The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laurencikiene, J.
Right arrow Articles by Severinson, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laurencikiene, J.
Right arrow Articles by Severinson, E.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2001, 167: 3257-3265.
Copyright © 2001 by The American Association of Immunologists

HS1,2 Enhancer Regulation of Germline {epsilon} and {gamma}2b Promoters in Murine B Lymphocytes: Evidence for Specific Promoter-Enhancer Interactions1

Jurga Laurencikiene2,*,{dagger}, Vilma Deveikaite*,{dagger} and Eva Severinson*

* Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden; and {dagger} Institute of Immunology, Vilnius, Lithuania


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During an immune response, activated B cells develop into high rate Ig-secreting plasma cells. They also switch from production of IgM to IgG, IgA, or IgE. This process requires a DNA recombination event, which is regulated at the transcriptional level by the production of isotype-specific, sterile germline (GL) transcripts. Induction of these transcripts is controlled by GL promoters and, possibly, by IgH 3' enhancers. We investigated the interaction of the GL {epsilon} and {gamma}2b promoters with the HS1,2 enhancer using transiently transfected mouse primary B cells and cell lines. The constructs used for the transfections contained a GL promoter upstream and HS1,2 downstream of a luciferase reporter gene. Both GL {epsilon} and {gamma}2b promoters synergized strongly with the HS1,2 enhancer in activated primary B cells, a mature B cell line, and a plasma cell line. We show that the major activity of HS1,2 in activated primary B cells occurs within a 310-bp fragment that includes NF-{kappa}B, OCT, and NF of activated B cells (Ets/AP-1) sites. By mutating the consensus sequences for various transcription factors, we have determined which sites in HS1,2 are important for synergy with the GL {epsilon} and {gamma}2b promoters. Our findings indicate that different sites in HS1,2 might selectively interact with the GL {epsilon} and {gamma}2b promoters. We also provide evidence that B cell-specific activator protein is not an absolute suppressor of HS1,2 activity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Numerous studies have demonstrated that transcription is controlled by the interaction of positive and negative regulatory factors with specific DNA elements flanking a gene. Some regions of the genome, such as the {beta}-globin or IgH loci, contain huge gene clusters that are tightly regulated during cell development and differentiation. This regulation is conducted by various cis-acting elements such as promoters, enhancers, or locus control regions (LCR).3 The best-studied LCR is the one in the human {beta}-globin locus. It contains five DNase I-hypersensitive sites that together control correct developmental, successive expression of five {beta}-globin genes (for review, see Refs. 1, 2, 3). The IgH locus is even more complex, containing multiple gene segments coding for the variable and constant regions of Ab molecules (Fig. 1GoA). During B cell differentiation, a series of well-coordinated events takes place within this locus, such as V(D)J rearrangement, IgH class switch recombination (CSR), and somatic hypermutation of V genes (for review, see Refs. 4, 5, 6). Several enhancer elements with developmentally regulated activity have been found in murine and human IgH loci (7, 8, 9, 10, 11, 12, 13, 14, 15). The IgH intronic enhancer (Eµ) has been shown to be active in both early and late stages of B cell development (16). Its deletion impairs V to DJ rearrangement and Ig µ-chain expression and reduces CSR (17, 18, 19). The mouse 3' enhancers span a region of >30 kb and consist of four DNase I-hypersensitive sites (HS3a, HS1,2, HS3b, and HS4) (for review see Ref. 20). Except for HS4, which is functional from pro-B to plasma cells, this region is activated in the late stages of B cell differentiation (13, 21), i.e., during induction of Ig germline (GL) transcripts, CSR, and up-regulation of Ig expression and secretion. Regulation of CSR is very likely to be a function of IgH 3' enhancers, although data showing this are controversial (22, 23, 24, 25, 26).



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 1. Schematic map of the mouse IgH locus and constructs used in this study. A, The V, D, J, and C regions are shown as filled boxes. The small filled ovals represent GL promoters, the hatched ovals represent IgH locus enhancers, and the arrows represent transcription start sites in the locus. The outlines of GL {epsilon}, {gamma}2b promoters, and HS1,2 enhancer with transcription-factor binding sites are also shown. Open symbols represent nonverified binding sites, whereas dotted symbols represent verified binding sites. The TRANSFAC 4.0 program was used to identify transcription-factor binding sites in the GL {gamma}2b promoter (65 ). B, Schematic diagrams of the test constructs used for transient transfections. The GL {epsilon} promoter is shown as an unfilled oval, and the HS1,2 enhancer is shown as an open box following the luciferase gene. X indicates a point-mutated transcription-factor binding site, and the fragmented enhancer box denotes a deleted transcription-factor binding site. Transcription factor sites in HS1,2 present in different constructs are indicated to the right. The GL {epsilon} promoter was exchanged for GL {gamma}2b in the constructs referred as {gamma}2b prom.

 
During the immune response, B cells switch from expression of IgM to IgG, IgA, or IgE. This process involves two events: activation of sterile GL transcripts from a specific CH gene and DNA recombination. Gene targeting experiments indicate that synthesis of GL transcripts is required for switch recombination to occur (27, 28). External stimuli (cytokines or direct cell-cell contact) direct CSR to a particular CH gene via their ability to modulate GL transcription of a given CH gene. GL transcription is driven by promoters located upstream of each switch region that can be activated by external stimuli. For example, the GL {epsilon} promoter in the mouse is induced by IL-4 in combination with LPS or CD40 ligation (29, 30, 31, 32, 33, 34). A set of transcription factors including STAT6, NF-{kappa}B, B cell-specific activator protein (BSAP, encoded by Pax-5), C/EBP, PU.1, BCL-6, and AP-1 have been shown to contribute to the regulation of this promoter (Fig. 1GoA) (35, 36, 37, 38, 39, 40, 41, 42). The GL {gamma}2b promoter is induced by another set of stimuli: LPS, TGF-{beta}1, or CD40 ligation (43, 44, 45). Transcription factor binding sites important for the stimulation of the GL {gamma}2b promoter have, to our knowledge, hardly been studied.

External signals have varying effects on specific IgH locus 3' enhancers. LPS, PMA, IL-4, and TGF-{beta} either alone or in combination do not induce HS3a in mature B and plasma cell lines, implying that its activity cannot be modulated by external signals (12). This is probably true for HS3b as well because it is an inverted copy of HS3a. Conversely, HS1,2 can be activated by LPS and CD40 ligation (21, 46), the same stimuli that induce GL transcription and CSR. HS1,2 contains several activation and repression elements. Proteins that bind E5 (47), NF-{kappa}B (48, 49, 50), NFE (49), OCT (51, 52), NF-{alpha}P (53), and NF of activated B cells (NF-AB) (Ets/AP-1) (46, 54) motifs positively regulate HS1,2 in activated B and plasma cells. BSAP has been shown to suppress HS1,2 activity in B cell lines that correspond to early differentiation stages (51, 53, 55). In contrast, there is evidence that HS1,2 activity is not blocked by BSAP in activated mature B cells (56).

Some factors that activate GL {epsilon} and {gamma}2b promoters also induce HS1,2 activity. Specific sets of transcription factors that bind GL promoters could induce their differential interactions with the enhancers. GL promoter "competition" for the 3' enhancers may be part of a mechanism regulating GL transcription and CSR (22, 23), which is also consistent with recent findings from Seidl et al. (57).

We present here a study designed to test the direct interaction of the mouse GL {epsilon} and {gamma}2b promoters with HS1,2 in primary B cells and B cell lines. By mutating DNA-binding-factor sites in HS1,2, we provide evidence for possible specific interactions between HS1,2 and different GL promoters in primary B cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of primary B cells

Cells were isolated from spleens of 4- to 8-wk-old (CBA x C57BL/6)F1 mice purchased from Charles River Laboratories (Uppsala, Sweden). The splenocytes were enriched for total B cells as described previously (58) using a mixture of anti-T cell Abs and complement followed by size separation using Percoll gradient centrifugation. Cells at the 50–70% interface were used in all experiments. Cells were cultured in RPMI 1640 supplemented with 10 µM sodium pyruvate, 100 µg/ml penicillin, 100 µg/ml streptomycin, 2 mM 2-ME, and 10% heat-inactivated FBS and were preactivated with 10 µg/ml LPS (Sigma, St. Louis, MO) for 2 days at 37°C and 5% CO2.

Cell lines

The mature B cell lines M12.4.1, IgG2a positive (59); L10, membrane IgM positive; A20, membrane IgG positive (60); and T lymphoma cell line, EL4 (EL4 BurOUr6.1.5.5) (61) have been described previously. The mouse myeloma cell line S194/5.XXO (TIB 19) and pre-B cell line 70Z/3 (TIB 158) were obtained from the American Type Culture Collection (Manassas, VA). All cell lines were cultured in supplemented RPMI 1640 as described above.

Vector construction

{epsilon} prom. and {epsilon} prom.-HS1,2. The GL {epsilon} promoter-corresponding fragment -162/+53 (37), where +1 is the first transcriptional start site, was PCR amplified using a 5' primer containing a BglII site (ATCTAGATCTGTGTCTCCTAGAAAGAGGCCT) and a 3' primer containing a HindIII site (ATCTAAGCTTTGTGCAGGCTCCCCAGGCGTT; restriction sites are underlined). The GL {epsilon} promoter was then cloned upstream of a luciferase gene into the pGL3 basal vector (Promega, Madison, WI), generating plasmid {epsilon} prom. (Fig. 1GoB). A 908-bp StuI-StuI fragment of the mouse HS1,2 enhancer was kindly provided by Dr. S. Pettersson (Karolinska Institutet, Stockholm, Sweden). It was amplified by PCR to add BamHI and SalI sites at the ends (5' primer, ATGCGGATCCTGTCTGCCAAGTCTGTCTGAG; and 3' primer, ATCAGTCGACACGTGGCCACAGTCTATCCCT) and cloned into the {epsilon} prom. plasmid downstream of the luciferase gene, generating the {epsilon} prom.-HS1,2 plasmid (Fig. 1GoB).

{gamma}2b prom. and {gamma}2b prom.-HS1,2. The GL {gamma}2b promoter fragment corresponding to the -362/+184 fragment relative to the first transcriptional initiation site was PCR amplified from a plasmid that contained a 5' S{gamma}2b region (a gift from S. Lutzker, Howard Hughes Medical Institute, New York, NY) (62). The BglII and HindIII sites were inserted using primers 5'- CAGTAGATCTCCACCTGACTTGCTGCACTCT and 3'-ATCTAAGCTTGCCGCGTGAAGAAGACTG. The GL {gamma}2b promoter was cloned into either the pGL3 basal vector or a vector with an inserted HS1,2, generating plasmids {gamma}2b prom. or {gamma}2b prom.-HS1,2 (Fig. 1GoB).

{epsilon} prom.-HS1,2 fragment I, II, or III. Fragment I (Fig. 1GoB) of the HS1,2 enhancer, corresponding to bp 28–333 in relation to the StuI site, was amplified using the {epsilon} prom.-HS1,2 vector as a template and adding a SalI site at the 3' end (5' fragment I primer, TGTTTCAGGTTCAGGGGGAGGTG; 3' fragment I primer, ATCAGTCGACGGTCCATGACCCTATTGATG). It was cloned downstream of the luciferase reporter gene into the BamHI, SalI cloning site of the {epsilon} prom. plasmid. Fragments II and III were cloned in the same way. Fragment II spanned bp 301–611 of HS1,2 (5' fragment II primer, AGCTGGATCCCGGAATTCAACATCATCAAT; and 3' fragment II primer, TCAGTCGACGGTTGGGGGCTCAGATA). Fragment III contained bp 577–905 of HS1,2, and was amplified using the following primers: 5' fragment III, TGACGGATCCCCTTGTTTCTGGTACTGATA; and 3' fragment III, CGCCCACCGGAAGGAGCTGAC. All inserts were sequenced to confirm.

Mutagenesis

{epsilon} or {gamma}2b prom.-HS1,2 oct.mut. The octamer site and NF-{kappa}B binding site mutations were made using a QuikChange site-directed mutagenesis kit following the manufacturer’s instructions (Stratagene, La Jolla, CA). The octamer site mutation was designed as described previously (48). A ClaI site was inserted by using complementary primers that cover the octamer site in HS1,2, GAAACAAACATCCAaTcGatGTGCCCTTGTG (mutated bases are in lower case). The resulting plasmid was named either {epsilon} prom.-HS1,2 oct.mut. or {gamma}2b prom.-HS1,2 oct.mut., depending on the promoter used (Fig. 1GoB).

{epsilon} or {gamma}2b prom.-HS1,2 NF-{kappa}B mut. The NF-{kappa}B site mutation was made by inserting a NheI site using a complementary primer, AGTGGCCTATGCTaGcAGTCgCCCATCCCCAAG (mutated bases are in lower case). Abolished binding of NF-{kappa}B proteins to this oligonucleotide was tested by EMSA. The pGL3 plasmid carrying HS1,2 was used as a template, and GL {epsilon} or {gamma}2b promoters were inserted subsequently, as described above.

{epsilon} prom.-HS1,2 BSAP mut. A 50-bp region spanning the functional higher affinity BSAP binding site (55) was deleted, inserting a ClaI restriction site. HS1,2 was amplified in two separate fragments. The first fragment used a 5' fragment I primer and a 3' primer carrying a ClaI site, AACATCGATACCCCAGGGAAGTGAG. The 3' fragment III primer and 5' primer with a ClaI site (CCAATCGATAGATTCCAGCAGTGGTGATA) were used to amplify the second fragment. The first fragment was digested with BamHI and ClaI, the second with ClaI and SalI, and the {epsilon} prom. vector was cut with BamHI and SalI. All three resulting fragments were ligated together, generating the {epsilon} prom.-HS1,2 BSAP mut. plasmid (Fig. 1GoB).

{epsilon} or {gamma}2b prom.-HS1,2 NF-AB mut. The NF-AB site mutation was made by deleting 33 bp that span the NF-AB site. HS1,2 was again amplified in two separate fragments. For the first fragment, we used the 5' fragment I primer and a KpnI site-containing primer (AATAGGTACCAGTTGGCTCACAAGGGCACAT), and for the second fragment, we used the 3' fragment III primer and a primer with a KpnI site (AATAGGTACCGTGTGCGAGTGTGACATGTTG). The fragments were ligated into the {epsilon} prom. or {gamma}2b prom. plasmids using the same strategy as was used for the BSAP-site mutation (Fig. 1GoB). All mutations were confirmed by both restriction enzyme digestion and sequencing.

Transfection

Primary B cells and cell lines were transiently transfected with the supercoiled plasmids by electroporation. All plasmids were prepared using either CsCl gradient or polyethylene glycol precipitation. High purity of the plasmids was crucial for successful transfection of the primary B cells. Ten or 14 µg of test plasmid were used per cuvette (Bio-Rad, Hercules, CA) to transfect the cell lines and primary B cells, respectively. We used 1.25 µg CMV-{beta}-galactosidase-containing vector as an internal control for all transfections. A total of 107 cells/cuvette were mixed with the plasmid DNA in 350 µl RPMI 1640 with 10% FBS and incubated for 10 min at room temperature. Cells were exposed to a single pulse (Gene Pulser; Bio-Rad) at 960 µF. The optimal voltage and resistance were tested for each cell line type. Voltages for the different cell lines were 370 V (M12.4.1, L10, EL4, and primary B cells), 390 V (A20, and 70Z) or 410 V (S194). The resistance was 400 ohm (A20, 70Z, S194, and primary B cells) or 600 ohm (M12.4.1, L10, and EL4). After electroporation, cells were incubated for 10 min at room temperature, resuspended, and 10 ml RPMI 1640 with 10% FBS with or without stimuli (IL-4 plus anti-CD40) was added. Recombinant murine IL-4 was either derived from supernatants of the plasmocytoma X63-Ag8-653 transfected with IL-4 cDNA (63) or purchased from PeproTech (London, U.K.). Monoclonal rat anti-mouse CD40 (1C10) (64) was prepared as previously described (45). The optimal incubation time following transfection was first determined and used thereafter for each cell type (6 h for primary B cells and 16 h for cell lines). Cells were washed and mixed thoroughly with 100 µl lysis buffer (stock solution: 25 mM Tris-PO4 (pH 7.8), 15% glycerol, 2% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (Sigma), 1% lecitin (Sigma), and freshly added 4 mM EGTA, 8 mM MgCl2, 1 mM DTT, and 0.4 mM PMSF). Cell debris was removed by centrifugation, and 20 µl of the supernatants were used for detection of luciferase and {beta}-galactosidase activities. Reporter assays for luciferase (Geneglow; BioOrbit, Turku, Finland) and {beta}-galactosidase (Galacto-Light Plus chemiluminescent reporter assay kit; Tropix, Bedford, MA) were performed using a luminometer (LKB Instruments, Stockholm, Sweden) according to the manufacturer’s instructions. Individual activities were calculated using the following formula: (luciferase value/{beta}-galactosidase value) x 100. Each group was tested in triplicates and the mean ± SD was calculated. Statistical significance was evaluated by a t test. For all experiments, at least four independent transfections with at least two different plasmid preparations were performed, with results similar to those presented in the text.

Identification of transcription-factor binding sites

The TRANSFAC 4.0 program (AG Bioinformatics, Branschweig, Germany) (65) was used to identify transcription-factor binding sites in both the GL {epsilon} (fragment -162/+53) and GL {gamma}2b (fragment -362/+184) promoters.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The HS1,2 enhancer can activate the GL {epsilon} promoter

It has been reported that the types of interacting DNA elements (26), as well as the distance between them (66, 67), are important for their activities. HS1,2 activity in B cell lines has been studied intensively but has generally been cloned upstream of heterologous or V promoters (13, 48, 51). It was shown recently that the human IgH downstream enhancers synergize with the GL {alpha} and {gamma}3 promoters (25, 26). It has also been demonstrated that the mouse {gamma}2a promoter activity is dramatically elevated by the presence of the downstream enhancers in transgenic mice (68). We wished to investigate a potential synergy between the murine {epsilon} or {gamma}2b promoters and the HS1,2 enhancer. Therefore, we cloned the mouse GL {epsilon} or {gamma}2b promoters 5' of the luciferase reporter gene in the pGL3-basic vector. The HS1,2 enhancer was inserted 3' of the reporter in the correct orientation in relation to the promoters, 2 kb downstream of the latter (Fig. 1GoB). We first studied the HS1,2 interaction with the GL {epsilon} promoter by transiently transfecting B cell lines that corresponded to different stages of B cell development. Cells were either induced by IL-4 plus anti-CD40 Abs or left without stimuli following transfection. The results are shown in Fig. 2Go. In the pre-B cell line, 70Z, the promoter was induced by the stimuli, but the presence of HS1,2 inhibited the activity. In the plasma cell line, S194, HS1,2 enhanced GL {epsilon} promoter activity ~25-fold, but the promoter did not respond to the stimuli. We used three mature B cell lines (A20, L10, and M12.4.1) to investigate HS1,2 activity. All three cell lines have been used extensively in GL promoter studies and are known to respond to IL-4 stimulation and to induce exogenous GL {epsilon} and {gamma}1 promoters (37, 69). Despite this, HS1,2 promoter synergy was divergent. In the L10 cells, GL {epsilon} promoter activity was elevated ~6-fold by the enhancer in the nonstimulated condition and a further 2.5-fold when induced by IL-4 and anti-CD40. In the M12.4.1 cell line, the GL {epsilon} promoter was strongly induced by the stimuli, but the presence of the HS1,2 was repressive. The A20 cells showed an intermediate pattern; the promoter activity was enhanced 2-fold by HS1,2 when stimuli were absent, but not in their presence. In the T cell line, EL4, the enhancer was inactive and the GL {epsilon} promoter could not be induced by stimuli.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. GL {epsilon} promoter-HS1,2 enhancer activity in various cell lines. The pre-B cell line 70Z, the plasma cell line S194, the mature B cell lines L10, M12.4.1, and A20, and the T cell line EL4 were used for transient transfection of the indicated constructs. Following transfection, cells were cultured in the presence or absence of the stimuli shown. Luciferase activity was normalized by comparing with {beta}-galactosidase expression and presented as relative luciferase activity. Results represent the mean value of triplicates ± SD from one representative experiment.

 
Both GL {epsilon} and {gamma}2b promoters are enhanced by HS1,2 in activated primary B cells

Because the data above demonstrate that mature B cell lines are not suitable for studying interactions between GL promoters and the HS1,2 enhancer, we tried transfecting primary B cells. First, we tested transfection efficiency using CMV promoter-reporter constructs. Nonstimulated, resting B cells from murine spleen could not be transfected, whereas B cells stimulated for 2 days with mitogenic stimuli could be transfected. LPS stimulation led to higher transfection efficiency than stimulation with LPS plus IL-4, anti-CD40, or anti-CD40 plus IL-4 (data not shown). For this reason, we used LPS-stimulated B cells in the experiments described here. We also found that it was important to measure activity soon after transfection (see Materials and Methods).

We transiently transfected LPS blast with constructs containing either GL {epsilon} or {gamma}2b promoters and thereafter recultured the cells with or without various stimuli. In Table IGo, the mean results from several experiments are shown, in which data are calculated relative to the activities obtained for the {epsilon} or {gamma}2b promoter constructs without HS1,2 and without stimuli. Both promoters were enhanced by HS1, 2 (the {epsilon} promoter 9-fold and the {gamma}2b promoter 6.7-fold, on average). The {epsilon} promoter constructs, with or without HS1, 2, could be further induced by IL-4, LPS plus IL-4, or anti-CD40 plus IL-4, but not by LPS or anti-CD40 when given alone. The {gamma}2b promoter was not induced by any stimuli but was, in fact, inhibited by IL-4 plus anti-CD40. The observation that the {epsilon} promoter constructs were induced by anti-CD40 and IL-4 is in accordance with published data (37, 38). The endogenous {gamma}2b promoter can be induced with LPS or CD40 ligation (43, 45). Because LPS was added to the cells before transfection, this signal might be stably induced so that further addition of LPS or anti-CD40 after transfection would have no effect. For simplicity, we chose one stimulation condition in the experiments shown below, i.e., anti-CD40 plus IL-4 for the {epsilon} promoter constructs and LPS or anti-CD40 for the {gamma}2b promoter constructs. Fig. 3Go shows two typical experiments of this kind, with statistical values (see legend).


View this table:
[in this window]
[in a new window]
 
Table I. Activity of GL {epsilon} and {gamma}2b promoters with or without HS1,2 in primary B cells: effects of different stimuli1

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3. HS1,2 enhances the GL {epsilon} and {gamma}2b promoters in activated primary B cells. Splenic B cells were activated by LPS for 2 days and subsequently transfected. After transfection, cells were induced by IL-4 plus anti-CD40, by LPS, or they were left unstimulated, as indicated. Stimuli before and after transfection are shown separated by a slash. Luciferase activity was calculated as for Fig. 2Go. HS1,2 enhancement of the GL promoters and stimulation of GL {epsilon} promoter by IL-4 plus anti-CD40 is significant (p < 0.005).

 
As discussed above, LPS-stimulated cells were more amenable to transfection than B cells stimulated with either LPS plus IL-4 or anti-CD40. We tested whether B cells that were stimulated with LPS plus IL-4 before transfection would respond to the GL promoter constructs. Both {epsilon} and {gamma}2b promoter constructs were expressed, and the level of synergy with HS1,2 was similar to that shown in Table IGo and Fig. 3Go. However, the {epsilon} constructs were not induced with anti-CD40 plus IL-4, probably because the cells were already stimulated with IL-4 before transfection (data not shown). LPS-activated B cells express GL {gamma}2b and {gamma}3 transcripts, whereas LPS plus IL-4-activated cells express GL {gamma}1 and {epsilon} transcripts. Thus, these data indicate that the response of activated primary B cells to GL promoter-HS1,2 constructs is independent of the expression of certain endogenous GL transcripts.

The conserved region of the HS1,2 enhancer contains most of its activity

Earlier studies revealed several stimulatory and inhibitory factors that regulate activity through their binding to specific elements in the HS1,2 enhancer (47, 48, 49, 50, 51, 52, 53, 54). In one previous study, the rat HS1,2 enhancer was subdivided into fragments A, B, and C (70), whereas the mouse enhancer has not been similarly subdivided.

We wished to determine which regions are most important for synergy with the GL promoters, so we tested the effects of three subfragments of HS1,2 of equal size, which we call I, II, and III (Fig. 4GoA). Fragment II synergized with the {epsilon} promoter at a level similar to the entire HS1,2 enhancer fragment, whereas fragment I was significantly inhibitory (p < 0.05) compared with constructs that lacked the enhancer (Fig. 4GoB). Fragment III had no effect on the promoters (data not shown). We also studied the activities of fragments I and II in the L10 cell line, because in this cell line HS1,2 showed a similar activity to that seen in the primary cells. Fragment I was also inhibitory in L10 cells, whereas fragment II contained only ~60–70% of the response observed in the intact enhancer, showing that the HS1,2 activity in L10 cells differs somewhat from that in primary B cells (data not shown).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 4. Synergy with the GL {epsilon} promoter is dependent on the central portion of HS1,2. A, Schematic outline of the HS1,2 enhancer showing three fragments with transcription-factor binding sites (figure is not to scale). BSAP binding site b is the higher affinity site. B, Activity of fragments I and II compared with full-length enhancer in activated primary B cells. Posttransfection cells were induced by IL-4 plus anti-CD40, by LPS, or they were left unstimulated. Luciferase activity was calculated as for Fig. 2Go. The asterisks show significance (p < 0.05) of inhibition of the GL {epsilon} promoter’s basal activity by fragment I.

 
Fragments I and II span fragments B and A used in the early studies of rat HS1,2 enhancer (70). Fragments B (containing a G-rich box, BSAP, NF-{alpha}P, NF-{kappa}B, and E1 sites) and A (containing E5, OCT, and NF-AB sites) used by Grant et al. (70) contributed to 30 and 60% of the activity of HS1,2, respectively, when transfected into B cell lines. Fragment II contains all fragment A sites in addition to BSAP site a and E1, µB-like, and NF-{kappa}B sites. The higher activity of fragment II compared with fragment A studied by Grant et al. could depend on those additional transcription factor sites or differences between systems used in the two studies.

The NF-{kappa}B and NF-AB sites are differentially important for HS1,2 interaction with the GL {epsilon} and {gamma}2b promoters

We wished to investigate the importance of previously determined transcription-factor binding sites in the HS1,2 enhancer. We first mutated the NF-{kappa}B site, because this site has been shown to be important for enhancer activity in several studies (48, 50, 51). Surprisingly, in primary B cells, the HS1,2 enhancer with the NF-{kappa}B site mutation was as potent as the wild-type enhancer in inducing increased activity of the GL {epsilon} promoter (Fig. 5Go, A and D). In fact, in some experiments, the mutated construct induced a significantly higher (120–160%) enhancement compared with the wild-type one (data not shown). However, synergy with the GL {gamma}2b promoter was significantly reduced to 60–70% of wild-type activity when the NF-{kappa}B site was mutated (Fig. 5Go, A and D). The activity of HS1,2 combined with GL {gamma}2b promoter was also reduced to the same extent when cells were stimulated with IL-4 plus anti-CD40 (data not shown). These results indicate that NF-{kappa}B proteins are differentially involved in the interaction of HS1,2 with specific GL promoters.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 5. GL {epsilon} and {gamma}2b promoters interact differently with the HS1,2 enhancer. Mutations were introduced in HS1,2 at the indicated transcription-factor binding sites, and the capacity of the enhancer to interact with the GL promoters was assayed. Primary B cells were transfected with constructs containing the GL {epsilon} (upper graphs) or {gamma}2b (lower graphs) promoters. After transfection, cells were incubated either alone or with the indicated stimuli. Luciferase activity was calculated as for Fig. 2Go. The asterisks show a significant reduction of cells transfected with mutated constructs compared with similarly treated cells expressing wild-type constructs (A and C, p < 0.05; and B, p < 0.01). A, Mutation in the NF-{kappa}B site; B, mutation in the NF-AB site; C, mutation in the octamer motif; and D, a summary of three to six experiments given in arbitrary values compared with values for the wild-type enhancer. Dashed lines show abolishment of enhancer activity; -, partial decrease; +, increase; and 0, no effect of mutation on enhancer activity.

 
We then investigated the NF-AB site. It has been shown to be important for B cell receptor- and CD40-dependent stimulation via binding to the Ets/AP-1 family of proteins (46, 54). Deletion of this site resulted in a complete reduction of HS1,2 activity in the construct containing the GL {epsilon} promoter. In the cells induced by IL-4 plus anti-CD40, it was even inhibitory when compared with the response of the promoter alone (Fig. 5Go, B and D). The NF-AB site deletion also had a negative effect on the GL {gamma}2b promoter activity, although it was less marked. The mutated HS1,2 significantly enhanced the promoter (p < 0.005 in all experiments) to ~40–50% of wild-type enhancer activity (Fig. 5Go, B and D). From these results, we conclude that different sites in HS1,2 may interact with various GL promoters, which involves selective sets of transcription factors that bind HS1,2 in activated primary B cells.

An octamer motif mutation reduces HS1,2 activity when combined with the GL {epsilon} or {gamma}2b promoters

The OCT motif has been shown to contribute to HS1,2 activity in several studies (51, 52) and was therefore our next target. The HS1,2 carrying an OCT motif mutation showed reduced enhancer activity when combined with either GL {epsilon} or {gamma}2b promoters (Fig. 5Go, C and D). Enhancement of the GL {epsilon} promoter was significantly reduced only when cells were stimulated with IL-4 plus anti-CD40. When combined with the {gamma}2b promoter, the activity of the HS1,2 enhancer containing the OCT mutation was reduced both in the presence and absence of anti-CD40.

The BSAP higher affinity site is not inhibitory when HS1,2 is combined with the GL {epsilon} promoter

We have shown above that fragment I of HS1,2 inhibits GL {epsilon} promoter activity in primary B cells (Fig. 4GoB). There are two BSAP binding sites in HS1,2, with a higher affinity site present in fragment I. Its role in HS1,2 activity has been studied extensively (48, 53, 55, 56). Our system is unique in that it contains BSAP binding elements that are involved in both positive and negative regulation. The BSAP binding site in the GL {epsilon} promoter is required for activity of the latter (39, 71), whereas the site in HS1,2 is inhibitory (51, 55). Surprisingly, deletion of the higher affinity BSAP site in HS1,2 did not affect its capacity to synergize with the GL {epsilon} promoter in primary B cells (Fig. 6GoA). The presence of HS1,2 reduced the activity of the GL {epsilon} promoter in the M12.4.1 cell line as shown in Fig. 2Go. To see whether BSAP was responsible for this effect, we transfected this cell line with the {epsilon} prom.-HS1,2 BSAP mut. plasmid. Indeed, the construct carrying the BSAP site deletion in HS1,2 was 2.5-fold more active than that containing the wild-type enhancer and gave a significantly higher response than with the promoter alone (Fig. 6GoB). Because the BSAP higher affinity site is located within fragment I, one might expect that fragment II, which does not contain functional BSAP sites, would enhance promoter activity in M12.4.1 cells. As shown in Fig. 6GoC, fragment II increased GL {epsilon} promoter activity ~1.4-fold compared with the promoter alone. This response was significantly different to that induced by the wild-type enhancer, but much lower than that in primary B cells (compare Figs. 6GoC and 4B). These data imply that BSAP can act as a repressor through binding HS1,2 in M12.4.1 cells, but that it is not the only reason for the lack of synergy observed between the {epsilon} promoter and HS1,2 in the M12.4.1 cell line.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 6. Evidence for BSAP as a negative regulator in cell lines, but not in primary B cells. A, Activity of a mutated BSAP higher affinity site in the HS1,2 enhancer in primary B cells. Following transfection, cells were induced by IL-4 plus anti-CD40 or left without stimulation. B, Activity of a mutated BSAP higher affinity site in the HS1,2 enhancer in a M12.4.1 cell line. The asterisks show a significant increase in mutated BSAP HS1,2 activity compared with wild-type enhancer in a M12.4.1 cell line. C, Activity of HS1,2 fragment II in a M12.4.1 cell line. The asterisk denotes a significant (p < 0.01) increase in the activity of fragment II-containing plasmid compared with full-length enhancer. Luciferase activity was calculated as for Fig. 2Go.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies using different promoters (VH, VL, human {beta}-globin, and c-myc) coupled to mouse IgH distal enhancer elements have demonstrated their activation during the late stages of B cell differentiation (13, 21, 55, 72). The highest activity was reached when all four enhancer elements (HS3A, HS1, 2, HS3B, and HS4) were combined together (52, 72, 73), demonstrating some features of LCR (13, 74). Many of those studies used constructs in which the enhancer elements were placed upstream of, and in close proximity to, the promoter and the reporter gene (13, 21, 48, 49). It is possible that the location and the distance between the promoter and the enhancer are crucial for their interaction as shown for Eµ and HS1,2 (66). Single enhancer elements are indeed weaker when placed 2 kb downstream of the reporter gene. When cloned upstream, HS1,2 enhances the V{lambda} promoter 35- to 80-fold in the S194 plasmacytoma cell line (51, 55), but only enhances the VH promoter 2- to 3-fold when cloned downstream of the reporter (72). In the present study, HS1,2 elevated GL {epsilon} promoter activity ~20-fold in S194 cells. It is possible that these differences are dependent, to some extent, on the promoter used, but it is likely that the location of the enhancer also plays a role. Results from transient transfections of the M12.4.1 cell line also strengthen this interpretation. In the M12.4.1 cell line, HS1,2, when cloned upstream of the reporter, caused a 4- to 5-fold enhancement in one study (51) and a 25-fold enhancement in another study (55). We show here that HS1,2 is inhibitory in the M12.4.1 cell line, in agreement with findings from Ong et al. (72), in which constructs containing the enhancer elements downstream of the reporter were used, with no HS1,2 activity observed in the M12.4.1 cell line.

We tested three murine B cell lines for synergy responses between the GL promoters and the HS1,2 enhancer. Surprisingly, only one cell line, L10, supported synergy, whereas the other two, M12.4.1 and A20, did not. It has been shown previously that BSAP represses HS1,2 activity in M12.4.1 and A20 cell lines. However, this is not the mechanism for the lack of synergy with the GL promoters, because fragment II of HS1,2 (which lacks the BSAP binding site) has low activity in M12.4.1 cells (Fig. 6GoC). Previous studies of the GL {gamma}1 promoter in L10 and A20 cells have indicated that at least one transcription factor differs between these cell lines (69). The same factor or factors could also be important for HS1,2 activity. An interesting possibility is that the difference in supporting synergy is reflected in their degree of differentiation. Both A20 and M12.4.1 express IgG, whereas L10 expresses IgM (59, 60, 69). Thus, optimal synergy might depend on a transiently activated transcription factor or cofactor, which is down-regulated when B cells have undergone Ig class switching.

Regulation of HS1,2 activity has been shown to involve both activation and repression factors, and our data adds to this knowledge. Fragment I of HS1,2 inhibited promoter activity in primary B cells (Fig. 4GoB). This might not be surprising because this fragment contains the higher affinity BSAP binding site shown to be the main negative regulator of HS1,2 activity. The deletion of the BSAP site had no significant effect on HS1,2 and GL {epsilon} promoter synergy in primary B cells. It has been shown that the BSAP binding site in the GL {epsilon} promoter is necessary for its activity, and that the affinity of this site is higher than that in the HS1,2 enhancer (39, 75). It is possible that the presence of low levels of BSAP could be enough to activate the promoter, but not to suppress the enhancer. However, although BSAP levels diminish as B cells differentiate into plasma cells, they are still high in cells stimulated by LPS for 2 days (56, 76). Our data argue that BSAP is not an absolute repressor of the enhancer, but its regulation is much more complex and likely to be dependent on other factors, as also proposed by others (51, 53, 56).

Fragment II of HS1,2 has the same activity as intact HS1,2 in primary B cells, which probably means that the major activating factors bind within this fragment. In this respect, it is not surprising that it contains a 135-bp core homology region that is 90% identical with a corresponding fragment in human HS1,2 (14). The NF-{kappa}B, OCT, and NF-AB sites are located in this fragment and have been shown previously to be important for enhancer activity (46, 48, 54).

The NF-{kappa}B site contributes to 40% of the enhancer activity in a plasma cell line, as previous studies have indicated (48). In the current study, mutation of the NF-{kappa}B site reduced HS1,2 activity when combined with the GL {gamma}2b but not the GL {epsilon} promoter. This mutation clearly separates activation of two GL promoters by HS1,2. The GL {epsilon} promoter contains two NF-{kappa}B sites, which have been shown to be important for promoter activity (38). The presence of these sites might render the NF-{kappa}B site in the HS1,2 enhancer less important for GL {epsilon} promoter-HS1,2 interactions. To our knowledge, it is not known whether there are any NF-{kappa}B binding sites in the GL {gamma}2b promoter, but none were found using a program to identify transcription-factor binding sites. However, we cannot exclude their existence.

The most crucial site for HS1,2 activity in activated primary B cells is the NF-AB (Ets/AP-1) site. The NF-AB complex is induced by CD40 or BCR ligation and consists of Ets/AP-1 family proteins including Elf-1, Jun-B, and c-Fos (46, 54). We deleted the NF-AB site to destroy all possible binding sites for this complex, and this led to a complete reduction in synergy between HS1,2 and the GL {epsilon} promoter. In fact, the mutation even suppressed the induced promoter activity. However, it had a milder effect on the GL {gamma}2b promoter because HS1,2 activity was reduced, but significant enhancement was still detected in all experiments. It has been shown that Ets protein family members and BSAP can form functional complexes (77, 78), making it possible that an interaction takes place between Elf-1 (binding the enhancer) and BSAP (binding the GL {epsilon} promoter). Disruption of this complex may enable BSAP to bind inhibitory factors instead. However, by deleting the NF-AB binding site in HS1,2, we not only abolished NF-AB binding but also altered the spacing between other sites, which could also influence the outcome, as demonstrated for other enhancers (for review, see Ref. 79).

A role for the OCT site in the activity of distal IgH locus enhancers in vivo has been suggested from data showing that OCA-B-knockout mice have reduced transcription of switched Ig classes (80). Using transient transfections of activated B cells from OCA-B-knockout mice, it was shown that IL-4 plus anti-CD40 activation of all four distal IgH enhancers did not take place, but exact sites were not specified (52). We show here that the OCT site contributes to HS1,2 activity in combination with both of the GL promoters tested. This site seems to be more important for HS1,2 activity with a stimulated promoter as opposed to an unstimulated one. This is consistent with the notion that OCT 2 is up-regulated by LPS (81) and OCA-B by IL-4 and CD40 signals (82), implying that these stimuli could act on the HS1,2 octamer site.

Taken together, our data indicate possible interactions of GL promoters with the HS1,2 enhancer in primary B cells. We show that weak promoters such as the GL promoters can be converted to relatively strong ones in the presence of HS1,2, allowing detection of their activities in primary B cells. Together with published findings, our data imply that specific factors seem to contribute to enhancer activity in different ways, depending on the promoter. Most likely, transcription factors that bind the enhancer may cooperate to form a specific activating surface. This surface would also interact with activating proteins in the promoter region and with the basal transcription machinery, as indicated from studies of the IFN-{beta} enhancesome (83, 84). We provide evidence that different DNA binding factors could be responsible for the interactions between the enhancer and GL promoters. It could be that different enhancer-activating surfaces areoptimal for enhancer interactions with specific GL promoters, also allowing GL promoter competition for the enhancer depending on which transcription factors are activated.

Conclusions based on transient transfection experiments always have limitations and cannot totally reflect promoter-enhancer interactions at the endogenous locus. Although in transient transfections of primary B cells only a small portion of the HS1,2 enhancer is enough to achieve synergy with GL promoters, the entire unit is most likely required to provide an enhancer-activating surface at the endogenous locus. The findings reported here of the HS1,2 sites important for synergy may provide a starting point for more elaborate studies using transgene technology.


    Acknowledgments
 
We thank Mary-Rose Hoja for proofreading the manuscript.


    Footnotes
 
1 This work was supported by Vårdalstiftelsen, Swedish Natural Science Council Foundation, Swedish Institute, and Karolinska Institutet. Back

2 Address correspondence and reprint requests to Dr. Jurga Laurencikiene, Department of Cell and Molecular Biology, Karolinska Institutet, SE-171 77 Stockholm, Sweden. E-mail address: Jurga.Laurencikiene{at}cmb.ki.se Back

3 Abbreviations used in this paper: LCR, locus control region; BSAP, B cell-specific activator protein; CSR, class switch recombination; Eµ, IgH intronic enhancer; GL, germline; NF-AB, NF of activated B cells. Back

Received for publication February 7, 2001. Accepted for publication July 25, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hardison, R., J. L. Slightom, D. L. Gumucio, M. Goodman, N. Stojanovic, W. Miller. 1997. Locus control regions of mammalian {beta}-globin gene clusters: combining phylogenetic analyses and experimental results to gain functional insights. Gene 205:73.[Medline]
  2. Fraser, P., F. Grosveld. 1998. Locus control regions, chromatin activation and transcription. Curr. Opin. Cell Biol. 10:361.[Medline]
  3. Engel, J. D., K. Tanimoto. 2000. Looping, linking, and chromatin activity: new insights into {beta}-globin locus regulation. Cell 100:499.[Medline]
  4. Staudt, L., M. J. Lenardo. 1991. Immunoglobulin gene transcription. Annu. Rev. Immunol. 9:373.[Medline]
  5. Rudin, C., C. Thompson. 1998. B-cell development and maturation. Semin. Oncol. 25:435.[Medline]
  6. Stavnezer, J.. 2000. Molecular processes that regulate class switching. Curr. Top. Microbiol. Immunol. 245:127.[Medline]
  7. Baneriji, J., L. Olson, W. Shaffner. 1983. A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell 33:729.[Medline]
  8. Gillies, S. D., S. L. Morrison, V. T. Oi, S. Tonegawa. 1983. A tissue-specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene. Cell 33:717.[Medline]
  9. Pettersson, S., G. P. Cook, M. Bruggemann, G. T. Williams, M. S. Neuberger. 1990. A second B cell-specific enhancer 3' of the immunoglobulin heavy-chain locus. Nature 344:165.[Medline]
  10. Dariavach, P., G. T. Williams, K. Campbell, S. Pettersson, M. S. Neuberger. 1991. The mouse IgH 3'-enhancer. Eur. J. Immunol. 21:1499.[Medline]
  11. Lieberson, R., S. L. Giannini, B. K. Birshtein, L. A. Eckhardt. 1991. An enhancer at the 3' end of the mouse immunoglobulin heavy chain locus. Nucleic Acids Res. 19:933.[Abstract/Free Full Text]
  12. Matthias, P., D. Baltimore. 1993. The immunoglobulin heavy chain locus contains another B-cell-specific 3' enhancer close to the {alpha} constant region. Mol. Cell. Biol. 13:1547.[Abstract/Free Full Text]
  13. Madisen, L., M. Groudine. 1994. Identification of a locus control region in the immunoglobulin heavy-chain locus that deregulates c-myc expression in plasmacytoma and Burkitt’s lymphoma cells. Genes Dev. 8:2212.[Abstract/Free Full Text]
  14. Mills, F. C., N. Harindranath, M. Mitchell, E. E. Max. 1997. Enhancer complexes located downstream of both human immunoglobulin C{alpha} genes. J. Exp. Med. 186:845.[Abstract/Free Full Text]
  15. Chen, C., B. K. Birshtein. 1997. Virtually identical enhancers containing a segment of homology to murine 3'IgH-E(hs1,2) lie downstream of human Ig C{alpha}1 and C{alpha}2 genes. J. Immunol. 159:1310.[Abstract]
  16. Grosschedl, R., D. Weaver, D. Baltimore, F. Costantini. 1984. Introduction of a mu immunoglobulin gene into the mouse germ line: specific expression in lymphoid cells and synthesis of functional antibody. Cell 38:647.[Medline]
  17. Serwe, M., F. Sablitzky. 1993. V(D)J recombination in B cells is impaired but not blocked by targeted deletion of the immunoglobulin heavy chain intron enhancer. EMBO J. 12:2321.[Medline]
  18. Chen, J., F. Young, A. Bottaro, V. Stewart, R. K. Smith, F. W. Alt. 1993. Mutations of the intronic IgH enhancer and its flanking sequences differentially affect accessibility of the JH locus. EMBO J. 12:4635.[Medline]
  19. Bottaro, A., F. Young, J. Chen, M. Serwe, F. Sablitzky, F. W. Alt. 1998. Deletion of the IgH intronic enhancer and associated matrix-attachment regions decreases, but does not abolish, class switching at the µ locus. Int. Immunol. 10:799.[Abstract/Free Full Text]
  20. Khamlichi, A. A., E. Pinaud, C. Decourt, C. Chauveau, M. Cogne. 2000. The 3' IgH regulatory region: a complex structure in a search for a function. Adv. Immunol. 75:317.[Medline]
  21. Arulampalam, V., P. A. Grant, A. Samuelsson, U. Lendahl, S. Pettersson. 1994. Lipopolysaccharide-dependent transactivation of the temporally regulated immunoglobulin heavy chain 3' enhancer. Eur. J. Immunol. 24:1671.[Medline]
  22. Cogne, M., R. Lansford, A. Bottaro, J. Zhang, J. Gorman, F. Young, H. L. Cheng, F. W. Alt. 1994. A class switch control region at the 3' end of the immunoglobulin heavy chain locus. Cell 77:737.[Medline]
  23. Manis, J. P., N. van der Stoep, M. Tian, R. Ferrini, L. Davidson, A. Bottaro, F. W. Alt. 1998. Class switching in B cells lacking 3' immunoglobulin heavy chain enhancers. J. Exp. Med. 188:1421.[Abstract/Free Full Text]
  24. Saleque, S., M. Singh, B. K. Birshtein. 1999. Ig heavy chain expression and class switching in vitro from an allele lacking the 3' enhancers DNase I-hypersensitive hs3A and hs1,2. J. Immunol. 162:2791.[Abstract/Free Full Text]
  25. Pan, Q., F. C. Petit, J. Stavnezer, L. Hammarström. 2000. Regulation of the promoter for human immunoglobulin {gamma}3 germline transcription and its interaction with the 3' {alpha} enhancer. Eur. J. Immunol. 30:1019.[Medline]
  26. Hu, Y., Q. Pan, E. Pardali, F. C. Mills, R. M. Bernstein, E. E. Max, P. Sideras, L. Hammarstrom. 2000. Regulation of germline promoters by the two human Ig heavy chain 3' {alpha} enhancers. J. Immunol. 164:6380.[Abstract/Free Full Text]
  27. Jung, S., K. Rajewsky, A. Radbruch. 1993. Shutdown of class switch recombination by deletion of a switch region control element. Science 259:984.[Abstract]
  28. Zhang, J., A. Bottaro, S. Li, V. Stewart, F. W. Alt. 1993. A selective defect in IgG2b switching as a result of targeted mutation of the I{gamma}2b promoter and exon. EMBO J. 12:3529.[Medline]
  29. Coffman, R. L., J. Ohara, W. M. Bond, J. Carty, A. Zlotnik, W. E. Paul. 1986. B cell stimulatory factor-1 enhances the IgE response of lipopolysaccharide-activated B cells. J. Immunol. 135:4538.
  30. Snapper, C. M., F. D. Finkelman, W. E. Paul. 1988. Differential regulation of IgG1 and IgE synthesis by interleukin-4. J. Exp. Med. 167:183.[Abstract/Free Full Text]
  31. Stavnezer, J., G. Radcliffe, Y. C. Lin, J. Nietupski, L. Berggren, R. Sitia, E. Severinson. 1988. Immunoglobulin heavy-chain switching may be directed by prior induction of transcripts from constant-region genes. Proc. Natl. Acad. Sci. USA 85:7704.[Abstract/Free Full Text]
  32. Gerondakis, S.. 1990. Structure and expression of murine germ-line immunoglobulin {epsilon} heavy chain transcripts induced by interleukin 4. Proc. Natl. Acad. Sci. USA 87:1581.[Abstract/Free Full Text]
  33. Warren, W. D., M. T. Berton. 1995. Induction of germline {gamma}1 and {epsilon} Ig gene expression in murine B cells. J. Immunol. 155:5637.[Abstract]
  34. Snapper, C. M., M. R. Kehry, B. E. Castle, J. J. Mond. 1995. Multivalent, but not divalent, antigen receptor crosslinkers synergize with CD40 ligand for induction of Ig synthesis and class switching in normal murine B cells. J. Immunol. 154:1177.[Abstract]
  35. Rothman, P., S. C. Li, B. Gorham, L. Glimcher, F. Alt, M. Boothby. 1991. Identification of a conserved lipopolysaccharide-plus-interleukin-4-responsive element located at the promoter of germline {epsilon} transcripts. Mol. Cell. Biol. 11:5551.[Abstract/Free Full Text]
  36. Hou, L., U. Schindler, W. J. Henzel, T. C. Ho, M. Brasseur, S. L. McKnight. 1994. An interleukin-4 induced transcription factor: IL-4 Stat. Science 265:1701.[Abstract/Free Full Text]
  37. Delphin, S., J. Stavnezer. 1995. Characterization of an interleukin 4 (IL-4) responsive region in the immunoglobulin heavy chain germline {epsilon} promoter: regulation by NF-IL-4, a C/EBP family member and NF-{kappa}B/p50. J. Exp. Med. 181:181.[Abstract/Free Full Text]
  38. Iciek, L. A., S. A. Delphin, J. Stavnezer. 1997. CD40 cross-linking induces Ig {epsilon} germline transcripts in B cells via activation of NF-{kappa}B: synergy with IL-4 induction. J. Immunol. 158:4769.[Abstract]
  39. Liao, F., B. K. Birshtein, M. Busslinger, P. Rothman. 1994. The transcription factor BSAP (NF-HB) is essential for immunoglobulin germline {epsilon} transcription. J. Immunol. 152:2904.[Abstract]
  40. Stütz, A. M., M. Woisetschläger. 1999. Functional synergism of STAT6 with either NF-{kappa}B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J. Immunol. 163:4383.[Abstract/Free Full Text]
  41. Harris, M. B., C. C. Chang, M. T. Berton, N. N. Danial, J. Zhang, D. Kuehner, B. H. Ye, M. Kvatyuk, P. P. Pandolfi, G. Cattoretti, R. Dalla-Favera, P. B. Rothman. 1999. Transcriptional repression of Stat6-dependent interleukin-4-induced genes by BCL-6: specific regulation of I{epsilon} transcription and immunoglobulin E switching. Mol. Cell. Biol. 19:7264.[Abstract/Free Full Text]
  42. Shen, C. H., J. Stavnezer. 2001. Activation of the mouse Ig germline epsilon promoter by IL-4 is dependent on AP-1 transcription factors. J. Immunol. 166:411.[Abstract/Free Full Text]
  43. Lutzker, S., P. Rothman, R. Pollock, R. Coffman, F. W. Alt. 1988. Mitogen- and IL-4-regulated expression of germ-line Ig {gamma}2b transcripts: evidence for directed heavy chain class switching. Cell 53:177.[Medline]
  44. McIntyre, T. M., D. R. Klinman, P. Rothman, M. Lugo, J. R. Dasch, J. J. Mond, C. M. Snapper. 1993. Transforming growth factor {beta}1 selectivity stimulates immunoglobulin {gamma}2b secretion by lipopolysaccharide-activated murine B cells. J. Exp. Med. 177:1031.[Abstract/Free Full Text]
  45. Ström, L., J. Laurencikiene, A. Miskiniene, E. Severinson. 1999. Characterization of CD40-dependent immunoglobulin class switching. Scand. J. Immunol. 49:523.[Medline]
  46. Grant, P. A., T. Andersson, M. F. Neurath, V. Arulampalam, A. Bauch, R. Müller, M. Reth, S. Pettersson. 1996. A T cell controlled molecular pathway regulating the IgH locus: CD40-mediated activation of the IgH 3' enhancer. EMBO J. 15:6691.[Medline]
  47. Meyer, K. B., M. Skogberg, C. Margenfeld, J. Ireland, S. Pettersson. 1995. Repression of the immunoglobulin heavy chain 3' enhancer by helix-loop-helix protein Id3 via a functionally important E47/E12 binding site: implications for developmental control of enhancer function. Eur. J. Immunol. 25:1770.[Medline]
  48. Michaelson, J. S., M. Singh, C. M. Snapper, W. C. Sha, D. Baltimore, B. K. Birshtein. 1996. Regulation of 3' IgH enhancers by a common set of factors, including {kappa}B-binding proteins. J. Immunol. 156:2828.[Abstract]
  49. Linderson, Y., D. Cross, M. F. Neurath, S. Pettersson. 1997. NFE, a new transcriptional activator that facilitates p50 and c-Rel-dependent IgH 3' enhancer activity. Eur. J. Immunol. 27:468.[Medline]
  50. Zelazowski, P., Y. Shen, C. M. Snapper. 2000. NF-{kappa}B/p50 and NF-{kappa}B/c-Rel differentially regulate the activity of the 3' {alpha}E-hsl,2 enhancer in normal murine B cells in an activation-dependent manner. Int. Immunol. 12:1167.[Abstract/Free Full Text]
  51. Singh, M., B. K. Birshtein. 1996. Concerted repression of an immunoglobulin heavy-chain enhancer, 3' {alpha}E(hs1, 2). Proc. Natl. Acad. Sci. USA 93:4392.[Abstract/Free Full Text]
  52. Stevens, S., J. Ong, U. Kim, L. A. Eckhardt, R. G. Roeder. 2000. Role of OCA-B in 3'-IgH enhancer function. J. Immunol. 164:5306.[Abstract/Free Full Text]
  53. Neurath, M. F., E. E. Max, W. Strober. 1995. Pax5 (BSAP) regulates the murine immunoglobulin 3' {alpha} enhancer by suppressing binding of NF-{alpha}P, a protein that controls heavy chain transcription. Proc. Natl. Acad. Sci. USA 92:5336.[Abstract/Free Full Text]
  54. Grant, P. A., C. B. Thompson, S. Pettersson. 1995. IgM receptor-mediated transactivation of the IgH 3' enhancer couples a novel Elf-1-AP-1 protein complex to the developmental control of enhancer function. EMBO J. 14:4501.[Medline]
  55. Singh, M., B. K. Birshtein. 1993. NF-HB (BSAP) is a repressor of the murine immunoglobulin heavy-chain 3' {alpha} enhancer at early stages of B-cell differentiation. Mol. Cell. Biol. 13:3611.[Abstract/Free Full Text]
  56. Andersson, T., M. F. Neurath, P. A. Grant, S. Pettersson. 1996. Physiological activation of the IgH 3' enhancer in B lineage cells is not blocked by Pax-5. Eur. J. Immunol. 26:2499.[Medline]
  57. Seidl, K. J., A. Bottaro, A. Vo, J. Zhang, L. Davidson, F. W. Alt. 1998. An expressed neor cassette provides required functions of the I{gamma}2b exon for class switching. Int. Immunol. 10:1683.[Abstract/Free Full Text]
  58. Davey, E. J., W. C. Bartlett, H. Kikutani, H. Fujiwara, T. Kishimoto, D. H. Conrad, E. Severinson. 1995. Homotypic aggregation of murine B lymphocytes is independent of CD23. Eur. J. Immunol. 25:1224.[Medline]
  59. Glimcher, L. H., T. Hamano, R. Asofsky, E. Herber-Katz, S. Hedrick, R. H. Schwartz, W. E. Paul. 1982. I region-restricted antigen presentation by B cell-B lymphoma hybridomas. Nature 298:283.[Medline]
  60. Kim, J. K., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, R. Asofsky. 1979. Establishment and characterisation of BALB/c lymphoma lines with B cell properties. J. Immunol. 122:549.[Abstract/Free Full Text]
  61. Zubler, R. H., C. Werner-Favre, L. Wen, K. Sekita, C. Straub. 1987. Theoretical and practical aspects of B-cell activation: murine and human systems. Immunol. Rev. 99:281.[Medline]
  62. Lutzker, S., F. Alt. 1988. Structure and expression of germ-line immunoglobulin {gamma}2b transcripts. Mol. Cell. Biol. 8:1849.[Abstract/Free Full Text]
  63. Karasuyama, H., F. Melchers. 1988. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4, or 5 using modified cDNA expression vectors. Eur. J. Immunol. 18:97.[Medline]
  64. Heath, A. W., W. W. Wu, M. C. Howard. 1994. Monoclonal antibodies to murine CD40 define two distinct functional epitopes. Eur. J. Immunol. 24:1828.[Medline]
  65. Quandt, K., K. Frech, H. Karas, E. Wingender, T. Werner. 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23:4878.[Abstract/Free Full Text]
  66. Mocikat, R., C. Kardinal, H. G. Klobeck. 1995. Differential interactions between the immunoglobulin heavy chain µ intron and 3' enhancer. Eur. J. Immunol. 25:3195.[Medline]
  67. Chen, H., F. K. Yoshimura. 1998. Spacing between the enhancer and promoter of the long terminal repeat of a murine leukaemia retrovirus is required for transcriptional activation in T cells. J. Gen. Virol. 79:1101.[Abstract]
  68. Collins, J. T., W. A. Dunnick. 1999. Cutting edge: IFN-{gamma} regulated germline transcripts are expressed from {gamma}2a transgenes independently of the heavy chain 3' enhancers. J. Immunol. 163:5758.[Abstract/Free Full Text]
  69. Xu, M. Z., J. Stavnezer. 1992. Regulation of transcription of immunoglobulin germ-line {gamma}1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[Medline]
  70. Grant, P. A., V. Arulampalam, L. Ährlund-R ichter, S. Pettersson. 1992. Identification of Ets-like lymphoid specific elements within the immunoglobulin heavy chain 3' enhancer. Nucleic Acids Res. 20:4401.[Abstract/Free Full Text]
  71. Qiu, G., J. Stavnezer. 1998. Overexpression of BSAP/Pax-5 inhibits switching to IgA and enhances switching to IgE in the I.29µ B cell line. J. Immunol. 161:2906.[Abstract/Free Full Text]
  72. Ong, J., S. Stevens, R. G. Roeder, L. A. Eckhardt. 1998. 3' IgH enhancer elements shift synergistic interactions during B cell development. J. Immunol. 160:4896.[Abstract/Free Full Text]
  73. Chauveau, C., E. Pinaud, M. Cogne. 1998. Synergies between regulatory elements of the immunoglobulin heavy chain locus and its palindromic 3' locus control region. Eur. J. Immunol. 28:3048.[Medline]
  74. Chauveau, C., E. A. Jansson, S. Müller, M. Cogne, S. Pettersson. 1999. Cutting edge: Ig heavy chain 3' HS1–4 directs correct spatial position-independent expression of a linked transgene to B lineage cells. J. Immunol. 163:4637.[Abstract/Free Full Text]
  75. Wallin, J. J., E. R. Gackstetter, M. E. Koshland. 1998. Dependence of BSAP repressor and activator functions on BSAP concentration. Science 279:1961.[Abstract/Free Full Text]
  76. Wakatsuki, Y., M. F. Neurath, E. E. Max, W. Strober. 1994. The B cell-specific transcription factor BSAP regulates B cell proliferation. J. Exp. Med. 179:1099.[Abstract/Free Full Text]
  77. Fitzsimmons, D., W. Hodsdon, W. Wheat, S. M. Maira, B. Wasylyk, J. Hagman. 1996. Pax-5 (BSAP) recruits Ets proto-oncogene family proteins to form functional ternary complexes on a B-cell-specific promoter. Genes Dev. 10:2198.[Abstract/Free Full Text]
  78. Maitra, S., M. Atchison. 2000. BSAP can repress enhancer activity by targeting PU.1 function. Mol. Cell. Biol. 20:1911.[Abstract/Free Full Text]
  79. Carey, M.. 1998. The enhanceosome and transcriptional synergy. Cell 92:5.[Medline]
  80. Kim, U., X. F. Qin, S. Gong, S. Stevens, Y. Luo, M. Nussenzweig, R. G. Roeder. 1996. The B-cell-specific transcription coactivator OCA-B/OBF-1/Bob-1 is essential for normal production of immunoglobulin isotypes. Nature 383:542.[Medline]
  81. Miller, C. L., A. L. Feldhaus, J. W. Rooney, L. D. Rhodes, C. H. Sibley, H. Singh. 1991. Regulation and a possible stage-specific function of Oct-2 during pre-B- cell differentiation. Mol. Cell. Biol. 11:4885.[Abstract/Free Full Text]
  82. Qin, X. F., A. Reichlin, Y. Luo, R. G. Roeder, M. C. Nussenzweig. 1998. OCA-B integrates B cell antigen receptor-, CD40L- and IL 4-mediated signals for the germinal center pathway of B cell development. EMBO J. 17:5066.[Medline]
  83. Kim, T. K., T. Maniatis. 1997. The mechanism of transcriptional synergy of an in vitro assembled interferon-{beta} enhanceosome. Mol. Cell 1:119.[Medline]
  84. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, D. Thanos. 2000. Ordered recruitment of chromatin modifying and general transcription factors to the IFN-{beta} promoter. Cell 103:667.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
J. Laurencikiene, V. Tamosiunas, and E. Severinson
Regulation of {epsilon} germline transcription and switch region mutations by IgH locus 3' enhancers in transgenic mice
Blood, January 1, 2007; 109(1): 159 - 167.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
V. Volgina, P.-C. Yam, and K. L. Knight
A negative regulatory element in the rabbit 3'IgH chromosomal region
Int. Immunol., August 1, 2005; 17(8): 973 - 982.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Lin, S. L. Brody, and S. L. Peng
Restraint of B Cell Activation by Foxj1-Mediated Antagonism of NF-{kappa}B and IL-6
J. Immunol., July 15, 2005; 175(2): 951 - 958.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Reynaud, L. Delpy, L. Fleury, H.-L. Dougier, C. Sirac, and M. Cogne
Interallelic Class Switch Recombination Contributes Significantly to Class Switching in Mouse B Cells
J. Immunol., May 15, 2005; 174(10): 6176 - 6183.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
W. A. Dunnick, J. Shi, K. A. Graves, and J. T. Collins
The 3' end of the heavy chain constant region locus enhances germline transcription and switch recombination of the four {gamma} genes
J. Exp. Med., May 2, 2005; 201(9): 1459 - 1466.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Ushmorov, O. Ritz, M. Hummel, F. Leithauser, P. Moller, H. Stein, and T. Wirth
Epigenetic silencing of the immunoglobulin heavy-chain gene in classical Hodgkin lymphoma-derived cell lines contributes to the loss of immunoglobulin expression
Blood, November 15, 2004; 104(10): 3326 - 3334.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Sepulveda, A. V. Emelyanov, and B. K. Birshtein
NF-{kappa}B and Oct-2 Synergize to Activate the Human 3' Igh hs4 Enhancer in B Cells
J. Immunol., January 15, 2004; 172(2): 1054 - 1064.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. A. Heckman, T. Cao, L. Somsouk, H. Duan, J. W. Mehew, C.-y. Zhang, and L. M. Boxer
Critical Elements of the Immunoglobulin Heavy Chain Gene Enhancers for Deregulated Expression of Bcl-2
Cancer Res., October 15, 2003; 63(20): 6666 - 6673.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Zhang
Accessibility control and machinery of immunoglobulin class switch recombination
J. Leukoc. Biol., March 1, 2003; 73(3): 323 - 332.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Bae, V. C. Calhoun, M. Levine, E. B. Lewis, and R. A. Drewell
Characterization of the intergenic RNA profile at abdominal-A and Abdominal-B in the Drosophila bithorax complex
PNAS, December 24, 2002; 99(26): 16847 - 16852.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. L. Peng, S. J. Szabo, and L. H. Glimcher
T-bet regulates IgG class switching and pathogenic autoantibody production
PNAS, April 16, 2002; 99(8): 5545 - 5550.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laurencikiene, J.
Right arrow Articles by Severinson, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laurencikiene, J.
Right arrow Articles by Severinson, E.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS