The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sato, W.
Right arrow Articles by Muramatsu, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sato, W.
Right arrow Articles by Muramatsu, T.
The Journal of Immunology, 2001, 167: 3463-3469.
Copyright © 2001 by The American Association of Immunologists

Midkine Is Involved in Neutrophil Infiltration into the Tubulointerstitium in Ischemic Renal Injury1

Waichi Sato*,{dagger}, Kenji Kadomatsu{dagger}, Yukio Yuzawa*, Hisako Muramatsu{dagger}, Nigishi Hotta*, Seiichi Matsuo* and Takashi Muramatsu2,{dagger}

Departments of * Internal Medicine III and {dagger} Biochemistry, Nagoya University School of Medicine, Nagoya, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Midkine (MK) is a multifunctional heparin-binding protein and promotes migration of neutrophils, macrophages, and neurons. In the normal mouse kidney, MK is expressed in the proximal tubules. After renal ischemic reperfusion injury, its expression in proximal tubules was increased. Immediate increase of MK expression was found when renal proximal tubular epithelial cells in culture were exposed to 5 mM H2O2. Histologically defined tubulointerstitial damage was less severe in MK-deficient (Mdk-/-) than in wild-type (Mdk+/+) mice at 2 and 7 days after ischemic reperfusion injury. Within 2 days after ischemic injury, inflammatory leukocytes, of which neutrophils were the major population, were recruited to the tubulointerstitium. The numbers of infiltrating neutrophils and also macrophages were lower in Mdk-/- than in Mdk+/+ mice. Induction of macrophage inflammatory protein-2 and macrophage chemotactic protein-1, chemokines for neutrophils and macrophages, respectively, were also suppressed in Mdk-/- mice. Furthermore, renal tubular epithelial cells in culture expressed macrophage inflammatory protein-2 in response to exogenous MK administration. These results suggested that MK enhances migration of inflammatory cells upon ischemic injury of the kidney directly and also through induction of chemokines, and contributes to the augmentation of ischemic tissue damage.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tubulointerstitial injury is one of the most important histological parameters for progressive renal injury to predict renal outcome in various forms of glomerulonephritis as well as primary tubulointerstitial nephritis. In fact, several studies have demonstrated that the renal function and long-term prognosis are better correlated with the degree of tubulointerstitial damage than with the level of glomerular injury (1, 2).

Several immunological and nonimmunological mechanisms of progressive tubulointerstitial injury have been proposed, including autologous complement activation (3) in the renal parenchyma and the involvement of cytokines/chemokines, growth factors, and vasoactive mediators (4, 5, 6, 7, 8). The importance of tubular epithelial cells as regulators of tubulointerstitial inflammation and fibrosis has been revealed recently. Many observations have shown that the activated tubular epithelial cells, especially proximal tubular epithelial cells, have the potential to produce leukocyte adhesion molecules (4) and diverse cytokines/chemokines such as macrophage chemotactic protein-1 (MCP-1)3 (5), IL-8 (6), platelet-derived growth factor (7), and RANTES (8). All these factors might be directly or indirectly involved in the process of tubulointerstitial inflammation and fibrosis. However, the detailed mechanism of tubulointerstitial injury remains to be clarified.

Ischemic reperfusion injury (IRI) of the kidney is a good animal model of tubulointerstitial injury. Furthermore, it is one of the main causes of acute renal failure in humans, which is the most costly kidney-related illness requiring admission to a hospital (9, 10). Renal ischemia has been shown to be a potent stimulus resulting in activation of tubular epithelial cells and leukocyte infiltration into the tubulointerstitium, with concomitant expression of ICAM-1 in these cells (11).

In this study, we demonstrated that midkine (MK), a heparin-binding multifunctional factor (12, 13, 14), plays important roles in IRI of the kidney. MK is a 13-kDa protein and promotes cell survival (15, 16), migration of neurons, neutrophils, and macrophages (17, 18, 19), and neurite outgrowth (20), and enhances fibrinolytic activity of endothelial cells (21). MK has ~50% sequence identity with pleiotrophin (PTN), also called heparin-binding growth-associated molecule (HB-GAM), but is not related to other growth factors or cytokines (22, 23). Both MK and PTN/HB-GAM have been believed to play important roles in tumorigenesis and neurogenesis (19, 24, 25, 26, 27).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MK-deficient mice

Mice deficient in MK gene (Mdk) were generated as described previously (28). After backcrossing of Mdk+/- mice for four generations to 129/SV mice, Mdk+/- mice were mated with each other to generate Mdk+/+ and Mdk-/- mice, which were used in the present study. All experiments were performed with Mdk+/+ and Mdk-/- littermates. Mice used were 8- to 10-wk-old males, and were fed normal rodent chow. The experiments described above were conducted according to The Animal Experimentation Guide of Nagoya University School of Medicine.

Renal IRI model

A previously characterized model of renal IRI in mice was used (29). Briefly, mice weighing 20–25 g were anesthetized by i.p. administration of sodium pentobarbital (40 mg/kg). The flank region was shaved, and the animals were placed on a heating pad to keep a constant body temperature (37°C). Under pentobarbital sodium anesthesia, right flank incisions were made and the right kidney was removed. Seven days later, mice were anesthetized as above and the left kidney was exposed. The renal pedicles were bluntly dissected, and a nontraumatic vascular clamp was applied across the pedicles for 90 min. After the clamps were released, the flanks were closed in two layers with 5-0 silk sutures. The animals received 100 ml/kg warm saline instilled into the peritoneal cavity during the procedure and were allowed to recover with free access to food and water. One, 2, 3, and 7 days after ischemia, the left kidneys were removed for examination.

H2O2-mediated oxidant injury model

Proximal tubular epithelial cells were isolated from the kidneys of adult Mdk+/+ or Mdk-/- mice and cultured in KI medium (224.25 ml Ham’s F12, 226.25 ml DMEM, and 12.5 ml HEPES) containing 10% FBS and hormones as described previously (30). Tubular epithelial cells in primary culture displayed strong alkaline phosphatase reactivity and were identified by mAbs for cytokeratin (Labsystems, Helsinki, Finland), which are markers of proximal tubules (30). After reaching confluence, tubular epithelial cells (1 x 107/10-cm dish) were washed with PBS and were exposed to 5 mM H2O2 (31, 32) in DMEM. These cells were also exposed to 1, 10, and 100 ng/ml MK in DMEM. Protein and RNA were extracted from tubular epithelial cells at 30, 60, 80, and 90 min after treatment as described previously (16, 18).

Histology

Kidneys were fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 2-µm sections. They were stained with periodic acid-Schiff reagent (PAS). To assess tubulointerstitial injury, kidney sections were arbitrarily divided into three regions, i.e., the cortex, outer medulla, and inner medulla. Using semiquantitative indices, sections were analyzed for evaluation of acute tubulointerstitial damage in each region (3). Briefly, the extents of tubular cast formation, tubular dilatation, and tubular degeneration (vacuolar change, loss of brush border, detachment of tubular epithelial cells, and condensation of tubular nuclei) were scored according to the following criteria by two observers in a blind manner: 0, normal; 1, <30\%; 2, 30\N70\%; 3, >70% of the pertinent area.

Immunohistochemistry

Parts of the kidney tissues were snap-frozen in liquid nitrogen and kept frozen at -80°C until use. Sections (2-µm thick) were cut by a cryostat and fixed in acetone. Sections were then stained with rabbit anti-mouse MK and FITC-labeled goat anti-rabbit IgG (Cappel, Durham, NC). Rabbit anti-mouse MK was raised by injection of recombinant mouse MK produced in bacteria (33) into rabbits, and was purified by a combination of affinity chromatography on protein A and MK columns (20). The Ab was specific to MK and did not react to PTN/HB-GAM. After washing with PBS, all of the sections were covered with 90% glycerol containing p-phenylenediamine (34) and were examined by epifluorescence microscopy (Olympus Optical, Tokyo, Japan).

For double-immunofluorescence staining of MK and distal tubules, the sections were first stained for MK as described above. They were then incubated with goat anti-human Tamm-Horsfall protein antisera (35) (Serotec, Oxford, U.K.) followed by incubation with rhodamine-labeled rabbit anti-goat IgG (Cappel) (36). For double-immunofluorescence staining of MK and proximal tubules, frozen sections were first stained for MK as described above and then incubated with goat anti-rabbit angiotensin-converting enzyme Ab (36) followed by incubation with rhodamine-labeled rabbit anti-goat IgG.

Cryosections were stained with a monoclonal rat anti-mouse monocyte-macrophage marker F4/80 (Serotec), a monoclonal rat anti-mouse neutrophil marker 7/4 (Serotec), or anti-CD45 (BD PharMingen, San Diego, CA) Ab followed by detection with FITC rabbit anti-rat IgG (Zymed Laboratories, San Francisco, CA). Leukocytes positive for F4/80, 7/4, or CD45 were counted by examining all renal regions (cortex, outer medulla, and inner medulla) under a microscope at x400 magnification in a blind manner.

In situ hybridization

In situ hybridization was performed as described previously (37) using probes described elsewhere (38).

Western blotting and Northern blotting analyses

Proteins were separated by 15% SDS-PAGE, and MK protein was detected by Western blotting with anti-mouse MK Ab using an ECL kit (Amersham, Little Chalfont, U.K.) (39). Northern blotting analysis was performed as described previously (16). For quantitative estimation, blots were scanned by Imaging Densitometer model GS-700 (Bio-Rad, Tokyo, Japan).

Polymerase chain reaction

One microgram of total RNA was reverse-transcribed by Superscript II (Life Technologies, Gaithersburg, MD). The samples were denatured at 94°C for 2 min, and PCR was performed for 35 cycles of 30 s at 94°C, 30 s at 55°C, and 120 s at 72°C. The oligonucleotides used for amplification of MK cDNA were as follows: forward, AGAGAGTCTAGACCACCATGCAGCACCGAGGCTTCTTC, and reverse, AGAGAGTCTAGACCGGAGGCTCTCTGGCCTCCTGAC. Those for MCP-1 cDNA were as follows: forward, GTGAAGCTTAGCTCTCTCTTCCTCCACCACCA, and reverse, CACGGATCCTTTACGGGTCAACTTCACATTCAAA, whereas those for murine macrophage inflammatory protein-2 (MIP-2) cDNA were as follows: forward, GTGAAGCTTAGCCACACTTCAGCCTAGCGCC, and reverse, CACGGATCCTTTCCAGGTCAGTTAGCCTTGCC (40).

Assay of survival of neutrophils and macrophages

Mouse neutrophils (41) and peritoneal macrophages (42) were isolated as described in the respective references. These leukocytes were plated in 24-well plates in DMEM without serum at a density of 2.0 x 105 cells/well with MK at concentrations of 0, 10, and 100 ng/ml and were cultured for 3 days. Cell survival was monitored at days 1, 2, and 3 using a Cell Counting kit (Dojin, Kumamoto, Japan).

Statistical analysis

All values are given as means ± SE. Statistical analysis was performed by one-factor ANOVA. When a significant difference was detected, statistical analysis was further performed using Scheffe’s F test between two groups. A p value of <0.05 was taken to indicate a significant difference.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MK expression was increased in the renal tubules after IRI

By in situ hybridization (Fig. 1GoB) and immunohistochemical staining (Fig. 1GoC), expression of MK was readily observed in the tubules of the normal mouse kidney. A moderate increase in MK protein expression was found in renal tubules 2 days after IRI (Fig. 1GoD). The tubules with MK expression did not overlap with those expressing Tamm-Horsfall protein, which is a marker of distal tubules (Fig. 1Go, D–F), but coincided with tubules expressing angiotensin-converting enzyme, which is a marker of proximal tubules (Fig. 1Go, G–I). Therefore, we concluded that after IRI, MK expression was increased in proximal tubules. Similar experiments revealed that in the normal kidney, MK was also localized in proximal tubules (data not shown).



View larger version (82K):
[in this window]
[in a new window]
 
FIGURE 1. Immunohistochemical studies on MK expression in the normal kidneys and in kidneys after IRI. A–C, Normal kidneys; D–I, kidneys obtained 2 days after ischemia/reperfusion. A, PAS staining; B, in situ hybridization with MK antisense probe; C, immunofluorescence staining with anti-MK Ab. D–F and G–I, Sets of double-immunofluorescence staining. The sections were stained for MK (D and F) and for Tamm-Horsfall protein (E and F) or for MK (G and I) and for angiotensin-converting enzyme (H and I). MK was revealed by green color of FITC, whereas other markers are indicated in red (rhodamine). Bar, 50 µm.

 
We determined the time course of the increase in MK expression. Western blot analysis showed that MK protein levels were elevated within 2 days postischemia, remained elevated for at least 3 days, and returned to normal levels by 7 days postischemia (Fig. 2Go). The MK mRNA levels behaved similarly (Fig. 2Go).



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 2. Time course of increase in MK expression after IRI. Days, Number of days after IRI. Left, Protein, mRNA, and GAPDH indicate Western blot for MK, Northern blot for MK, and Northern blot for GAPDH, respectively. Right, Intensity of bands relative to that on day 0; protein and mRNA represent MK protein and MK mRNA normalized to GAPDH mRNA, respectively.

 
Tubulointerstitial damage was less marked in MK-deficient mice than in wild-type mice

To determine the consequences of the increase in MK expression after IRI, we compared the degree of tubulointerstitial injury between MK-deficient (Mdk-/-) and wild-type (Mdk+/+) mice. Two days after ischemic insult, Mdk-/- mice showed less tubulointerstitial injury as compared with the Mdk+/+ mice by all three criteria examined, i.e., tubular cast formation, tubular dilatation, and tubular degeneration (Fig. 3Go). Statistical analysis confirmed the significance of the partial resistance of the Mdk-/- kidney to IRI (p < 0.01) (Fig. 4Go). These phenomena were similarly found in the cortex, outer medulla, and inner medulla. On day 7 after ischemia, similar differences in the degree of ischemic injury were observed between the Mdk-/- and Mdk+/+ mice (p < 0.01), except that the differences were not significant in terms of cast formation in the cortex or the outer medulla (Fig. 4Go).



View larger version (147K):
[in this window]
[in a new window]
 
FIGURE 3. Tubulointerstitial damage in Mdk+/+ mice (A) and Mdk-/- mice (B) 2 days after IRI. Sections of kidney tissues were stained with PAS. Arrow, Dilatation of the tubule; arrowhead, tubular cast; open arrow, degeneration of the tubule. Bar, 50 µm.

 


View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 4. Semiquantitative analysis of tubulointerstitial damage. The degrees of tubular cast formation, tubular dilatation, and tubular degeneration were comparatively rated as described in Materials and Methods; higher values indicate more sever damages. Data are shown as means (columns) and SEs (bars). {blacksquare}, Mdk+/+ mice; {square}, Mdk-/- mice. N.S., Not significant; *, p < 0.01.

 
Neutrophil recruitment into the tubulointerstitium after IRI was reduced in Mdk-/- mice

Inflammatory leukocytes infiltrated into the tubulointerstitium after IRI. These cells were largely neutrophils, but macrophages were also detected. We found that on day 2 after reperfusion injury, the number of infiltrating inflammatory cells detected by CD45 staining, as well as the number of infiltrating neutrophils and macrophages, was lower in Mdk-/- as compared with Mdk+/+ mice (p < 0.01) (Fig. 5Go). Similar tendencies were found also in the cortex, outer medulla, and inner medulla (data not shown). Because MK at 10 or 100 ng/ml did not enhance survival of macrophages and neutrophils in vitro (data not shown), it was likely that recruitment of inflammatory cells were impaired in Mdk-/- mice.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 5. Decreased infiltration of inflammatory cells into the tubulointerstitium 2 days after ischemic reperfusion in Mdk-/- mice. The numbers of cells scored by examining all renal regions under a microscope at x400 magnification are shown as means (column) and SEs (bar) in Mdk-/- mice ({square}) as compared with Mdk+/+ mice ({blacksquare}). *, p < 0.01.

 
Induction of chemokines is suppressed in Mdk-/- mice

MK is known to induce migration of neutrophils (17) and macrophages (18). We investigated whether failure of these direct effects could fully explain the reduced number of inflammatory cells in Mdk-/- mice. mRNAs of two chemokines, MIP-2 and MCP-1, were induced upon IRI (Fig. 6Go). However, no such induction was apparent in Mdk-/- mice (Fig. 6Go). Thus, the reduced recruitment of inflammatory cells may be ascribed in part to failure of induction of chemokines. We also noticed that induction of MIP-2 in wild-type mice upon IRI was an early event and that of MCP-1 was a late event.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 6. Expression of MIP-2 and MCP-1 mRNA before and after ischemia/reperfusion in the kidneys of Mdk+/+ and Mdk-/- mice. MIP-2 mRNA was detected by Northern blotting, whereas MCP-1 and GAPDH mRNA were detected by RT-PCR.

 
Induction of MK mRNA and MIP-2 mRNA in proximal tubular epithelial cells in culture

To gain further insight into the increased expression of MK and chemokines, we used cultured proximal tubular epithelial cells. We found that exposure of the confluent cells to 5 mM H2O2 led to significant increases in cellular expression of MK protein and mRNA. The levels of MK protein and mRNA were elevated within 30 min after treatment and returned to normal levels by 90 min after treatment (Fig. 7Go).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 7. Effects of exposure to 5 mM H2O2 on MK expression in cultured tubular epithelial cells. At appropriate time points after exposure, MK protein in the cells was determined by Western blotting, and MK mRNA was determined by RT-PCR. Left, Protein, mRNA, and GAPDH indicate Western blot for MK, Northern blot for MK, and Northern blot for GAPDH, respectively. Right, Intensity of bands relative to that on day 0; protein and mRNA represent MK protein and MK mRNA normalized to GAPDH mRNA, respectively.

 
The proximal tubular epithelial cells in culture showed weak expression of MIP-2 and MCP-1 mRNA 60 min after serum deprivation (Fig. 8GoA). MIP-2 mRNA expression significantly increased in the presence of MK (Fig. 8GoA). This increase was transient and reached a peak at 90–120 min after MK administration. When the dosage of MK was changed, MK at 1 ng/ml was scarcely effective, and MK at 100 ng/ml exhibited effects similar to MK at 10 ng/ml (Fig. 8GoB). MCP-1 mRNA expression was increased by MK to a lesser extent (Fig. 8GoA).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 8. Effects of MK on the expression of MIP-2 and MCP-1 mRNA in cultured proximal tubular epithelial cells from Mdk+/+ or Mdk-/- mice. Tubular epithelial cells cultured in the presence of serum were washed with PBS and incubated with DMEM with or without MK. A, Northern blot analysis to compare the effects of 10 ng/ml MK on MIP-2 and MCP-1 expression in cells from Mdk+/+ mice. After appropriate incubation periods, cells were harvested and RNA expression was analyzed. Control indicates incubation in DMEM without MK. B, Effects of different concentrations of MK on MIP-2 induction in cells from Mdk+/+ mice. Results are shown as relative ratios of MIP-2/GAPDH mRNAs, setting the value of MK at 100 ng/ml at 120 min as 1.0. Open columns, Control; hatched columns, MK at 1 ng/ml; dotted columns, MK at 10 ng/ml; filled columns, MK at 100 ng/ml. C, Effects of exposure to 5 mM H2O2 on MIP-2 and MCP-1 mRNA expression in cells from Mdk+/+ mice (left columns) and in cells from Mdk-/- mice (right columns) at 80 min after treatment. The results are shown as relative ratios of MIP-2/GAPDH or MCP-1/GAPDH mRNAs, setting the value of Control at 80 min as 1.0. Control indicates incubation of MdK+/+ cells in DMEM without 5 mM H2O2. Open columns, Control; filled columns, exposure to 5 mM H2O2; hatched columns in Mdk+/+ cells, exposure to 5 mM H2O2 in the presence of 10 µg/ml affinity-purified rabbit anti-MK Ab. Results are expressed as mean ± SD (n = 3).

 
We also found that at 80 min after H2O2 treatment, MIP-2 and MCP-1 mRNA expression increased as compared with the cells after serum deprivation (Fig. 8GoC). A significant portion of the mRNA increase was concluded to be due to the increase of MK expression, because anti-MK Ab inhibited the increase (Fig. 8GoC). In the epithelial cells from Mdk-/- mice, the basal levels of MIP-2 and MCP-1 mRNAs at 80 min after serum deprivation were low (Fig. 8GoC). H2O2 treatment increased the mRNA levels only slightly in Mdk-/- cells (Fig. 8GoC).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neutrophils are recruited to the sites of inflammation and play important roles in defense against infectious microorganisms by releasing superoxide and related radicals and enzymes such as proteases (43, 44). However, the excessive presence of these cells often augments injury by damaging surrounding normal tissues (43, 44). Neutrophil infiltration has been correlated with IRI of several organs (45, 46, 47).

Mdk-/- mice were found to show partial suppression of tubulointerstitial damage upon IRI of the kidney. In this occasion, Mdk-/- mice also exhibited significant suppression of interstitial recruitment of neutrophils as compared with Mdk+/+ mice. These findings suggest that MK is involved in neutrophil recruitment in the kidney and thus participates in tubulointerstitial damage. MK is known to promote migration of neutrophils in vitro (17). Furthermore, in this report, we showed that MK induced expression of MIP-2 in cultured tubular epithelial cells and that induction of MIP-2 upon IRI was suppressed in MK-deficient mice. CXC chemokines such as IL-8 and MIP-2 have been shown to be responsible for neutrophil recruitment in various systems (45, 46, 47, 48, 49, 50, 51) such as IRI in the lung (45) and liver (46), endotoxin-induced pleurisy (49), and lung injury caused by acid aspiration (50). Therefore, we consider that MK enhances neutrophil migration directly by its chemotactic activity and also indirectly by induction of MIP-2. The macrophage recruitment upon IRI needs more elaborated consideration. The macrophage recruitment was also suppressed in Mdk-/- mice. Induction of MCP-1, a chemokine involved in macrophage chemotaxis, was also suppressed in Mdk-/- mice, and MK has been shown to enhance macrophage migration directly (18). Thus, the situation is quite similar to that in neutrophil migration. However, MCP-1 induction in Mdk+/+ mice was a late event and occurred mainly 2 or more days after IRI, implying that induction of MCP-1 may not contribute to enhancement of macrophage migration. Nevertheless, we cannot exclude the possibility that other cytokine(s) with macrophage chemotactic activity was induced by MK. So far we have concluded that MK enhances macrophage recruitment at least partly by its direct effect on macrophages (18) and possibly by induction of other chemokine(s).

Upon IRI of the kidney, MK expression in the proximal tubules was increased 3-fold. Because induction of MIP-2 in the process was more marked, MK was considered one of the molecules involved in MIP-2 induction, and other molecules induced by IRI are also expected to participate in the process. Furthermore, in addition to the functions related to leukocyte migration, MK, which is significantly expressed in normal tubular epithelial cells, is expected to play various roles in the function of these cells, for example, in promotion of their survival. However, this point remains to be clarified.

Because proximal tubular epithelial cells exposed to 5 mM H2O2 exhibited a significant increase in MK expression, superoxide induced by IRI could induce MK expression in vivo. We also noted the difference between the kinetics of increased MK expression upon IRI and that upon in vitro treatment with H2O2: in the former case, the peak of MK expression was 2 days after IRI, whereas in the latter, it was 1 h after the exposure. It is possible that a chain reaction occurs in vivo, i.e., recruited neutrophils release superoxides, which further up-regulate MK expression.

Initially MK was reported to be expressed in proximal tubules in the normal mouse kidney (52), whereas later, MK immunoreactivity was reported in distal tubules (53). In the present study, we used specific markers for proximal tubules, and confirmed the presence of MK in the proximal tubules as reported initially (52).

Among the several cytokines involved in tubulointerstitial injury, TGF-{beta} is generally accepted as the most relevant for renal fibrosis when overexpressed under specific pathological conditions (54, 55). However, TGF-{beta} also has another favorable function as a potent anti-inflammatory cytokine, and the constitutive expression of TGF-{beta} is a prerequisite for the maintenance of normal organ function. There may be a similar requirement in the case of the MK network in the kidney. Indeed, recruitment of inflammatory cells is not the only function of MK occurring in injured tissues, and MK has been shown to have anti-apoptotic activity. MK prevents apoptosis of embryonic neurons cultured in the absence of serum (15), and G401 Wilms’ tumor cells cultured with cisplatin (16). In vivo, MK prevents retinal degeneration caused by exposure to constant light (56). These two functions of MK action, when they are properly coordinated, will promote tissue repair by preventing infection and unnecessary apoptosis.

The results of the present study strongly suggest that MK is involved in progressive tubulointerstitial injury when overexpressed under pathological conditions in a deregulated fashion. Although it should be stated that MK deficiency showed only partial effects and that MK alone does not explain inflammation in this model, the present study provides new insight into the role of MK in kidney diseases, and our results are relevant to the understanding of tubulointerstitial injury in humans. The development of means to suppress inappropriate MK function is expected to contribute to the cure or prevention of this pathological phenomenon.


    Acknowledgments
 
We thank N. Suzuki, N. Asano, T. Katahara, and Y. Fujitani for their excellent technical assistance; and H. Inoue, T. Adachi, and T. Kato for secretarial assistance.


    Footnotes
 
1 This work was supported by Japanese Ministry of Education, Science, and Culture Grants 10CE2006 and 11152210, and the Heparin Research Foundation. Back

2 Address correspondence and reprint requests to Dr. Takashi Muramatsu, Department of Biochemistry, Nagoya University School of Medicine, 65 Turumai-cho, Showa-ku, Nagoya 466-8550, Japan. E-mail address: tmurama{at}med.nagoya-u.ac.jp Back

3 Abbreviations used in this paper: MCP-1, macrophage chemotactic protein-1; HB-GAM, heparin-binding growth-associated molecule; IRI, ischemic reperfusion injury; MK, midkine; Mdk, MK gene; MIP-2, macrophage inflammatory protein-2; PAS, periodic acid-Schiff reagent; PTN, pleiotrophin. Back

Received for publication September 8, 2000. Accepted for publication July 10, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Striker, G. E., L. I. Schainuck, R. E. Cutler, E. P. Benditt. 1970. Structural-functional correlations in renal disease. I. A method for assaying and classifying histopathologic changes in renal disease. Hum. Pathol. 1:615.[Medline]
  2. Neilson, E. G.. 1989. Pathogenesis and therapy of interstitial nephritis. Kidney Int. 35:1257.[Medline]
  3. Nomura, A., K. Nishikawa, Y. Yuzawa, H. Okada, N. Okada, B. P. Morgan, S. J. Piddlesden, M. Nadai, T. Hasegawa, S. Matsuo. 1995. Tubulointerstitial injury induced in rats by a monoclonal antibody that inhibits function of a membrane inhibitor of complement. J. Clin. Invest. 96:2348.
  4. Roy-Chaudhury, P., B. Wu, G. King, M. Cambell, A. M. Macleod, N. E. Haites, J. G. Simpson, D. A. Power. 1996. Adhesion molecule interactions in human glomerulonephritis: importance of the tubulointerstitium. Kidney Int. 49:127.[Medline]
  5. Prodjosudjadi, W., J. S. Gerritsma, N. Klar-Mohamad, A. F. Gerritsen, J. A. Bruijin, M. R. Daha, L. A. van Es. 1995. Production and cytokine-mediated regulation of monocyte chemoattractant protein-1 by human proximal tubular epithelial cells. Kidney Int. 48:1477.[Medline]
  6. Gerritsma, J. S., P. S. Hiemstra, A. F. Gerritsen, W. Prodjosudjadi, C. L. Verweij, L. A. Van Es, M. R. Daha. 1996. Regulation and production of IL-8 by human proximal tubular epithelial cells in vitro. Clin. Exp. Immunol. 103:289.[Medline]
  7. Tang, W. W., T. R. Ulich, D. L. Lacey, D. C. Hill, S. A. Kaufman, G. Y. Van, J. E. Tarprey, J. S. Yee. 1996. Platelet-derived growth factor-BB induces renal tubulointerstitial myofibroblast formation and tubulointerstitial fibrosis. Am. J. Pathol. 148:1169.[Abstract]
  8. Moore, K. J., T. Wada, S. D. Barbee, V. R. Kelley. 1998. Gene transfer of RANTES elicits autoimmune renal injury in MRL-Faslpr mice. Kidney Int. 53:1631.[Medline]
  9. Hammerman, M. R.. 1997. New treatments for acute renal failure: growth factors and beyond. Curr. Opin. Nephrol. Hypertens. 6:7.[Medline]
  10. Lieberthal, W.. 1997. Biology of acute renal failure: therapeutic implications. Kidney Int. 52:1102.[Medline]
  11. Combe, C., C. J. Burton, P. Dufourco, S. Weston, T. Horsburgh, J. Walls, K. P. G. Harris. 1997. Hypoxia induces intercellular adhesion molecule-1 on cultured human tubular epithelial cells. Kidney Int. 51:1703.[Medline]
  12. Kadomatsu, K., M. Tomomura, T. Muramatsu. 1988. cDNA cloning and sequencing of a new gene intensely expressed in early differentiation stages of embryonal carcinoma cells and in mid-gestation period of mouse embryogenesis. Biochem. Biophys. Res. Commun. 151:1312.[Medline]
  13. Tomomura, M., K. Kadomatsu, S. Matsubara, T. Muramatsu. 1990. A retinoic acid-responsive gene, MK, found in the teratocarcinoma system: heterogeneity of the transcript and the nature of the translation product. J. Biol. Chem. 265:10765.[Abstract/Free Full Text]
  14. Iwasaki, W., K. Nagata, H. Hatanaka, T. Inui, T. Kimura, T. Muramatsu, K. Yoshida, M. Tasumi, F. Inagaki. 1997. Solution structure of midkine, a new heparin-binding growth factor. EMBO J. 16:6936.[Medline]
  15. Owada, K., N. Sanjo, T. Kobayashi, H. Mizusawa, H. Muramatsu, T. Muramatsu, M. Michikawa. 1999. Midkine inhibits caspase-dependent apoptosis via the activation of mitogen-activated protein kinase and phosphatidylinositol 3-kinase in cultured neurons. J. Neurochem. 73:2084.[Medline]
  16. Qi, M., S. Ikematsu, K. Ichihara-Tanaka, S. Sakuma, T. Muramatsu, K. Kadomatsu. 2000. Midkine rescues Wilms’ tumor cells from cisplatin-induced apoptosis: regulation of Bcl-2 expression by midkine. J. Biochem. 127:269.[Abstract/Free Full Text]
  17. Takada, T., K. Toriyama, H. Muramatsu, X. Song, S. Torii, T. Muramatsu. 1997. Midkine, a retinoic acid-inducible heparin-binding cytokine in inflammatory responses: chemotactic activity to neutrophils and association with inflammatory synovitis. J. Biochem. 122:453.[Abstract/Free Full Text]
  18. Horiba, M., K. Kadomatsu, E. Nakamura, H. Muramatsu, S. Ikematsu, S. Sakuma, K. Hayashi, Y. Yuzawa, S. Matsuo, M. Kuzuya, et al 2000. Neointima formation in a restenosis model is suppressed in midkine-deficient mice. J. Clin. Invest. 105:489.[Medline]
  19. Maeda, N., K. Ichihara-Tanaka, T. Kimura, K. Kadomatsu, T. Muramatsu, M. Noda. 1999. A receptor-like protein tyrosine phosphatase (PTP {zeta}/RPTP {beta}), binds a heparin binding growth factor midkine: involvement of arginine 78 of midkine in the high affinity binding to PTP {zeta}. J. Biol. Chem. 274:12474.[Abstract/Free Full Text]
  20. Muramatsu, H., H. Shirahama, S. Yonezawa, H. Maruta, T. Muramatsu. 1993. Midkine, a retinoic acid-inducible growth/differentiation factor: immunochemical evidence for the function and distribution. Dev. Biol. 159:392.[Medline]
  21. Kojima, S., H. Muramatsu, H. Amanuma, T. Muramatsu. 1995. Midkine enhances fibrinolytic activity of bovine endothelial cells. J. Biol. Chem. 270:9590.[Abstract/Free Full Text]
  22. Merenmies, J., H. Rauvala. 1990. Molecular cloning of the 18-kDa growth-associated protein of developing brain. J. Biol. Chem. 265:16721.[Abstract/Free Full Text]
  23. Li, Y., P. G. Milner, A. K. Chauhan, M. A. Watson, R. M. Hoffman, C. M. Kodner, J. Milbrandt, T. F. Deuel. 1990. Cloning and expression of a developmentally regulated protein that induces mitogenic and neurite outgrowth activity. Science 250:1690.[Abstract/Free Full Text]
  24. Rauvala, H.. 1989. An 18-kD heparin-binding protein of developing brain that is distinct from fibroblast growth factors. EMBO J. 8:2933.[Medline]
  25. Chauhan, A. K., Y. S. Li, T. F. Deuel. 1993. Pleiotrophin transforms NIH3T3 cells and induces tumors in nude mice. Proc. Natl. Acad. Sci. USA 90:679.[Abstract/Free Full Text]
  26. Nakagawara. A., J., T. Milbrandt, T. F. Muramatsu, H. Deuel, A. Zhao, A. Craan, G. M. Brodeur. 1995. Differential expression of pleiotrophin and midkine in advanced neuroblastomas. Cancer Res. 55:1792.[Abstract/Free Full Text]
  27. Czubayko. F., A. M., G. J. Shulte, G. J. Berchem, A. Wellstein. 1996. Melanoma angiogenesis and metastasis modulated by ribozyme targeting of the secreted growth factor pleiotrophin. Proc. Natl. Acad. Sci. USA 93:14753.[Abstract/Free Full Text]
  28. Nakamura. E., K., S. Kadomatsu, H. Yuasa, T. Muramatsu, T. Mamiya, Q.-W. Nabeshima, K. Fan, T. Ishiguro, S. Igakura, S. Matsubara, et al 1998. Disruption of the midkine gene (Mdk) resulted in altered expression of a calcium binding protein in the hippocampus of infant mice and their abnormal behavior. Genes Cells 3:811.[Abstract]
  29. Haq, M., J. Norman, S. R. Saba, G. Ramirez, H. Rabb. 1997. Role of IL-1 in renal ischemic reperfusion injury. J. Am. Soc. Nephrol. 9:614.[Abstract]
  30. Wuthrich, R. P., L. M. Glimcher, M. A. Yui, A. M. Jevnikar, S. E. Dumas, V. E. Kelley. 1990. MHC class II, antigen presentation and tumor necrosis factor in renal tubular epithelial cells. Kidney Int. 37:783.[Medline]
  31. Ueda, N., S. V. Shah. 1992. Role of intracellular calcium in hydrogen peroxide-induced renal tubular cell injury. Am. J. Physiol. 263:214.
  32. Padanilam, B. J., A. J. P. Lewington. 1999. Molecular mechanisms of cell death and regeneration in acute ischemic renal injury. Curr. Opin. Nephrol. Hypertens. 8:15.[Medline]
  33. Take, M., J. Tsutsui, H. Obama, M. Ozawa, T. Nakayama, I. Maruyama, T. Arima, T. Muramatsu. 1994. Identification of nucleolin as a binding protein for midkine (MK) and heparin-binding growth-associated molecule (HB-GAM). J. Biochem. 116:1063.[Abstract/Free Full Text]
  34. Platt, J. L., A. F. Michael. 1983. Retardation of fading and enhancement of intensity of immunofluorescence by p-phenylenediamine. J. Histochem. Cytochem. 31:840.[Abstract]
  35. Ichida, S., Y. Yuzawa, H. Okada, K. Yoshioka, S. Matsuo. 1994. Localization of the complement regulatory proteins in the normal human kidney. Kidney Int. 46:89.[Medline]
  36. Yuzawa, Y., J. R. Brentjens, J. Brett, P. R. Caldwell, C. Esposito, A. Fukatsu, G. Godman, D. Stern, G. Andres. 1993. Antibody-mediated redistribution and shedding of endothelial antigens in the rabbit. J. Immunol. 150:5633.[Abstract]
  37. Fan, Q.-W., S. Yuasa, N. Kuno, T. Senda, M. Kobayashi, T. Muramatsu, K. Kadomatsu. 1998. Expression of basigin, a member of the immunoglobulin superfamily, in the mouse central nervous system. Neurosci. Res. 30:53.[Medline]
  38. Kadomatsu, K., R. Huang, T. Suganuma, F. Murata, T. Muramatsu. 1990. A retinoic acid responsive gene MK found in the teratocarcinoma system is expressed in spatially and temporally controlled manner during mouse embryogenesis. J. Cell Biol. 110:607.[Abstract/Free Full Text]
  39. Kadomatsu, K., M. Hagihara, S. Akhter, Q. Fan, H. Muramatsu, T. Muramatsu. 1997. Midkine induces the transformation of NIH3T3 cells. Br. J. Cancer 75:354.[Medline]
  40. Hirose, K., M. Hakozaki, Y. Nyunoy, Y. Kobayashi, K. Matsushita, T. Takenouchi, A. Mikata, N. Mukaida, K. Matsushima. 1995. Chemokine gene transfection into tumour cells reduced tumorigenicity in nude mice in association with neutrophilic infiltration. Br. J. Cancer 72:708.[Medline]
  41. Werr, J., J. Johansson, E. E. Eriksson, P. Hedqvist, E. Ruoslahti, L. Lindbom. 2000. Integrin {alpha}2{beta}1 (VLA-2) is a principal receptor used by neutrophils for locomotion in extravascular tissue. Blood 95:1804.[Abstract/Free Full Text]
  42. Shacter, E., G. K. Arzadon, J. Williams. 1992. Elevation of interleukin-6 in response to a chronic inflammatory stimulus in mice: inhibition by indomethacin. Blood 80:194.[Abstract/Free Full Text]
  43. Baggiolini, M., F. Boulay, J. A. Badwey, J. T. Curnutte. 1993. Activation of neutrophil leukocytes: chemoattractant receptors and respiratory burst. FASEB J. 7:1004.[Abstract]
  44. Furie, M. B., G. J. Randolph. 1995. Chemokines and tissue injury. Am. J. Pathol. 146:1287.[Abstract]
  45. Sekido, N., N. Mukaida, A. Harada, I. Nakanishi, Y. Watanabe, K. Matsushima. 1993. Prevention of lung reperfusion injury in rabbits by a monoclonal antibody against interleukin-8. Nature 365:654.[Medline]
  46. Lentsch, A. B., H. Yoshidome, W. G. Cheadle, F. N. Miller, M. J. Edwards. 1998. Chemokine involvement in hepatic ischemia/reperfusion injury in mice: roles for macrophage inflammatory protein-2 and Kupffer cells. Hepatology 27:507.[Medline]
  47. Heinzelmann, M., M. A. Mercer-Jones, J. C. Passmore. 1999. Physiology and cell biology update: neutrophils and renal failure. Am. J. Kidney Dis. 34:384.[Medline]
  48. Cacalano, G., J. Lee, K. Kikly, A. M. Ryan, S. Pitts-Meek, B. Hultgren, W. I. Wood, M. W. Moore. 1994. Neutrophil and B cell expansion in mice that lack the murine IL-8 receptor homology. Science 265:682.[Abstract/Free Full Text]
  49. Broaddus, V. C., A. M. Boylan, J. M. Hoeffel, K. J. Kim, M. Sadick, A. Chuntharapai, C. A. Hébert. 1994. Neutralization of IL-8 inhibits neutrophil influx in a rabbit model of endotoxin-induced pleurisy. J. Immunol. 152:2960.[Abstract]
  50. Folkesson, H. G., M. A. Matthay, C. A. Hébert, V. C. Broaddus. 1995. Acid aspiration-induced lung injury in rabbits is mediated by interleukin-8-dependent mechanisms. J. Clin. Invest. 96:107.
  51. Hang, L., M. Haraoka, W. W. Agace, H. Leffler, M. Burdick, R. Strieter, C. Svanborg. 1999. Macrophage inflammatory protein-2 is required for neutrophil passage across the epithelial barrier of the infected urinary tract. J. Immunol. 162:3037.[Abstract/Free Full Text]
  52. Kitamura, M., T. Shirasawa, T. Mitarai, T. Muramatsu, N. Maruyama. 1993. A retinoid responsive cytokine gene, MK, is preferentially expressed in the proximal tubules of the kidney and human tumor cell lines. Am. J. Pathol. 142:425.[Abstract]
  53. Obama, H., J. Tsutsui, M. Ozawa, Y. Yoshida, M. Osame, T. Muramatsu. 1995. Midkine (MK) expression in extraembryonic tissues, amniotic fluid, and cerebrospinal fluid during mouse embryogenesis. J. Biochem. 118:88.[Abstract/Free Full Text]
  54. Border, W. A., N. A. Noble, T. Yamamoto, J. R. Harper, Y. Yamaguchi, M. D. Pierschbacher, E. Ruoslahti. 1992. Natural inhibitor of transforming growth factor-{beta} protects against scarring in experimental kidney disease. Nature 360:361.[Medline]
  55. Eddy, A. A.. 1994. Protein restriction reduces transforming growth factor-{beta} and interstitial fibrosis in nephrotic syndrome. Am. J. Physiol. 35:884.
  56. Unoki, K., N. Ohba, H. Arimura, H. Muramatsu, T. Muramatsu. 1994. Rescue of photoreceptors from the damaging effects of constant light by midkine, a retinoic acid responsive gene product. Invest. Ophthalmol. Vis. Sci. 35:4063.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
D. P. Basile, K. Fredrich, B. Chelladurai, E. C. Leonard, and A. R. Parrish
Renal ischemia reperfusion inhibits VEGF expression and induces ADAMTS-1, a novel VEGF inhibitor
Am J Physiol Renal Physiol, April 1, 2008; 294(4): F928 - F936.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Wang, H. Takeuchi, Y. Sonobe, S. Jin, T. Mizuno, S. Miyakawa, M. Fujiwara, Y. Nakamura, T. Kato, H. Muramatsu, et al.
Inhibition of midkine alleviates experimental autoimmune encephalomyelitis through the expansion of regulatory T cell population
PNAS, March 11, 2008; 105(10): 3915 - 3920.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
S. Fukui, S. Kitagawa-Sakakida, S. Kawamata, G. Matsumiya, N. Kawaguchi, N. Matsuura, and Y. Sawa
Therapeutic Effect of Midkine on Cardiac Remodeling in Infarcted Rat Hearts
Ann. Thorac. Surg., February 1, 2008; 85(2): 562 - 570.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Ichihara-Tanaka, A. Oohira, M. Rumsby, and T. Muramatsu
Neuroglycan C Is a Novel Midkine Receptor Involved in Process Elongation of Oligodendroglial Precursor-like Cells
J. Biol. Chem., October 13, 2006; 281(41): 30857 - 30864.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
I. M. D. Pecly, R. G. Goncalves, E. P. Rangel, C. M. Takiya, F. S. Taboada, C. A. Martinusso, M. S. G. Pavao, and M. Leite Jr
Effects of low molecular weight heparin in obstructed kidneys: decrease of collagen, fibronectin and TGF-{beta}, and increase of chondroitin/dermatan sulfate proteoglycans and macrophage infiltration
Nephrol. Dial. Transplant., May 1, 2006; 21(5): 1212 - 1222.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
K. Inoh, H. Muramatsu, S. Torii, S. Ikematsu, M. Oda, H. Kumai, S. Sakuma, T. Inui, T. Kimura, and T. Muramatsu
Doxorubicin-Conjugated Anti-Midkine Monoclonal Antibody as a Potential Anti-Tumor Drug
Jpn. J. Clin. Oncol., April 1, 2006; 36(4): 207 - 211.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Kosugi, Y. Yuzawa, W. Sato, H. Kawai, S. Matsuo, Y. Takei, T. Muramatsu, and K. Kadomatsu
Growth Factor Midkine Is Involved in the Pathogenesis of Diabetic Nephropathy
Am. J. Pathol., January 1, 2006; 168(1): 9 - 19.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Mizuno and T. Nakamura
Prevention of Neutrophil Extravasation by Hepatocyte Growth Factor Leads to Attenuations of Tubular Apoptosis and Renal Dysfunction in Mouse Ischemic Kidneys
Am. J. Pathol., June 1, 2005; 166(6): 1895 - 1905.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Hayashi, H. Banno, K. Kadomatsu, Y. Takei, K. Komori, and T. Muramatsu
Antisense oligodeoxyribonucleotide as to the growth factor midkine suppresses neointima formation induced by balloon injury
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2203 - H2209.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Kawai, W. Sato, Y. Yuzawa, T. Kosugi, S. Matsuo, Y. Takei, K. Kadomatsu, and T. Muramatsu
Lack of the Growth Factor Midkine Enhances Survival against Cisplatin-Induced Renal Damage
Am. J. Pathol., November 1, 2004; 165(5): 1603 - 1612.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Muramatsu, P. Zou, H. Suzuki, Y. Oda, G.-Y. Chen, N. Sakaguchi, S. Sakuma, N. Maeda, M. Noda, Y. Takada, et al.
{alpha}4{beta}1- and {alpha}6{beta}1-integrins are functional receptors for midkine, a heparin-binding growth factor
J. Cell Sci., October 15, 2004; 117(22): 5405 - 5415.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Kato, Y. Yuzawa, N. Tsuboi, S. Maruyama, Y. Morita, T. Matsuguchi, and S. Matsuo
Endotoxin-Induced Chemokine Expression in Murine Peritoneal Mesothelial Cells: The Role of Toll-Like Receptor 4
J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1289 - 1299.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Suzuki, Y. Shibata, T. Urano, T. Murohara, T. Muramatsu, and K. Kadomatsu
Proteasomal Degradation of the Nuclear Targeting Growth Factor Midkine
J. Biol. Chem., April 23, 2004; 279(17): 17785 - 17791.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
E. E. Morrisey and R. C. Savani
Midkine: A Potential Bridge between Glucocorticoid and Retinoid Effects on Lung Vascular Development
Am. J. Respir. Cell Mol. Biol., January 1, 2003; 28(1): 5 - 8.
[Full Text] [PDF]


Home page
GlycobiologyHome page
P. Zou, K. Zou, H. Muramatsu, K. Ichihara-Tanaka, O. Habuchi, S. Ohtake, S. Ikematsu, S. Sakuma, and T. Muramatsu
Glycosaminoglycan structures required for strong binding to midkine, a heparin-binding growth factor
Glycobiology, January 1, 2003; 13(1): 35 - 42.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Sumi, H. Muramatsu, Y. Takei, K.-I. Hata, M. Ueda, and T. Muramatsu
Midkine, a heparin-binding growth factor, promotes growth and glycosaminoglycan synthesis of endothelial cells through its action on smooth muscle cells in an artificial blood vessel model
J. Cell Sci., January 7, 2002; 115(13): 2659 - 2667.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow