|
|
||||||||
and
2b Promoters in Murine B Lymphocytes: Evidence for Specific Promoter-Enhancer Interactions1


*
Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden; and
Institute of Immunology, Vilnius, Lithuania
| Abstract |
|---|
|
|
|---|
and
2b
promoters with the HS1,2 enhancer using transiently transfected mouse
primary B cells and cell lines. The constructs used for the
transfections contained a GL promoter upstream and HS1,2 downstream of
a luciferase reporter gene. Both GL
and
2b promoters synergized
strongly with the HS1,2 enhancer in activated primary B cells, a mature
B cell line, and a plasma cell line. We show that the major activity of
HS1,2 in activated primary B cells occurs within a 310-bp fragment that
includes NF-
B, OCT, and NF of activated B cells (Ets/AP-1) sites. By
mutating the consensus sequences for various transcription factors, we
have determined which sites in HS1,2 are important for synergy with the
GL
and
2b promoters. Our findings indicate that different sites
in HS1,2 might selectively interact with the GL
and
2b
promoters. We also provide evidence that B cell-specific activator
protein is not an absolute suppressor of HS1,2
activity. | Introduction |
|---|
|
|
|---|
-globin or IgH loci, contain huge gene clusters that are tightly
regulated during cell development and differentiation. This regulation
is conducted by various cis-acting elements such as
promoters, enhancers, or locus control regions
(LCR).3 The
best-studied LCR is the one in the human
-globin locus. It contains
five DNase I-hypersensitive sites that together control correct
developmental, successive expression of five
-globin genes (for
review, see Refs. 1, 2, 3). The IgH locus is even more
complex, containing multiple gene segments coding for the variable and
constant regions of Ab molecules (Fig. 1
|
promoter in the mouse is
induced by IL-4 in combination with LPS or CD40 ligation
(29, 30, 31, 32, 33, 34). A set of transcription factors including STAT6,
NF-
B, B cell-specific activator protein (BSAP, encoded by
Pax-5), C/EBP, PU.1, BCL-6, and AP-1 have been shown to
contribute to the regulation of this promoter (Fig. 1
2b promoter is induced by another set
of stimuli: LPS, TGF-
1, or CD40 ligation (43, 44, 45).
Transcription factor binding sites important for the stimulation of the
GL
2b promoter have, to our knowledge, hardly been studied.
External signals have varying effects on specific IgH locus 3'
enhancers. LPS, PMA, IL-4, and TGF-
either alone or in combination
do not induce HS3a in mature B and plasma cell lines, implying that its
activity cannot be modulated by external signals (12).
This is probably true for HS3b as well because it is an inverted copy
of HS3a. Conversely, HS1,2 can be activated by LPS and CD40 ligation
(21, 46), the same stimuli that induce GL transcription
and CSR. HS1,2 contains several activation and repression elements.
Proteins that bind E5 (47), NF-
B (48, 49, 50),
NFE (49), OCT (51, 52), NF-
P
(53), and NF of activated B cells (NF-AB) (Ets/AP-1)
(46, 54) motifs positively regulate HS1,2 in
activated B and plasma cells. BSAP has been shown to suppress
HS1,2 activity in B cell lines that correspond to early differentiation
stages (51, 53, 55). In contrast, there is evidence that
HS1,2 activity is not blocked by BSAP in activated mature B cells
(56).
Some factors that activate GL
and
2b promoters also
induce HS1,2 activity. Specific sets of transcription factors that bind
GL promoters could induce their differential interactions with the
enhancers. GL promoter "competition" for the 3' enhancers may be
part of a mechanism regulating GL transcription and CSR (22, 23), which is also consistent with recent findings from Seidl et
al. (57).
We present here a study designed to test the direct
interaction of the mouse GL
and
2b promoters with HS1,2 in
primary B cells and B cell lines. By mutating DNA-binding-factor sites
in HS1,2, we provide evidence for possible specific interactions
between HS1,2 and different GL promoters in primary B cells.
| Materials and Methods |
|---|
|
|
|---|
Cells were isolated from spleens of 4- to 8-wk-old (CBA x C57BL/6)F1 mice purchased from Charles River Laboratories (Uppsala, Sweden). The splenocytes were enriched for total B cells as described previously (58) using a mixture of anti-T cell Abs and complement followed by size separation using Percoll gradient centrifugation. Cells at the 5070% interface were used in all experiments. Cells were cultured in RPMI 1640 supplemented with 10 µM sodium pyruvate, 100 µg/ml penicillin, 100 µg/ml streptomycin, 2 mM 2-ME, and 10% heat-inactivated FBS and were preactivated with 10 µg/ml LPS (Sigma, St. Louis, MO) for 2 days at 37°C and 5% CO2.
Cell lines
The mature B cell lines M12.4.1, IgG2a positive (59); L10, membrane IgM positive; A20, membrane IgG positive (60); and T lymphoma cell line, EL4 (EL4 BurOUr6.1.5.5) (61) have been described previously. The mouse myeloma cell line S194/5.XXO (TIB 19) and pre-B cell line 70Z/3 (TIB 158) were obtained from the American Type Culture Collection (Manassas, VA). All cell lines were cultured in supplemented RPMI 1640 as described above.
Vector construction
prom. and
prom.-HS1,2.
The GL
promoter-corresponding fragment -162/+53 (37),
where +1 is the first transcriptional start site, was PCR amplified
using a 5' primer containing a BglII site
(ATCTAGATCTGTGTCTCCTAGAAAGAGGCCT) and a 3' primer
containing a HindIII site
(ATCTAAGCTTTGTGCAGGCTCCCCAGGCGTT; restriction sites are
underlined). The GL
promoter was then cloned upstream of a
luciferase gene into the pGL3 basal vector (Promega, Madison, WI),
generating plasmid
prom. (Fig. 1
B). A 908-bp
StuI-StuI fragment of the mouse HS1,2 enhancer
was kindly provided by Dr. S. Pettersson (Karolinska Institutet,
Stockholm, Sweden). It was amplified by PCR to add
BamHI and SalI sites at the ends (5' primer,
ATGCGGATCCTGTCTGCCAAGTCTGTCTGAG; and 3' primer,
ATCAGTCGACACGTGGCCACAGTCTATCCCT) and cloned into the
prom. plasmid downstream of the luciferase gene, generating the
prom.-HS1,2 plasmid (Fig. 1
B).
2b prom. and
2b prom.-HS1,2.
The GL
2b promoter fragment corresponding to the -362/+184 fragment
relative to the first transcriptional initiation site was PCR amplified
from a plasmid that contained a 5' S
2b region (a gift
from S. Lutzker, Howard Hughes Medical Institute, New York, NY)
(62). The BglII and HindIII sites
were inserted using primers 5'-
CAGTAGATCTCCACCTGACTTGCTGCACTCT and
3'-ATCTAAGCTTGCCGCGTGAAGAAGACTG. The GL
2b promoter
was cloned into either the pGL3 basal vector or a vector with an
inserted HS1,2, generating plasmids
2b prom. or
2b prom.-HS1,2
(Fig. 1
B).
prom.-HS1,2 fragment I, II, or III.
Fragment I (Fig. 1
B) of the HS1,2 enhancer, corresponding to
bp 28333 in relation to the StuI site, was amplified using
the
prom.-HS1,2 vector as a template and adding a SalI
site at the 3' end (5' fragment I primer, TGTTTCAGGTTCAGGGGGAGGTG;
3' fragment I primer, ATCAGTCGACGGTCCATGACCCTATTGATG).
It was cloned downstream of the luciferase reporter gene into the
BamHI, SalI cloning site of the
prom.
plasmid. Fragments II and III were cloned in the same way.
Fragment II spanned bp 301611 of HS1,2 (5' fragment II primer,
AGCTGGATCCCGGAATTCAACATCATCAAT; and 3' fragment II primer,
TCAGTCGACGGTTGGGGGCTCAGATA). Fragment III
contained bp 577905 of HS1,2, and was amplified using the following
primers: 5' fragment III,
TGACGGATCCCCTTGTTTCTGGTACTGATA; and 3' fragment III,
CGCCCACCGGAAGGAGCTGAC. All inserts were sequenced to confirm.
Mutagenesis
or
2b prom.-HS1,2 oct.mut.
The octamer site and NF-
B binding site mutations were made using a
QuikChange site-directed mutagenesis kit following the manufacturers
instructions (Stratagene, La Jolla, CA). The octamer site mutation was
designed as described previously (48). A ClaI
site was inserted by using complementary primers that cover the octamer
site in HS1,2, GAAACAAACATCCAaTcGatGTGCCCTTGTG (mutated bases are in
lower case). The resulting plasmid was named either
prom.-HS1,2
oct.mut. or
2b prom.-HS1,2 oct.mut., depending on the promoter used
(Fig. 1
B).
or
2b prom.-HS1,2 NF-
B mut.
The NF-
B site mutation was made by inserting a NheI site
using a complementary primer, AGTGGCCTATGCTaGcAGTCgCCCATCCCCAAG
(mutated bases are in lower case). Abolished binding of NF-
B
proteins to this oligonucleotide was tested by EMSA. The pGL3 plasmid
carrying HS1,2 was used as a template, and GL
or
2b promoters
were inserted subsequently, as described above.
prom.-HS1,2 BSAP mut.
A 50-bp region spanning the functional higher affinity BSAP binding
site (55) was deleted, inserting a ClaI
restriction site. HS1,2 was amplified in two separate fragments. The
first fragment used a 5' fragment I primer and a 3' primer carrying a
ClaI site, AACATCGATACCCCAGGGAAGTGAG. The 3'
fragment III primer and 5' primer with a ClaI site
(CCAATCGATAGATTCCAGCAGTGGTGATA) were used to amplify the
second fragment. The first fragment was digested with BamHI
and ClaI, the second with ClaI and
SalI, and the
prom. vector was cut with BamHI
and SalI. All three resulting fragments were ligated
together, generating the
prom.-HS1,2 BSAP mut. plasmid (Fig. 1
B).
or
2b prom.-HS1,2 NF-AB mut.
The NF-AB site mutation was made by deleting 33 bp that span the NF-AB
site. HS1,2 was again amplified in two separate fragments. For the
first fragment, we used the 5' fragment I primer and a KpnI
site-containing primer
(AATAGGTACCAGTTGGCTCACAAGGGCACAT), and for the second
fragment, we used the 3' fragment III primer and a primer with a
KpnI site (AATAGGTACCGTGTGCGAGTGTGACATGTTG).
The fragments were ligated into the
prom. or
2b prom. plasmids
using the same strategy as was used for the BSAP-site mutation (Fig. 1
B). All mutations were confirmed by both restriction enzyme
digestion and sequencing.
Transfection
Primary B cells and cell lines were transiently transfected with
the supercoiled plasmids by electroporation. All plasmids were prepared
using either CsCl gradient or polyethylene glycol precipitation. High
purity of the plasmids was crucial for successful transfection of the
primary B cells. Ten or 14 µg of test plasmid were used per cuvette
(Bio-Rad, Hercules, CA) to transfect the cell lines and primary B
cells, respectively. We used 1.25 µg CMV-
-galactosidase-containing
vector as an internal control for all transfections. A total of
107 cells/cuvette were mixed with the plasmid DNA
in 350 µl RPMI 1640 with 10% FBS and incubated for 10 min at room
temperature. Cells were exposed to a single pulse (Gene Pulser;
Bio-Rad) at 960 µF. The optimal voltage and resistance were tested
for each cell line type. Voltages for the different cell lines were 370
V (M12.4.1, L10, EL4, and primary B cells), 390 V (A20, and 70Z) or 410
V (S194). The resistance was 400 ohm (A20, 70Z, S194, and primary B
cells) or 600 ohm (M12.4.1, L10, and EL4). After electroporation, cells
were incubated for 10 min at room temperature, resuspended, and 10 ml
RPMI 1640 with 10% FBS with or without stimuli (IL-4 plus
anti-CD40) was added. Recombinant murine IL-4 was either
derived from supernatants of the plasmocytoma X63-Ag8-653 transfected
with IL-4 cDNA (63) or purchased from PeproTech (London,
U.K.). Monoclonal rat anti-mouse CD40 (1C10) (64) was
prepared as previously described (45). The optimal
incubation time following transfection was first determined and used
thereafter for each cell type (6 h for primary B cells and 16 h
for cell lines). Cells were washed and mixed thoroughly with 100 µl
lysis buffer (stock solution: 25 mM Tris-PO4 (pH
7.8), 15% glycerol, 2%
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate
(Sigma), 1% lecitin (Sigma), and freshly added 4 mM EGTA, 8 mM
MgCl2, 1 mM DTT, and 0.4 mM PMSF). Cell debris
was removed by centrifugation, and 20 µl of the supernatants were
used for detection of luciferase and
-galactosidase activities.
Reporter assays for luciferase (Geneglow; BioOrbit, Turku, Finland) and
-galactosidase (Galacto-Light Plus chemiluminescent reporter
assay kit; Tropix, Bedford, MA) were performed using a luminometer (LKB
Instruments, Stockholm, Sweden) according to the manufacturers
instructions. Individual activities were calculated using the following
formula: (luciferase value/
-galactosidase value) x 100. Each
group was tested in triplicates and the mean ± SD was calculated.
Statistical significance was evaluated by a t test. For all
experiments, at least four independent transfections with at least two
different plasmid preparations were performed, with results similar to
those presented in the text.
Identification of transcription-factor binding sites
The TRANSFAC 4.0 program (AG Bioinformatics, Branschweig,
Germany) (65) was used to identify
transcription-factor binding sites in both the GL
(fragment
-162/+53) and GL
2b (fragment -362/+184) promoters.
| Results |
|---|
|
|
|---|
promoter
It has been reported that the types of interacting DNA
elements (26), as well as the distance between them
(66, 67), are important for their activities. HS1,2
activity in B cell lines has been studied intensively but has generally
been cloned upstream of heterologous or V promoters (13, 48, 51). It was shown recently that the human IgH downstream
enhancers synergize with the GL
and
3 promoters (25, 26). It has also been demonstrated that the mouse
2a promoter
activity is dramatically elevated by the presence of the downstream
enhancers in transgenic mice (68). We wished to
investigate a potential synergy between the murine
or
2b
promoters and the HS1,2 enhancer. Therefore, we cloned the mouse GL
or
2b promoters 5' of the luciferase reporter gene in the pGL3-basic
vector. The HS1,2 enhancer was inserted 3' of the reporter in the
correct orientation in relation to the promoters, 2 kb downstream of
the latter (Fig. 1
B). We first studied the HS1,2 interaction
with the GL
promoter by transiently transfecting B cell lines that
corresponded to different stages of B cell development. Cells were
either induced by IL-4 plus anti-CD40 Abs or left without stimuli
following transfection. The results are shown in Fig. 2
. In the pre-B cell line, 70Z, the
promoter was induced by the stimuli, but the presence of HS1,2
inhibited the activity. In the plasma cell line, S194, HS1,2 enhanced
GL
promoter activity
25-fold, but the promoter did not respond
to the stimuli. We used three mature B cell lines (A20, L10, and
M12.4.1) to investigate HS1,2 activity. All three cell lines have been
used extensively in GL promoter studies and are known to respond to
IL-4 stimulation and to induce exogenous GL
and
1 promoters
(37, 69). Despite this, HS1,2 promoter synergy was
divergent. In the L10 cells, GL
promoter activity was elevated
6-fold by the enhancer in the nonstimulated condition and a further
2.5-fold when induced by IL-4 and anti-CD40. In the M12.4.1 cell
line, the GL
promoter was strongly induced by the stimuli, but the
presence of the HS1,2 was repressive. The A20 cells showed an
intermediate pattern; the promoter activity was enhanced 2-fold by
HS1,2 when stimuli were absent, but not in their presence. In the T
cell line, EL4, the enhancer was inactive and the GL
promoter could
not be induced by stimuli.
|
and
2b promoters are enhanced by HS1,2 in activated
primary B cellsBecause the data above demonstrate that mature B cell lines are not suitable for studying interactions between GL promoters and the HS1,2 enhancer, we tried transfecting primary B cells. First, we tested transfection efficiency using CMV promoter-reporter constructs. Nonstimulated, resting B cells from murine spleen could not be transfected, whereas B cells stimulated for 2 days with mitogenic stimuli could be transfected. LPS stimulation led to higher transfection efficiency than stimulation with LPS plus IL-4, anti-CD40, or anti-CD40 plus IL-4 (data not shown). For this reason, we used LPS-stimulated B cells in the experiments described here. We also found that it was important to measure activity soon after transfection (see Materials and Methods).
We transiently transfected LPS blast with constructs containing either
GL
or
2b promoters and thereafter recultured the cells with or
without various stimuli. In Table I
, the
mean results from several experiments are shown, in which data are
calculated relative to the activities obtained for the
or
2b
promoter constructs without HS1,2 and without stimuli. Both promoters
were enhanced by HS1, 2 (the
promoter 9-fold and the
2b promoter
6.7-fold, on average). The
promoter constructs, with or without
HS1, 2, could be further induced by IL-4, LPS plus IL-4, or
anti-CD40 plus IL-4, but not by LPS or anti-CD40 when given
alone. The
2b promoter was not induced by any stimuli but was, in
fact, inhibited by IL-4 plus anti-CD40. The observation that the
promoter constructs were induced by anti-CD40 and IL-4 is in
accordance with published data (37, 38). The endogenous
2b promoter can be induced with LPS or CD40 ligation (43, 45). Because LPS was added to the cells before transfection,
this signal might be stably induced so that further addition of LPS or
anti-CD40 after transfection would have no effect. For simplicity,
we chose one stimulation condition in the experiments shown below,
i.e., anti-CD40 plus IL-4 for the
promoter constructs and LPS
or anti-CD40 for the
2b promoter constructs. Fig. 3
shows two typical experiments of this
kind, with statistical values (see legend).
|
|
and
2b promoter constructs were expressed, and
the level of synergy with HS1,2 was similar to that shown in Table I
constructs were not induced with
anti-CD40 plus IL-4, probably because the cells were already
stimulated with IL-4 before transfection (data not shown).
LPS-activated B cells express GL
2b and
3 transcripts, whereas
LPS plus IL-4-activated cells express GL
1 and
transcripts.
Thus, these data indicate that the response of activated primary B
cells to GL promoter-HS1,2 constructs is independent of the expression
of certain endogenous GL transcripts. The conserved region of the HS1,2 enhancer contains most of its activity
Earlier studies revealed several stimulatory and inhibitory factors that regulate activity through their binding to specific elements in the HS1,2 enhancer (47, 48, 49, 50, 51, 52, 53, 54). In one previous study, the rat HS1,2 enhancer was subdivided into fragments A, B, and C (70), whereas the mouse enhancer has not been similarly subdivided.
We wished to determine which regions are most important for synergy
with the GL promoters, so we tested the effects of three subfragments
of HS1,2 of equal size, which we call I, II, and III (Fig. 4
A). Fragment II synergized
with the
promoter at a level similar to the entire HS1,2 enhancer
fragment, whereas fragment I was significantly inhibitory
(p < 0.05) compared with constructs that
lacked the enhancer (Fig. 4
B). Fragment III had no effect on
the promoters (data not shown). We also studied the activities of
fragments I and II in the L10 cell line, because in this cell line
HS1,2 showed a similar activity to that seen in the primary cells.
Fragment I was also inhibitory in L10 cells, whereas fragment II
contained only
6070% of the response observed in the intact
enhancer, showing that the HS1,2 activity in L10 cells differs somewhat
from that in primary B cells (data not shown).
|
P, NF-
B, and E1 sites) and A (containing E5, OCT,
and NF-AB sites) used by Grant et al. (70) contributed to
30 and 60% of the activity of HS1,2, respectively, when transfected
into B cell lines. Fragment II contains all fragment A sites in
addition to BSAP site a and E1, µB-like, and NF-
B sites. The
higher activity of fragment II compared with fragment A studied by
Grant et al. could depend on those additional transcription factor
sites or differences between systems used in the two studies.
The NF-
B and NF-AB sites are differentially important for HS1,2
interaction with the GL
and
2b promoters
We wished to investigate the importance of previously determined
transcription-factor binding sites in the HS1,2 enhancer. We first
mutated the NF-
B site, because this site has been shown to be
important for enhancer activity in several studies (48, 50, 51). Surprisingly, in primary B cells, the HS1,2 enhancer with
the NF-
B site mutation was as potent as the wild-type enhancer in
inducing increased activity of the GL
promoter (Fig. 5
, A and D). In
fact, in some experiments, the mutated construct induced a
significantly higher (120160%) enhancement compared with
the wild-type one (data not shown). However, synergy with the GL
2b
promoter was significantly reduced to 6070% of wild-type activity
when the NF-
B site was mutated (Fig. 5
, A and
D). The activity of HS1,2 combined with GL
2b promoter
was also reduced to the same extent when cells were stimulated with
IL-4 plus anti-CD40 (data not shown). These results indicate that
NF-
B proteins are differentially involved in the interaction of
HS1,2 with specific GL promoters.
|
promoter. In the cells induced by IL-4
plus anti-CD40, it was even inhibitory when compared with the
response of the promoter alone (Fig. 5
2b
promoter activity, although it was less marked. The mutated HS1,2
significantly enhanced the promoter (p < 0.005
in all experiments) to
4050% of wild-type enhancer activity (Fig. 5
An octamer motif mutation reduces HS1,2 activity when combined with
the GL
or
2b promoters
The OCT motif has been shown to contribute to HS1,2 activity in
several studies (51, 52) and was therefore our next
target. The HS1,2 carrying an OCT motif mutation showed reduced
enhancer activity when combined with either GL
or
2b promoters
(Fig. 5
, C and D). Enhancement of the GL
promoter was significantly reduced only when cells were stimulated with
IL-4 plus anti-CD40. When combined with the
2b promoter, the
activity of the HS1,2 enhancer containing the OCT mutation was reduced
both in the presence and absence of anti-CD40.
The BSAP higher affinity site is not inhibitory when HS1,2 is
combined with the GL
promoter
We have shown above that fragment I of HS1,2 inhibits GL
promoter activity in primary B cells (Fig. 4
B). There are
two BSAP binding sites in HS1,2, with a higher affinity site present in
fragment I. Its role in HS1,2 activity has been studied extensively
(48, 53, 55, 56). Our system is unique in that it contains
BSAP binding elements that are involved in both positive and negative
regulation. The BSAP binding site in the GL
promoter is required
for activity of the latter (39, 71), whereas the site in
HS1,2 is inhibitory (51, 55). Surprisingly, deletion of
the higher affinity BSAP site in HS1,2 did not affect its capacity to
synergize with the GL
promoter in primary B cells (Fig. 6
A). The presence of HS1,2
reduced the activity of the GL
promoter in the M12.4.1 cell line as
shown in Fig. 2
. To see whether BSAP was responsible for this effect,
we transfected this cell line with the
prom.-HS1,2 BSAP mut.
plasmid. Indeed, the construct carrying the BSAP site deletion in HS1,2
was 2.5-fold more active than that containing the wild-type enhancer
and gave a significantly higher response than with the promoter alone
(Fig. 6
B). Because the BSAP higher affinity site is located
within fragment I, one might expect that fragment II, which does not
contain functional BSAP sites, would enhance promoter activity in
M12.4.1 cells. As shown in Fig. 6
C, fragment II increased GL
promoter activity
1.4-fold compared with the promoter alone.
This response was significantly different to that induced by the
wild-type enhancer, but much lower than that in primary B cells
(compare Figs. 6
C and 4B). These data imply that
BSAP can act as a repressor through binding HS1,2 in M12.4.1 cells, but
that it is not the only reason for the lack of synergy observed between
the
promoter and HS1,2 in the M12.4.1 cell line.
|
| Discussion |
|---|
|
|
|---|
-globin,
and c-myc) coupled to mouse IgH distal enhancer elements
have demonstrated their activation during the late stages of B cell
differentiation (13, 21, 55, 72). The highest activity was
reached when all four enhancer elements (HS3A, HS1, 2, HS3B, and HS4)
were combined together (52, 72, 73), demonstrating some
features of LCR (13, 74). Many of those studies used
constructs in which the enhancer elements were placed upstream of, and
in close proximity to, the promoter and the reporter gene (13, 21, 48, 49). It is possible that the location and the distance
between the promoter and the enhancer are crucial for their interaction
as shown for Eµ and HS1,2 (66). Single enhancer elements
are indeed weaker when placed 2 kb downstream of the reporter gene.
When cloned upstream, HS1,2 enhances the V
promoter 35- to 80-fold in the S194 plasmacytoma cell line (51, 55), but only enhances the VH promoter 2-
to 3-fold when cloned downstream of the reporter (72). In
the present study, HS1,2 elevated GL
promoter activity
20-fold
in S194 cells. It is possible that these differences are dependent, to
some extent, on the promoter used, but it is likely that the location
of the enhancer also plays a role. Results from transient transfections
of the M12.4.1 cell line also strengthen this interpretation. In the
M12.4.1 cell line, HS1,2, when cloned upstream of the reporter, caused
a 4- to 5-fold enhancement in one study (51) and a 25-fold
enhancement in another study (55). We show here that HS1,2
is inhibitory in the M12.4.1 cell line, in agreement with findings from
Ong et al. (72), in which constructs containing the
enhancer elements downstream of the reporter were used, with no HS1,2
activity observed in the M12.4.1 cell line.
We tested three murine B cell lines for synergy responses between the
GL promoters and the HS1,2 enhancer. Surprisingly, only one cell line,
L10, supported synergy, whereas the other two, M12.4.1 and A20, did
not. It has been shown previously that BSAP represses HS1,2 activity in
M12.4.1 and A20 cell lines. However, this is not the mechanism for the
lack of synergy with the GL promoters, because fragment II of HS1,2
(which lacks the BSAP binding site) has low activity in M12.4.1 cells
(Fig. 6
C). Previous studies of the GL
1 promoter in L10
and A20 cells have indicated that at least one transcription factor
differs between these cell lines (69). The same factor or
factors could also be important for HS1,2 activity. An interesting
possibility is that the difference in supporting synergy is reflected
in their degree of differentiation. Both A20 and M12.4.1 express IgG,
whereas L10 expresses IgM (59, 60, 69). Thus, optimal
synergy might depend on a transiently activated transcription factor or
cofactor, which is down-regulated when B cells have undergone Ig class
switching.
Regulation of HS1,2 activity has been shown to involve both activation
and repression factors, and our data adds to this knowledge. Fragment I
of HS1,2 inhibited promoter activity in primary B cells (Fig. 4
B). This might not be surprising because this fragment
contains the higher affinity BSAP binding site shown to be the main
negative regulator of HS1,2 activity. The deletion of the BSAP site had
no significant effect on HS1,2 and GL
promoter synergy in primary B
cells. It has been shown that the BSAP binding site in the GL
promoter is necessary for its activity, and that the affinity of this
site is higher than that in the HS1,2 enhancer (39, 75).
It is possible that the presence of low levels of BSAP could be enough
to activate the promoter, but not to suppress the enhancer. However,
although BSAP levels diminish as B cells differentiate into plasma
cells, they are still high in cells stimulated by LPS for 2 days
(56, 76). Our data argue that BSAP is not an absolute
repressor of the enhancer, but its regulation is much more complex and
likely to be dependent on other factors, as also proposed by others
(51, 53, 56).
Fragment II of HS1,2 has the same activity as intact HS1,2 in primary B
cells, which probably means that the major activating factors bind
within this fragment. In this respect, it is not surprising that it
contains a 135-bp core homology region that is 90%
identical with a corresponding fragment in human HS1,2
(14). The NF-
B, OCT, and NF-AB sites are located in
this fragment and have been shown previously to be important for
enhancer activity (46, 48, 54).
The NF-
B site contributes to 40% of the enhancer activity in a
plasma cell line, as previous studies have indicated (48).
In the current study, mutation of the NF-
B site reduced HS1,2
activity when combined with the GL
2b but not the GL
promoter.
This mutation clearly separates activation of two GL promoters by
HS1,2. The GL
promoter contains two NF-
B sites, which have been
shown to be important for promoter activity (38). The
presence of these sites might render the NF-
B site in the HS1,2
enhancer less important for GL
promoter-HS1,2 interactions. To our
knowledge, it is not known whether there are any NF-
B binding sites
in the GL
2b promoter, but none were found using a program to
identify transcription-factor binding sites. However, we cannot exclude
their existence.
The most crucial site for HS1,2 activity in activated primary B cells
is the NF-AB (Ets/AP-1) site. The NF-AB complex is induced by CD40 or
BCR ligation and consists of Ets/AP-1 family proteins including Elf-1,
Jun-B, and c-Fos (46, 54). We deleted the NF-AB site to
destroy all possible binding sites for this complex, and this led to a
complete reduction in synergy between HS1,2 and the GL
promoter. In
fact, the mutation even suppressed the induced promoter activity.
However, it had a milder effect on the GL
2b promoter because HS1,2
activity was reduced, but significant enhancement was still detected in
all experiments. It has been shown that Ets protein family members and
BSAP can form functional complexes (77, 78), making it
possible that an interaction takes place between Elf-1 (binding the
enhancer) and BSAP (binding the GL
promoter). Disruption of this
complex may enable BSAP to bind inhibitory factors instead. However, by
deleting the NF-AB binding site in HS1,2, we not only abolished NF-AB
binding but also altered the spacing between other sites, which could
also influence the outcome, as demonstrated for other enhancers (for
review, see Ref. 79).
A role for the OCT site in the activity of distal IgH locus enhancers in vivo has been suggested from data showing that OCA-B-knockout mice have reduced transcription of switched Ig classes (80). Using transient transfections of activated B cells from OCA-B-knockout mice, it was shown that IL-4 plus anti-CD40 activation of all four distal IgH enhancers did not take place, but exact sites were not specified (52). We show here that the OCT site contributes to HS1,2 activity in combination with both of the GL promoters tested. This site seems to be more important for HS1,2 activity with a stimulated promoter as opposed to an unstimulated one. This is consistent with the notion that OCT 2 is up-regulated by LPS (81) and OCA-B by IL-4 and CD40 signals (82), implying that these stimuli could act on the HS1,2 octamer site.
Taken together, our data indicate possible interactions of GL
promoters with the HS1,2 enhancer in primary B cells. We show that weak
promoters such as the GL promoters can be converted to relatively
strong ones in the presence of HS1,2, allowing detection of their
activities in primary B cells. Together with published findings, our
data imply that specific factors seem to contribute to enhancer
activity in different ways, depending on the promoter. Most likely,
transcription factors that bind the enhancer may cooperate to form a
specific activating surface. This surface would also interact with
activating proteins in the promoter region and with the basal
transcription machinery, as indicated from studies of the IFN-
enhancesome (83, 84). We provide evidence that different
DNA binding factors could be responsible for the interactions between
the enhancer and GL promoters. It could be that different
enhancer-activating surfaces areoptimal for enhancer interactions
with specific GL promoters, also allowing GL promoter competition for
the enhancer depending on which transcription factors are activated.
Conclusions based on transient transfection experiments always have limitations and cannot totally reflect promoter-enhancer interactions at the endogenous locus. Although in transient transfections of primary B cells only a small portion of the HS1,2 enhancer is enough to achieve synergy with GL promoters, the entire unit is most likely required to provide an enhancer-activating surface at the endogenous locus. The findings reported here of the HS1,2 sites important for synergy may provide a starting point for more elaborate studies using transgene technology.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jurga Laurencikiene, Department of Cell and Molecular Biology, Karolinska Institutet, SE-171 77 Stockholm, Sweden. E-mail address: Jurga.Laurencikiene{at}cmb.ki.se ![]()
3 Abbreviations used in this paper: LCR, locus control region; BSAP, B cell-specific activator protein; CSR, class switch recombination; Eµ, IgH intronic enhancer; GL, germline; NF-AB, NF of activated B cells. ![]()
Received for publication February 7, 2001. Accepted for publication July 25, 2001.
| References |
|---|
|
|
|---|
-globin gene clusters: combining phylogenetic analyses and experimental results to gain functional insights. Gene 205:73.[Medline]
-globin locus regulation. Cell 100:499.[Medline]
constant region. Mol. Cell. Biol. 13:1547.
genes. J. Exp. Med. 186:845.
1 and C
2 genes. J. Immunol. 159:1310.[Abstract]
3 germline transcription and its interaction with the 3'
enhancer. Eur. J. Immunol. 30:1019.[Medline]
enhancers. J. Immunol. 164:6380.
2b promoter and exon. EMBO J. 12:3529.[Medline]
heavy chain transcripts induced by interleukin 4. Proc. Natl. Acad. Sci. USA 87:1581.
1 and
Ig gene expression in murine B cells. J. Immunol. 155:5637.[Abstract]
transcripts. Mol. Cell. Biol. 11:5551.
promoter: regulation by NF-IL-4, a C/EBP family member and NF-
B/p50. J. Exp. Med. 181:181.
germline transcripts in B cells via activation of NF-
B: synergy with IL-4 induction. J. Immunol. 158:4769.[Abstract]
transcription. J. Immunol. 152:2904.[Abstract]
B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J. Immunol. 163:4383.
transcription and immunoglobulin E switching. Mol. Cell. Biol. 19:7264.
2b transcripts: evidence for directed heavy chain class switching. Cell 53:177.[Medline]
1 selectivity stimulates immunoglobulin
2b secretion by lipopolysaccharide-activated murine B cells. J. Exp. Med. 177:1031.
B-binding proteins. J. Immunol. 156:2828.[Abstract]
B/p50 and NF-
B/c-Rel differentially regulate the activity of the 3'
E-hsl,2 enhancer in normal murine B cells in an activation-dependent manner. Int. Immunol. 12:1167.
E(hs1, 2). Proc. Natl. Acad. Sci. USA 93:4392.
enhancer by suppressing binding of NF-
P, a protein that controls heavy chain transcription. Proc. Natl. Acad. Sci. USA 92:5336.
enhancer at early stages of B-cell differentiation. Mol. Cell. Biol. 13:3611.
2b exon for class switching. Int. Immunol. 10:1683.
2b transcripts. Mol. Cell. Biol. 8:1849.
regulated germline transcripts are expressed from
2a transgenes independently of the heavy chain 3' enhancers. J. Immunol. 163:5758.
1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[Medline]
enhanceosome. Mol. Cell 1:119.[Medline]
promoter. Cell 103:667.[Medline]This article has been cited by other articles:
![]() |
J. Laurencikiene, V. Tamosiunas, and E. Severinson Regulation of {epsilon} germline transcription and switch region mutations by IgH locus 3' enhancers in transgenic mice Blood, January 1, 2007; 109(1): 159 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Volgina, P.-C. Yam, and K. L. Knight A negative regulatory element in the rabbit 3'IgH chromosomal region Int. Immunol., August 1, 2005; 17(8): 973 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lin, S. L. Brody, and S. L. Peng Restraint of B Cell Activation by Foxj1-Mediated Antagonism of NF-{kappa}B and IL-6 J. Immunol., July 15, 2005; 175(2): 951 - 958. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Reynaud, L. Delpy, L. Fleury, H.-L. Dougier, C. Sirac, and M. Cogne Interallelic Class Switch Recombination Contributes Significantly to Class Switching in Mouse B Cells J. Immunol., May 15, 2005; 174(10): 6176 - 6183. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Dunnick, J. Shi, K. A. Graves, and J. T. Collins The 3' end of the heavy chain constant region locus enhances germline transcription and switch recombination of the four {gamma} genes J. Exp. Med., May 2, 2005; 201(9): 1459 - 1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ushmorov, O. Ritz, M. Hummel, F. Leithauser, P. Moller, H. Stein, and T. Wirth Epigenetic silencing of the immunoglobulin heavy-chain gene in classical Hodgkin lymphoma-derived cell lines contributes to the loss of immunoglobulin expression Blood, November 15, 2004; 104(10): 3326 - 3334. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Sepulveda, A. V. Emelyanov, and B. K. Birshtein NF-{kappa}B and Oct-2 Synergize to Activate the Human 3' Igh hs4 Enhancer in B Cells J. Immunol., January 15, 2004; 172(2): 1054 - 1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Heckman, T. Cao, L. Somsouk, H. Duan, J. W. Mehew, C.-y. Zhang, and L. M. Boxer Critical Elements of the Immunoglobulin Heavy Chain Gene Enhancers for Deregulated Expression of Bcl-2 Cancer Res., October 15, 2003; 63(20): 6666 - 6673. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zhang Accessibility control and machinery of immunoglobulin class switch recombination J. Leukoc. Biol., March 1, 2003; 73(3): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bae, V. C. Calhoun, M. Levine, E. B. Lewis, and R. A. Drewell Characterization of the intergenic RNA profile at abdominal-A and Abdominal-B in the Drosophila bithorax complex PNAS, December 24, 2002; 99(26): 16847 - 16852. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Peng, S. J. Szabo, and L. H. Glimcher T-bet regulates IgG class switching and pathogenic autoantibody production PNAS, April 16, 2002; 99(8): 5545 - 5550. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |