|
|
||||||||




Departments of
*
Internal Medicine III and
Biochemistry, Nagoya University School of Medicine, Nagoya, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Several immunological and nonimmunological mechanisms of progressive tubulointerstitial injury have been proposed, including autologous complement activation (3) in the renal parenchyma and the involvement of cytokines/chemokines, growth factors, and vasoactive mediators (4, 5, 6, 7, 8). The importance of tubular epithelial cells as regulators of tubulointerstitial inflammation and fibrosis has been revealed recently. Many observations have shown that the activated tubular epithelial cells, especially proximal tubular epithelial cells, have the potential to produce leukocyte adhesion molecules (4) and diverse cytokines/chemokines such as macrophage chemotactic protein-1 (MCP-1)3 (5), IL-8 (6), platelet-derived growth factor (7), and RANTES (8). All these factors might be directly or indirectly involved in the process of tubulointerstitial inflammation and fibrosis. However, the detailed mechanism of tubulointerstitial injury remains to be clarified.
Ischemic reperfusion injury (IRI) of the kidney is a good animal model of tubulointerstitial injury. Furthermore, it is one of the main causes of acute renal failure in humans, which is the most costly kidney-related illness requiring admission to a hospital (9, 10). Renal ischemia has been shown to be a potent stimulus resulting in activation of tubular epithelial cells and leukocyte infiltration into the tubulointerstitium, with concomitant expression of ICAM-1 in these cells (11).
In this study, we demonstrated that midkine (MK), a heparin-binding
multifunctional factor (12, 13, 14), plays important roles in
IRI of the kidney. MK is a 13-kDa protein and promotes cell survival
(15, 16), migration of neurons, neutrophils, and
macrophages (17, 18, 19), and neurite outgrowth
(20), and enhances fibrinolytic activity of endothelial
cells (21). MK has
50% sequence identity with
pleiotrophin (PTN), also called heparin-binding growth-associated
molecule (HB-GAM), but is not related to other growth factors or
cytokines (22, 23). Both MK and PTN/HB-GAM have been
believed to play important roles in tumorigenesis and neurogenesis
(19, 24, 25, 26, 27).
| Materials and Methods |
|---|
|
|
|---|
Mice deficient in MK gene (Mdk) were generated as described previously (28). After backcrossing of Mdk+/- mice for four generations to 129/SV mice, Mdk+/- mice were mated with each other to generate Mdk+/+ and Mdk-/- mice, which were used in the present study. All experiments were performed with Mdk+/+ and Mdk-/- littermates. Mice used were 8- to 10-wk-old males, and were fed normal rodent chow. The experiments described above were conducted according to The Animal Experimentation Guide of Nagoya University School of Medicine.
Renal IRI model
A previously characterized model of renal IRI in mice was used (29). Briefly, mice weighing 2025 g were anesthetized by i.p. administration of sodium pentobarbital (40 mg/kg). The flank region was shaved, and the animals were placed on a heating pad to keep a constant body temperature (37°C). Under pentobarbital sodium anesthesia, right flank incisions were made and the right kidney was removed. Seven days later, mice were anesthetized as above and the left kidney was exposed. The renal pedicles were bluntly dissected, and a nontraumatic vascular clamp was applied across the pedicles for 90 min. After the clamps were released, the flanks were closed in two layers with 5-0 silk sutures. The animals received 100 ml/kg warm saline instilled into the peritoneal cavity during the procedure and were allowed to recover with free access to food and water. One, 2, 3, and 7 days after ischemia, the left kidneys were removed for examination.
H2O2-mediated oxidant injury model
Proximal tubular epithelial cells were isolated from the kidneys of adult Mdk+/+ or Mdk-/- mice and cultured in KI medium (224.25 ml Hams F12, 226.25 ml DMEM, and 12.5 ml HEPES) containing 10% FBS and hormones as described previously (30). Tubular epithelial cells in primary culture displayed strong alkaline phosphatase reactivity and were identified by mAbs for cytokeratin (Labsystems, Helsinki, Finland), which are markers of proximal tubules (30). After reaching confluence, tubular epithelial cells (1 x 107/10-cm dish) were washed with PBS and were exposed to 5 mM H2O2 (31, 32) in DMEM. These cells were also exposed to 1, 10, and 100 ng/ml MK in DMEM. Protein and RNA were extracted from tubular epithelial cells at 30, 60, 80, and 90 min after treatment as described previously (16, 18).
Histology
Kidneys were fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 2-µm sections. They were stained with periodic acid-Schiff reagent (PAS). To assess tubulointerstitial injury, kidney sections were arbitrarily divided into three regions, i.e., the cortex, outer medulla, and inner medulla. Using semiquantitative indices, sections were analyzed for evaluation of acute tubulointerstitial damage in each region (3). Briefly, the extents of tubular cast formation, tubular dilatation, and tubular degeneration (vacuolar change, loss of brush border, detachment of tubular epithelial cells, and condensation of tubular nuclei) were scored according to the following criteria by two observers in a blind manner: 0, normal; 1, <30\%; 2, 30\N70\%; 3, >70% of the pertinent area.
Immunohistochemistry
Parts of the kidney tissues were snap-frozen in liquid nitrogen and kept frozen at -80°C until use. Sections (2-µm thick) were cut by a cryostat and fixed in acetone. Sections were then stained with rabbit anti-mouse MK and FITC-labeled goat anti-rabbit IgG (Cappel, Durham, NC). Rabbit anti-mouse MK was raised by injection of recombinant mouse MK produced in bacteria (33) into rabbits, and was purified by a combination of affinity chromatography on protein A and MK columns (20). The Ab was specific to MK and did not react to PTN/HB-GAM. After washing with PBS, all of the sections were covered with 90% glycerol containing p-phenylenediamine (34) and were examined by epifluorescence microscopy (Olympus Optical, Tokyo, Japan).
For double-immunofluorescence staining of MK and distal tubules, the sections were first stained for MK as described above. They were then incubated with goat anti-human Tamm-Horsfall protein antisera (35) (Serotec, Oxford, U.K.) followed by incubation with rhodamine-labeled rabbit anti-goat IgG (Cappel) (36). For double-immunofluorescence staining of MK and proximal tubules, frozen sections were first stained for MK as described above and then incubated with goat anti-rabbit angiotensin-converting enzyme Ab (36) followed by incubation with rhodamine-labeled rabbit anti-goat IgG.
Cryosections were stained with a monoclonal rat anti-mouse monocyte-macrophage marker F4/80 (Serotec), a monoclonal rat anti-mouse neutrophil marker 7/4 (Serotec), or anti-CD45 (BD PharMingen, San Diego, CA) Ab followed by detection with FITC rabbit anti-rat IgG (Zymed Laboratories, San Francisco, CA). Leukocytes positive for F4/80, 7/4, or CD45 were counted by examining all renal regions (cortex, outer medulla, and inner medulla) under a microscope at x400 magnification in a blind manner.
In situ hybridization
In situ hybridization was performed as described previously (37) using probes described elsewhere (38).
Western blotting and Northern blotting analyses
Proteins were separated by 15% SDS-PAGE, and MK protein was detected by Western blotting with anti-mouse MK Ab using an ECL kit (Amersham, Little Chalfont, U.K.) (39). Northern blotting analysis was performed as described previously (16). For quantitative estimation, blots were scanned by Imaging Densitometer model GS-700 (Bio-Rad, Tokyo, Japan).
Polymerase chain reaction
One microgram of total RNA was reverse-transcribed by Superscript II (Life Technologies, Gaithersburg, MD). The samples were denatured at 94°C for 2 min, and PCR was performed for 35 cycles of 30 s at 94°C, 30 s at 55°C, and 120 s at 72°C. The oligonucleotides used for amplification of MK cDNA were as follows: forward, AGAGAGTCTAGACCACCATGCAGCACCGAGGCTTCTTC, and reverse, AGAGAGTCTAGACCGGAGGCTCTCTGGCCTCCTGAC. Those for MCP-1 cDNA were as follows: forward, GTGAAGCTTAGCTCTCTCTTCCTCCACCACCA, and reverse, CACGGATCCTTTACGGGTCAACTTCACATTCAAA, whereas those for murine macrophage inflammatory protein-2 (MIP-2) cDNA were as follows: forward, GTGAAGCTTAGCCACACTTCAGCCTAGCGCC, and reverse, CACGGATCCTTTCCAGGTCAGTTAGCCTTGCC (40).
Assay of survival of neutrophils and macrophages
Mouse neutrophils (41) and peritoneal macrophages (42) were isolated as described in the respective references. These leukocytes were plated in 24-well plates in DMEM without serum at a density of 2.0 x 105 cells/well with MK at concentrations of 0, 10, and 100 ng/ml and were cultured for 3 days. Cell survival was monitored at days 1, 2, and 3 using a Cell Counting kit (Dojin, Kumamoto, Japan).
Statistical analysis
All values are given as means ± SE. Statistical analysis was performed by one-factor ANOVA. When a significant difference was detected, statistical analysis was further performed using Scheffes F test between two groups. A p value of <0.05 was taken to indicate a significant difference.
| Results |
|---|
|
|
|---|
By in situ hybridization (Fig. 1
B) and immunohistochemical
staining (Fig. 1
C), expression of MK was readily observed in
the tubules of the normal mouse kidney. A moderate increase in MK
protein expression was found in renal tubules 2 days after IRI (Fig. 1
D). The tubules with MK expression did not overlap with
those expressing Tamm-Horsfall protein, which is a marker of distal
tubules (Fig. 1
, DF), but coincided with tubules
expressing angiotensin-converting enzyme, which is a marker of proximal
tubules (Fig. 1
, GI). Therefore, we concluded that after
IRI, MK expression was increased in proximal tubules. Similar
experiments revealed that in the normal kidney, MK was also localized
in proximal tubules (data not shown).
|
|
To determine the consequences of the increase in MK expression
after IRI, we compared the degree of tubulointerstitial injury between
MK-deficient (Mdk-/-) and wild-type
(Mdk+/+) mice. Two days after ischemic
insult, Mdk-/- mice showed less
tubulointerstitial injury as compared with the
Mdk+/+ mice by all three criteria examined,
i.e., tubular cast formation, tubular dilatation, and tubular
degeneration (Fig. 3
). Statistical
analysis confirmed the significance of the partial resistance of the
Mdk-/- kidney to IRI
(p < 0.01) (Fig. 4
). These phenomena were similarly found
in the cortex, outer medulla, and inner medulla. On day 7 after
ischemia, similar differences in the degree of ischemic injury were
observed between the Mdk-/- and
Mdk+/+ mice (p <
0.01), except that the differences were not significant in terms of
cast formation in the cortex or the outer medulla (Fig. 4
).
|
|
Inflammatory leukocytes infiltrated into the tubulointerstitium
after IRI. These cells were largely neutrophils, but macrophages were
also detected. We found that on day 2 after reperfusion injury, the
number of infiltrating inflammatory cells detected by CD45 staining,
as well as the number of infiltrating neutrophils and macrophages, was
lower in Mdk-/- as compared with
Mdk+/+ mice (p <
0.01) (Fig. 5
). Similar tendencies were
found also in the cortex, outer medulla, and inner medulla (data not
shown). Because MK at 10 or 100 ng/ml did not enhance survival of
macrophages and neutrophils in vitro (data not shown), it was likely
that recruitment of inflammatory cells were impaired in
Mdk-/- mice.
|
MK is known to induce migration of neutrophils (17)
and macrophages (18). We investigated whether failure of
these direct effects could fully explain the reduced number of
inflammatory cells in Mdk-/- mice. mRNAs
of two chemokines, MIP-2 and MCP-1, were induced upon IRI (Fig. 6
). However, no such induction was
apparent in Mdk-/- mice (Fig. 6
). Thus,
the reduced recruitment of inflammatory cells may be ascribed in part
to failure of induction of chemokines. We also noticed that induction
of MIP-2 in wild-type mice upon IRI was an early event and that of
MCP-1 was a late event.
|
To gain further insight into the increased expression of MK and
chemokines, we used cultured proximal tubular epithelial cells. We
found that exposure of the confluent cells to 5 mM
H2O2 led to significant
increases in cellular expression of MK protein and mRNA. The levels of
MK protein and mRNA were elevated within 30 min after treatment and
returned to normal levels by 90 min after treatment (Fig. 7
).
|
|
| Discussion |
|---|
|
|
|---|
Mdk-/- mice were found to show partial suppression of tubulointerstitial damage upon IRI of the kidney. In this occasion, Mdk-/- mice also exhibited significant suppression of interstitial recruitment of neutrophils as compared with Mdk+/+ mice. These findings suggest that MK is involved in neutrophil recruitment in the kidney and thus participates in tubulointerstitial damage. MK is known to promote migration of neutrophils in vitro (17). Furthermore, in this report, we showed that MK induced expression of MIP-2 in cultured tubular epithelial cells and that induction of MIP-2 upon IRI was suppressed in MK-deficient mice. CXC chemokines such as IL-8 and MIP-2 have been shown to be responsible for neutrophil recruitment in various systems (45, 46, 47, 48, 49, 50, 51) such as IRI in the lung (45) and liver (46), endotoxin-induced pleurisy (49), and lung injury caused by acid aspiration (50). Therefore, we consider that MK enhances neutrophil migration directly by its chemotactic activity and also indirectly by induction of MIP-2. The macrophage recruitment upon IRI needs more elaborated consideration. The macrophage recruitment was also suppressed in Mdk-/- mice. Induction of MCP-1, a chemokine involved in macrophage chemotaxis, was also suppressed in Mdk-/- mice, and MK has been shown to enhance macrophage migration directly (18). Thus, the situation is quite similar to that in neutrophil migration. However, MCP-1 induction in Mdk+/+ mice was a late event and occurred mainly 2 or more days after IRI, implying that induction of MCP-1 may not contribute to enhancement of macrophage migration. Nevertheless, we cannot exclude the possibility that other cytokine(s) with macrophage chemotactic activity was induced by MK. So far we have concluded that MK enhances macrophage recruitment at least partly by its direct effect on macrophages (18) and possibly by induction of other chemokine(s).
Upon IRI of the kidney, MK expression in the proximal tubules was increased 3-fold. Because induction of MIP-2 in the process was more marked, MK was considered one of the molecules involved in MIP-2 induction, and other molecules induced by IRI are also expected to participate in the process. Furthermore, in addition to the functions related to leukocyte migration, MK, which is significantly expressed in normal tubular epithelial cells, is expected to play various roles in the function of these cells, for example, in promotion of their survival. However, this point remains to be clarified.
Because proximal tubular epithelial cells exposed to 5 mM H2O2 exhibited a significant increase in MK expression, superoxide induced by IRI could induce MK expression in vivo. We also noted the difference between the kinetics of increased MK expression upon IRI and that upon in vitro treatment with H2O2: in the former case, the peak of MK expression was 2 days after IRI, whereas in the latter, it was 1 h after the exposure. It is possible that a chain reaction occurs in vivo, i.e., recruited neutrophils release superoxides, which further up-regulate MK expression.
Initially MK was reported to be expressed in proximal tubules in the normal mouse kidney (52), whereas later, MK immunoreactivity was reported in distal tubules (53). In the present study, we used specific markers for proximal tubules, and confirmed the presence of MK in the proximal tubules as reported initially (52).
Among the several cytokines involved in tubulointerstitial injury,
TGF-
is generally accepted as the most relevant for renal fibrosis
when overexpressed under specific pathological conditions (54, 55). However, TGF-
also has another favorable function as a
potent anti-inflammatory cytokine, and the constitutive expression
of TGF-
is a prerequisite for the maintenance of normal organ
function. There may be a similar requirement in the case of the MK
network in the kidney. Indeed, recruitment of inflammatory cells is not
the only function of MK occurring in injured tissues, and MK has been
shown to have anti-apoptotic activity. MK prevents apoptosis of
embryonic neurons cultured in the absence of serum (15),
and G401 Wilms tumor cells cultured with cisplatin (16).
In vivo, MK prevents retinal degeneration caused by exposure to
constant light (56). These two functions of MK action,
when they are properly coordinated, will promote tissue repair by
preventing infection and unnecessary apoptosis.
The results of the present study strongly suggest that MK is involved in progressive tubulointerstitial injury when overexpressed under pathological conditions in a deregulated fashion. Although it should be stated that MK deficiency showed only partial effects and that MK alone does not explain inflammation in this model, the present study provides new insight into the role of MK in kidney diseases, and our results are relevant to the understanding of tubulointerstitial injury in humans. The development of means to suppress inappropriate MK function is expected to contribute to the cure or prevention of this pathological phenomenon.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Takashi Muramatsu, Department of Biochemistry, Nagoya University School of Medicine, 65 Turumai-cho, Showa-ku, Nagoya 466-8550, Japan. E-mail address: tmurama{at}med.nagoya-u.ac.jp ![]()
3 Abbreviations used in this paper: MCP-1, macrophage chemotactic protein-1; HB-GAM, heparin-binding growth-associated molecule; IRI, ischemic reperfusion injury; MK, midkine; Mdk, MK gene; MIP-2, macrophage inflammatory protein-2; PAS, periodic acid-Schiff reagent; PTN, pleiotrophin. ![]()
Received for publication September 8, 2000. Accepted for publication July 10, 2001.
| References |
|---|
|
|
|---|
/RPTP
), binds a heparin binding growth factor midkine: involvement of arginine 78 of midkine in the high affinity binding to PTP
. J. Biol. Chem. 274:12474.
2
1 (VLA-2) is a principal receptor used by neutrophils for locomotion in extravascular tissue. Blood 95:1804.
protects against scarring in experimental kidney disease. Nature 360:361.[Medline]
and interstitial fibrosis in nephrotic syndrome. Am. J. Physiol. 35:884.
This article has been cited by other articles:
![]() |
J. Floege and S. Uhlig Kidney calling lung and call back: how organs talk to each other Nephrol. Dial. Transplant., September 15, 2009; (2009) gfp464v1. [Full Text] [PDF] |
||||
![]() |
N. Kato, Y. Yuzawa, T. Kosugi, A. Hobo, W. Sato, Y. Miwa, K. Sakamoto, S. Matsuo, and K. Kadomatsu The E-Selectin Ligand Basigin/CD147 Is Responsible for Neutrophil Recruitment in Renal Ischemia/Reperfusion J. Am. Soc. Nephrol., July 1, 2009; 20(7): 1565 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Furuichi, J.-L. Gao, R. Horuk, T. Wada, S. Kaneko, and P. M. Murphy Chemokine Receptor CCR1 Regulates Inflammatory Cell Infiltration after Renal Ischemia-Reperfusion Injury J. Immunol., December 15, 2008; 181(12): 8670 - 8676. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Urahama, Y. Ohsaki, Y. Fujita, S. Maruyama, Y. Yuzawa, S. Matsuo, and T. Fujimoto Lipid Droplet-Associated Proteins Protect Renal Tubular Cells from Fatty Acid-Induced Apoptosis Am. J. Pathol., November 1, 2008; 173(5): 1286 - 1294. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Basile, K. Fredrich, B. Chelladurai, E. C. Leonard, and A. R. Parrish Renal ischemia reperfusion inhibits VEGF expression and induces ADAMTS-1, a novel VEGF inhibitor Am J Physiol Renal Physiol, April 1, 2008; 294(4): F928 - F936. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, H. Takeuchi, Y. Sonobe, S. Jin, T. Mizuno, S. Miyakawa, M. Fujiwara, Y. Nakamura, T. Kato, H. Muramatsu, et al. Inhibition of midkine alleviates experimental autoimmune encephalomyelitis through the expansion of regulatory T cell population PNAS, March 11, 2008; 105(10): 3915 - 3920. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fukui, S. Kitagawa-Sakakida, S. Kawamata, G. Matsumiya, N. Kawaguchi, N. Matsuura, and Y. Sawa Therapeutic Effect of Midkine on Cardiac Remodeling in Infarcted Rat Hearts Ann. Thorac. Surg., February 1, 2008; 85(2): 562 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ichihara-Tanaka, A. Oohira, M. Rumsby, and T. Muramatsu Neuroglycan C Is a Novel Midkine Receptor Involved in Process Elongation of Oligodendroglial Precursor-like Cells J. Biol. Chem., October 13, 2006; 281(41): 30857 - 30864. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. D. Pecly, R. G. Goncalves, E. P. Rangel, C. M. Takiya, F. S. Taboada, C. A. Martinusso, M. S. G. Pavao, and M. Leite Jr Effects of low molecular weight heparin in obstructed kidneys: decrease of collagen, fibronectin and TGF-{beta}, and increase of chondroitin/dermatan sulfate proteoglycans and macrophage infiltration Nephrol. Dial. Transplant., May 1, 2006; 21(5): 1212 - 1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Inoh, H. Muramatsu, S. Torii, S. Ikematsu, M. Oda, H. Kumai, S. Sakuma, T. Inui, T. Kimura, and T. Muramatsu Doxorubicin-Conjugated Anti-Midkine Monoclonal Antibody as a Potential Anti-Tumor Drug Jpn. J. Clin. Oncol., April 1, 2006; 36(4): 207 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kosugi, Y. Yuzawa, W. Sato, H. Kawai, S. Matsuo, Y. Takei, T. Muramatsu, and K. Kadomatsu Growth Factor Midkine Is Involved in the Pathogenesis of Diabetic Nephropathy Am. J. Pathol., January 1, 2006; 168(1): 9 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mizuno and T. Nakamura Prevention of Neutrophil Extravasation by Hepatocyte Growth Factor Leads to Attenuations of Tubular Apoptosis and Renal Dysfunction in Mouse Ischemic Kidneys Am. J. Pathol., June 1, 2005; 166(6): 1895 - 1905. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hayashi, H. Banno, K. Kadomatsu, Y. Takei, K. Komori, and T. Muramatsu Antisense oligodeoxyribonucleotide as to the growth factor midkine suppresses neointima formation induced by balloon injury Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2203 - H2209. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawai, W. Sato, Y. Yuzawa, T. Kosugi, S. Matsuo, Y. Takei, K. Kadomatsu, and T. Muramatsu Lack of the Growth Factor Midkine Enhances Survival against Cisplatin-Induced Renal Damage Am. J. Pathol., November 1, 2004; 165(5): 1603 - 1612. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Muramatsu, P. Zou, H. Suzuki, Y. Oda, G.-Y. Chen, N. Sakaguchi, S. Sakuma, N. Maeda, M. Noda, Y. Takada, et al. {alpha}4{beta}1- and {alpha}6{beta}1-integrins are functional receptors for midkine, a heparin-binding growth factor J. Cell Sci., October 15, 2004; 117(22): 5405 - 5415. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kato, Y. Yuzawa, N. Tsuboi, S. Maruyama, Y. Morita, T. Matsuguchi, and S. Matsuo Endotoxin-Induced Chemokine Expression in Murine Peritoneal Mesothelial Cells: The Role of Toll-Like Receptor 4 J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1289 - 1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Suzuki, Y. Shibata, T. Urano, T. Murohara, T. Muramatsu, and K. Kadomatsu Proteasomal Degradation of the Nuclear Targeting Growth Factor Midkine J. Biol. Chem., April 23, 2004; 279(17): 17785 - 17791. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Morrisey and R. C. Savani Midkine: A Potential Bridge between Glucocorticoid and Retinoid Effects on Lung Vascular Development Am. J. Respir. Cell Mol. Biol., January 1, 2003; 28(1): 5 - 8. [Full Text] [PDF] |
||||
![]() |
P. Zou, K. Zou, H. Muramatsu, K. Ichihara-Tanaka, O. Habuchi, S. Ohtake, S. Ikematsu, S. Sakuma, and T. Muramatsu Glycosaminoglycan structures required for strong binding to midkine, a heparin-binding growth factor Glycobiology, January 1, 2003; 13(1): 35 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sumi, H. Muramatsu, Y. Takei, K.-I. Hata, M. Ueda, and T. Muramatsu Midkine, a heparin-binding growth factor, promotes growth and glycosaminoglycan synthesis of endothelial cells through its action on smooth muscle cells in an artificial blood vessel model J. Cell Sci., January 7, 2002; 115(13): 2659 - 2667. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |