemmi, T. Kaisho, K. Takeda, and S. Akira The Roles of Toll-Like Receptor 9, MyD88, and DNA-Dependent Protein Kinase Catalytic Subunit in the Effects of Two Distinct CpG DNAs on Dendritic Cell Subsets J. Immunol., March 15, 2003; 170(6): 3059 - 3064. [Abstract] [Full Text] [PDF]

				K. Sano, H. Shirota, T. Terui, T. Hattori, and G. Tamura Oligodeoxynucleotides Without CpG Motifs Work as Adjuvant for the Induction of Th2 Differentiation in a Sequence-Independent Manner J. Immunol., March 1, 2003; 170(5): 2367 - 2373. [Abstract] [Full Text] [PDF]

				J. E. Butler, P. Weber, M. Sinkora, D. Baker, A. Schoenherr, B. Mayer, and D. Francis Antibody Repertoire Development in Fetal and Neonatal Piglets. VIII. Colonization Is Required for Newborn Piglets to Make Serum Antibodies to T-Dependent and Type 2 T-Independent Antigens J. Immunol., December 15, 2002; 169(12): 6822 - 6830. [Abstract] [Full Text] [PDF]

				H. Yamada, I. Gursel, F. Takeshita, J. Conover, K. J. Ishii, M. Gursel, S. Takeshita, and D. M. Klinman Effect of Suppressive DNA on CpG-Induced Immune Activation J. Immunol., November 15, 2002; 169(10): 5590 - 5594. [Abstract] [Full Text] [PDF]

				S. Becker, M. J. Fenton, and J. M. Soukup Involvement of Microbial Components and Toll-like Receptors 2 And 4 in Cytokine Responses to Air Pollution Particles Am. J. Respir. Cell Mol. Biol., November 1, 2002; 27(5): 611 - 618. [Abstract] [Full Text] [PDF]

				R. B. Pyles, D. Higgins, C. Chalk, A. Zalar, J. Eiden, C. Brown, G. Van Nest, and L. R. Stanberry Use of Immunostimulatory Sequence-Containing Oligonucleotides as Topical Therapy for Genital Herpes Simplex Virus Type 2 Infection J. Virol., October 11, 2002; 76(22): 11387 - 11396. [Abstract] [Full Text] [PDF]

				S. S. Mambula, K. Sau, P. Henneke, D. T. Golenbock, and S. M. Levitz Toll-like Receptor (TLR) Signaling in Response to Aspergillus fumigatus J. Biol. Chem., October 11, 2002; 277(42): 39320 - 39326. [Abstract] [Full Text] [PDF]

				K. Heckelsmiller, K. Rall, S. Beck, A. Schlamp, J. Seiderer, B. Jahrsdorfer, A. Krug, S. Rothenfusser, S. Endres, and G. Hartmann Peritumoral CpG DNA Elicits a Coordinated Response of CD8 T Cells and Innate Effectors to Cure Established Tumors in a Murine Colon Carcinoma Model J. Immunol., October 1, 2002; 169(7): 3892 - 3899. [Abstract] [Full Text] [PDF]

				J. Jung, A.-K. Yi, X. Zhang, J. Choe, L. Li, and Y. S. Choi Distinct Response of Human B Cell Subpopulations in Recognition of an Innate Immune Signal, CpG DNA J. Immunol., September 1, 2002; 169(5): 2368 - 2373. [Abstract] [Full Text] [PDF]

				K. J. Ishii, F. Takeshita, I. Gursel, M. Gursel, J. Conover, A. Nussenzweig, and D. M. Klinman Potential Role of Phosphatidylinositol 3 Kinase, rather than DNA-dependent Protein Kinase, in CpG DNA-induced Immune Activation J. Exp. Med., July 15, 2002; 196(2): 269 - 274. [Abstract] [Full Text] [PDF]

				M. Zheng, D. M. Klinman, M. Gierynska, and B. T. Rouse DNA containing CpG motifs induces angiogenesis PNAS, June 25, 2002; 99(13): 8944 - 8949. [Abstract] [Full Text] [PDF]

				A. Campos-Neto, J. R. Webb, K. Greeson, R. N. Coler, Y. A. W. Skeiky, and S. G. Reed Vaccination with Plasmid DNA Encoding TSA/LmSTI1 Leishmanial Fusion Proteins Confers Protection against Leishmania major Infection in Susceptible BALB/c Mice Infect. Immun., June 1, 2002; 70(6): 2828 - 2836. [Abstract] [Full Text] [PDF]

				M. Gursel, D. Verthelyi, I. Gursel, K. J. Ishii, and D. M. Klinman Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide J. Leukoc. Biol., May 1, 2002; 71(5): 813 - 820. [Abstract] [Full Text] [PDF]

				D. Yu, E. R. Kandimalla, Q. Zhao, Y. Cong, and S. Agrawal Immunostimulatory properties of phosphorothioate CpG DNA containing both 3'-5'- and 2'-5'-internucleotide linkages Nucleic Acids Res., April 1, 2002; 30(7): 1613 - 1619. [Abstract] [Full Text] [PDF]

				D. Verthelyi, R. T. Kenney, R. A. Seder, A. A. Gam, B. Friedag, and D. M. Klinman CpG Oligodeoxynucleotides as Vaccine Adjuvants in Primates J. Immunol., February 15, 2002; 168(4): 1659 - 1663. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Takeshita, F. Articles by Klinman, D. M. Search for Related Content PubMed PubMed Citation Articles by Takeshita, F. Articles by Klinman, D. M.