|
|
||||||||




*
Division of Hematology-Oncology, Department of Pediatrics, Childrens Hospital Los Angeles and Keck School of Medicine, University of Southern California, Los Angeles, CA 90027;
Division of Developmental Immunology, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121; and
Kimmel Cancer Center, Department of Microbiology and Immunology, Jefferson Medical College, Philadelphia, PA 19107
| Abstract |
|---|
|
|
|---|
-Galactosylceramide (
GalCer) stimulates NKT cells and has
antitumor activity in mice. Murine NKT cells may directly kill tumor
cells and induce NK cell cytotoxicity, but the mechanisms are not well
defined. Newly developed human CD1d/
GalCer tetrameric complexes were
used to obtain highly purified human
GalCer-reactive NKT cell lines
(>99%), and the mechanisms of NKT cell cytotoxicity and activation of
NK cells were investigated. Human NKT cells were cytotoxic against
CD1d- neuroblastoma cells only when they were rendered
CD1d+ by transfection and pulsed with
GalCer. Four other
CD1d- tumor cell lines of diverse origin were resistant to
NKT cells, whereas Jurkat and U937 leukemia cell lines, which are
constitutively CD1d+, were killed. Killing of the latter
was greatly augmented in the presence of
GalCer. Upon human
CD1d/
GalCer recognition, NKT cells induced potent cytotoxicity of NK
cells against CD1d- neuroblastoma cell lines that were not
killed directly by NKT cells. NK cell activation depended upon NKT cell
production of IL-2, and was enhanced by secretion of IFN-
. These
data demonstrate that cytotoxicity of human NKT cells can be CD1d and
ligand dependent, and that TCR-stimulated NKT cells produce IL-2 that
is required to induce NK cell cytotoxicity. Thus, NKT cells can mediate
potent antitumor activity both directly by targeting CD1d and
indirectly by activating NK cells. | Introduction |
|---|
|
|
|---|
24J
Q gene rearrangement, and they often express an NK
locus-encoded C-type lectin NKR-P1A (CD161). Upon TCR stimulation, NKT
cells rapidly produce a number of cytokines, including IL-4, IFN-
,
TNF-
, IL-10, IL-13, and GM-CSF (1, 2, 3, 4). Immune
regulatory functions have been ascribed to NKT cells, and these include
development of tolerance (5), autoimmunity, and protection
from microorganisms (6). In the absence of exogenous
stimulation, the role of NKT cells in antitumor responses is
controversial. In one model, NKT cells were reported to protect mice
from tumors induced by methylcholanthrene (7). On the
contrary, another study in mice reported that CD1d-restricted
CD4+ NKT cells prevented effective CTL-mediated
tumor eradication in an IL-13-dependent manner (8).
-Galactosylceramide
(
GalCer),3 a
glycosphingolipid derived from the marine sponge Agelas
mauritanius, has been demonstrated to induce potent antitumor
responses in mice (9, 10, 11, 12) and to elicit cell-mediated
cytotoxicity against human tumor cell lines (13, 14, 15).
GalCer, a high affinity ligand for CD1d, is presented to a major
subset of human NKT cells that exclusively express V
11 paired with
the invariant V
24J
Q (7, 16). Mouse NKT cells
have an NK-like cytolytic activity against tumor cells (17, 18), and human NKT cells have been reported to kill a variety of
human tumor cell lines in a TCR-independent manner (13).
However, in other reports, human NKT cells did not exhibit cytotoxicity
against the same cell lines (14, 19, 20), and the very
rapid activation-induced cell death that occurs in vivo in mice
following
GalCer stimulation suggests that killing by NKT cells
might not be the most important mechanism whereby they eradicate tumors
(21, 22). Thus, the mechanism by which
GalCer-stimulated NKT cells mediate cytotoxicity is unclear. There
is evidence that
GalCer-stimulated NKT cells induce NK cell
proliferation and cytotoxicity (10, 19, 22, 23). This
involves IFN-
in the mouse (22, 23), but the mechanism
by which human NKT cells stimulate NK cell cytotoxicity has not been
defined.
In this study, using human CD1d/
GalCer (hCD1d/
GalCer) tetramers,
we obtained highly purified populations of human
GalCer-reactive NKT
cells and evaluated the requirements for direct NKT cell cytotoxicity
and for the NKT-dependent activation of NK cell cytotoxicity against
tumor cell lines. We demonstrate that NKT cell cytotoxicity is CD1d
restricted and ligand specific. Importantly, however, these cells can
strongly activate NK cell cytotoxicity via production of IL-2 and
IFN-
.
| Materials and Methods |
|---|
|
|
|---|
Venous peripheral blood, collected from healthy adult
volunteers, was obtained after informed consent and was anticoagulated
with heparin, 100 U/ml (SoloPak Laboratories, Elk Grove Village, IL).
After sedimentation of erythrocytes with dextran (U.S. Biomedical,
Cleveland, OH), PBMC were obtained from leukocytes by density-gradient
centrifugation using Histopaque-1077 (Sigma, St. Louis, MO). NKT cells
were isolated from PBMC, as described (24), with addition
of FACS sorting using hCD1d/
GalCer-TriColor (TC) tetramers. Briefly,
PBMC were stained with FITC-conjugated anti-V
24 mAb C15
(Beckman-Coulter, Miami, FL) and incubated with anti-FITC MACS
beads (Miltenyi Biotech, Bergisch Gladbach, Germany), according to the
manufacturers protocol. Cells retained in the MACS column were
selected as V
24+ cells. APCs were obtained
from the V
24- fraction after depleting
CD3+ cells with anti-CD3 MACS beads.
V
24+ cells and APCs (ratio 1:10) were
cocultured in RPMI 1640 medium containing 10% FCS (GeminiBio-Products,
Calabasas, CA), 2 mmol of L-glutamine (Irvine Scientific,
Santa Ana, CA), 50 U/ml penicillin G sodium, and 50 µg/ml
streptomycin sulfate (Life Technologies, Gaithersburg, MD) in the
presence of 10 ng/ml
GalCer (provided by Kirin Brewery, Tokyo,
Japan) with 100 U/ml rIL-2 (R&D Systems, Minneapolis, MN) for 3 wk.
Subsequently, hCD1d/
GalCer tetramer-reactive NKT cells were
positively sorted using a Coulter EPICS Elite flow cytometer
(Beckman-Coulter). The NKT cells that were obtained were restimulated
with hCD1d/
GalCer tetramer-coated plates every 23 wk. Multiwell
six-well tissue culture plates (BD Labware, Franklin Lakes, NJ) with
hCD1d/
GalCer tetramers (17 µg/well in 3 ml of PBS) were incubated
overnight at 4°C and washed three times with PBS immediately before
adding the cells. IL-2 (50 ng/ml) was added every other day. The cell
surface phenotype was analyzed by flow cytometry (multicolor
immunofluorescence) using the following mAbs: FITC anti-V
24 C15,
PE anti-V
11 C21 (Beckman-Coulter); CyChrome anti-CD3 UCHT1,
FITC anti-CD4 RPA-T4, PE anti-CD8 HIT8a, PE anti-CD161
DX12, PE anti-CD56 B159, PE anti-CD94 HP-3D9, and PE
anti-CD16 3G8 (BD PharMingen, San Diego, CA).
NK cells were separated from PBMC following negative selection using a NK Cell Isolation kit (Miltenyi Biotech), according to the manufacturers protocol. The purity of NK cells was confirmed by immunofluorescence using anti-CD56 PE B159 and anti-CD3 CyChrome UCHT1 mAbs. The NK cell preparations contained 9396% CD56+CD3- with no detectable CD3+ cells.
Tumor cell lines
The neuroblastoma LA-N-1 and T cell leukemia Jurkat J32 cell lines have been described (25, 26). The neuroblastoma cell line CHLA-20 (27) was provided by C. P. Reynolds (Childrens Hospital Los Angeles, Los Angeles, CA). Other cell lines were: melanoma M14 (provided by R. Irie, John Wayne Cancer Institute, Santa Monica, CA), small cell lung carcinoma NCI-H82, cervix adenocarcinoma HeLa, histiocytic lymphoma U937, and promyelocytic leukemia HL-60 (all obtained from American Type Culture Collection (ATCC), Manassas, VA). The cells were maintained in IMDM supplemented with 1020% heat-inactivated FCS and L-glutamine. CD1d surface expression was determined by flow cytometry using anti-CD1d mAb 42.1 (a gift from S. Porcelli, Albert Einstein College of Medicine, Bronx, NY). PE goat anti-mouse IgG (H+L) F(ab')2 and mouse IgG1 mAb 679.1 Mc7 (Beckman-Coulter) were used for detection and isotype control, respectively. CD1d expression also was examined in Western blots using NOR3.2 mAb (Serotec, Raleigh, NC). CD1d expression in leukemia cell lines was evaluated by RT-PCR, as described (28), with modifications in the cDNA amplification protocol, including increasing the number of cycles in the PCR from 35 to 40; increasing the denaturation temperature and time from 92°C and 30 s to 94°C and 1 min, respectively; and decreasing the extension time from 3 to 2 min.
cDNA constructs and transfections
Full-length hCD1d cDNA was PCR amplified and inserted into the
BamHI and SalI sites of the pH
Aprneo vector,
which contains the human
-actin promoter (29). The
plasmid containing the hCD1d coding sequence was transfected into the
neuroblastoma cell line LA-N-1 using LipofectAMINE PLUS (Life
Technologies), according to the manufacturers instructions. The
transfectants were selected in 300 ng/ml G418 for 14 days.
Immunofluorescence and Western blot analyses confirmed CD1d expression.
The lentiviral vector plasmids pHR'CMVGFP, pMD.G, and
pCMV
R8.91 were provided by D. Kohn (Childrens Hospital Los
Angeles). Construction of these plasmids was previously described
(30, 31). The hCD1d cDNA was cloned into the
BamHI-SalI sites of the pHR'CMVGFP vector,
replacing the green fluorescent protein cDNA. Lentiviral vector
particles expressing hCD1d were generated upon transient cotransfection
of human kidney 293T cells (ATCC) with the three-plasmid combination,
as previously described (32). Briefly, 293T cells were
transfected with 10 µg of pHR'CMVhCD1d, 10 µg of pCMV
R8.91, and
2 µg of pMD.G upon calcium phosphate precipitation (Life
Technologies). Supernatants with retroviral particles, 3 ml, were added
to 70% confluent neuroblastoma cell line CHLA-20 in a
25-cm2 flask, and after 24 h, the medium was
replaced. Immunofluorescence analysis was performed 48 h
later.
hCD1d/
GalCer tetramers
hCD1d heavy chain was PCR amplified using the 5' primer
CACGTCGACGATATGGGGTGCCTGCTGTTTCTGC and the 3' primer
CAGGGATCCCCAGTAGAGGACGATGTCCTG (SalI and
BamHI sites underlined), and was cloned into the
SalI and BamHI sites of the previously described
mouse CD1/
2-microglobulin
(
2m) expression vector pBacP10pH (gift of J.
Kappler, National Jewish Center, Denver, CO), which introduced a BirA
biotinylation sequence and a 6-His tag immediately following the
BamHI site (21). Similarly, human
2m was PCR amplified using the 5' primer
TCCGCTCGAGCGAGATGTCTCGCTCCGTGGCC and the 3' primer
ACTCCGGAGCTTACATGTCTCGATCCCAC (XhoI and
BspE1 sites underlined) and cloned under the control of the
p10 promoter of the same expression construct. Baculovirus isolation,
hCD1d protein expression in High Five insect cells (Invitrogen,
Carlsbad, CA), hCD1d purification, and tetramer production were
performed, as previously described for the mouse CD1d tetramer
(21). The identity of the secreted hCD1d protein was
confirmed in ELISA using anti-human
2m mAb
BBM.1 (33, 34) and anti-hCD1d heavy chain mAb NOR3.2.
Purified hCD1d was in native conformation, as assessed by the stability
of the hCD1d/
2m heterodimer during Ni agarose
purification and gel filtration purification on Superdex200 column
(hCD1d/
2m heterodimer elutes at position
corresponding to 50 kDa). Biotinylated hCD1d was loaded with
GalCer
by an overnight incubation with 3-fold molar excess of lipid, and
tetramers were made by a 1-h incubation of biotin-hCD1d/
GalCer
complexes with streptavidin-TC (Caltag Laboratories, Burlingame, CA).
Similarly to baculovirus-derived mCD1 tetramers, hCD1d tetramers
stained human and mouse NKT cells in immunofluorescence.
TC-hCd1d/
GalCer saturates 106 V
24V
11 NKT
cells when used at concentration 1 µg/ml. The tetramer was used at
concentration of 2 µg/ml to detect and sort NKT cells. For NKT cell
stimulation, plate-bound fluorochrome-free tetramer was used as
described above.
Cytotoxicity assay
Tumor cell viability was measured by quantifying retained calcein-AM fluorescence with digital image microscopy scanning (DIMSCAN), as previously described (35, 36). Calcein-AM (Molecular Probes, Eugene, OR) was added to the target cells, 5 µg/ml, and the cells were incubated at 37°C for 30 min. After washing, labeled target cells (10,000 cells in 50 µl/well) were plated into 96-well Falcon 3072 microtiter plates (BD Labware). Effector cells were washed and added in 50 µl/well to reach the desired E:T ratio. Each plate included six wells of target cells alone as control. Plates were incubated at 37°C in a humidified atmosphere with 5% CO2 for 6 h, and then analyzed by DIMSCAN. Data were expressed as percentage of target cell viability (% viability = fluorescence intensity in the experimental well/mean fluorescence intensity in the six control wells) x 100. The mean percentage of viability ± SD for each condition was calculated from six replicate experimental wells.
NKT and NK cell Transwell system
To study NK cell activation by NKT cells, we used Transwell
six-well plates with two chambers per well separated by a 400-nm-pore
membrane (Corning, Corning, NY). NKT (2 x
106 cells per chamber) and NK cells (0.52
x 106 cells per chamber) were cocultured in the
lower and upper chambers, respectively, for 3 days without exogenous
cytokines added. The lower chambers were precoated with hCD1d/
GalCer
tetramers (hCD1d = 16 µg/well,
GalCer = 1 µg/well) in
PBS; identical concentrations of hCD1d or
GalCer alone were used in
control wells. When indicated, anti-V
24 C15 mAb, with or without
anti-CD28 37407.111 (R&D Systems), 1 µg/ml each, were used
instead. Control wells were coated with the isotype control mouse IgG1
MOPC-21 mAb (BD PharMingen). Plates were incubated overnight at 4°C
and then washed three times with PBS immediately before adding the
cells.
Th1/Th2 cytometric bead array (CBA) analysis
NKT cells were cultured in plates coated with hCD1d/
GalCer,
hCD1d, or
GalCer, as described above. Culture medium, 60 µl, was
collected from each well at the indicated times and frozen at -80°C
until cytokine analysis. Cytokine concentrations were measured with the
CBA kit (BD PharMingen), according to the manufacturers manual, as
previously described (37, 38, 39, 40), with modification of data
analysis to use GraphPad Prism software (GraphPad Software, San Diego,
CA). Briefly, CBA uses a series of beads with discrete fluorescence
intensity at 670 nm. Each series of beads is coated with a mAb against
a single cytokine (IL-2, IL-4, IL-5, IL-10, IFN-
, or TNF-
), and
the mixture of beads detects six cytokines in one sample. A secondary
PE-conjugated mAb stains the beads proportionally to the amount of
bound cytokine. A cytokine standard containing a mixture of
predetermined amounts of all six cytokines was used to prepare 10
serial dilutions, providing a range of concentrations from 20 to 5000
pg/ml. After fluorescence intensity calibration and electronic color
compensation procedures, standard and test samples were analyzed with a
Coulter EPICS Elite flow cytometer. Fluorescence was excited by the
argon laser at 488 nm, and emitted light was measured at 670 and 576
nm. Data were collected using EXPO Analysis software (Beckman-Coulter).
Statistics (median fluorescence intensity values at 576 nm of each bead
series) was transferred to GraphPad Prism. Starting with standard
dilutions, the software performed a log transformation of the data,
then fit a curve to the 10 discreet points using a four-parameter
logistic model. The created calibration curve for each cytokine was
used to estimate the cytokine concentrations in the experimental
samples.
Induction of cytokine production and intracellular cytokine detection
This was performed as previously described in detail
(41), with minor modifications. Briefly, cells (5 x
106/ml) were incubated with the indicated stimuli
(6 h, 37°C) with brefeldin A added (10 µg/ml; Sigma) for the last
3 h. To induce TCR stimulation, cells were incubated with the
anti-V
24 C15 mAb (supernatant, produced from cells provided by
A. Lanzavecchia, Institute for Cancer Research, Bellinzona,
Switzerland) and anti-CD28 9.3 mAb (from ATCC), washed, and plated
in 6-cm petri dishes coated with a goat F(ab')2
anti-mouse IgG (Caltag Laboratories) for cross-linking. After
stimulation, the cells were fixed (3.7% formaldehyde in PBS, 10 min,
room temperature), washed with PBS, and resuspended in PBS containing
0.5% saponin, 0.2% FBS, 0.005% Tween 20, 0.01%
NaN3 for 18 h before intracellular cytokine
detection with FITC- or PE-labeled anti-cytokine or isotype-matched
IgG control mAb, as indicated. The mAb used were: FITC anti-IFN-
B27, PE anti-TNF-
MP9-20A4, PE anti-IL-10 JES3-9D7, FITC
anti-GM-CSF BVD-21C11, FITC anti-IL-2 MQ1-17H12, PE
anti-IL-4 MP4-25D2, and control FITC mouse IgG1 (Caltag
Laboratories); PE anti-IL-13 JES10-5A2, PE anti-IL-5
JES1-39D10, control PE rat IgG2a R35-95, and PE rat IgG1R3-34 (BD
PharMingen). Control Ig was used at a concentration giving background
fluorescence identical with that of the relevant Ab on control cell
lines not producing the relevant cytokine. Samples were analyzed on a
XL-MCL automated analytical cytometer (Beckman-Coulter).
Cytokine depletion
Cell-free conditioned medium was collected from NKT cells
stimulated for 6 h with plate-bound tetramers or mAbs, as
described above. This was distributed into vials (0.5 ml), and
neutralizing mAbs, alone or combined, were added to each of 0.5-ml
aliquots of the conditioned medium. The following reagents were used:
anti-IL-2 mAb MQ1-17H12, anti-TNF-
mAb mAb1 (BD PharMingen),
anti-IFN-
mAb 25718.111 (R&D Systems), and goat anti-IL-2
polyclonal serum (provided by one of us). All mAbs were used at final
concentration 50 µg/ml. For IL-2 depletion, two reagents were
applied: mAb MQ1-17H12 and goat anti-IL-2 polyclonal serum (1:500),
because the mAb alone bound only 80% IL-2, as determined by CBA
analysis (data not shown) (Amersham Pharmacia Biotech, Piscataway, NJ)
After 1-h incubation at 4°C, 30 µl of prewashed protein A-Sepharose
suspension was added to each aliquot. After 1-h incubation at 4°C,
the vials were centrifuged, and the bead-free supernatants were
collected. A 50-µl aliquot from each sample was used for CBA
analysis, and the remaining was used for the experiments with NK cells.
To reproduce the effect of the NKT cell-conditioned medium on NK cell
activation, recombinant cytokines (IL-2, IFN-
, and TNF-
; R&D
Systems) were added, alone or in combination, to the nonconditioned
medium (complete RPMI 1640) or to the medium depleted of the respective
cytokines.
Statistical analysis
GraphPad Prism 3.0 (GraphPad Software) was used to perform Students t test. All p values were obtained from two-tailed tests and were considered significant when p < 0.05.
| Results |
|---|
|
|
|---|
Using immunomagnetic separation, ex vivo expansion, and sorting
with hCD1d/
GalCer tetramers, we obtained
GalCer-reactive NKT cell
lines that exclusively expressed the V
24/V
11 TCR (Fig. 1
). Most cells were
CD4+ or CD4CD8 double negative, and about half of
them expressed CD161 (Table I
).
Initially, to evaluate NKT cell cytotoxicity, we chose neuroblastoma
cell lines because those that we tested do not express CD1d (Fig. 2
A), because they are
sensitive to lymphokine-activated NK cell cytotoxicity (42, 43), and because the TN-1 neuroblastoma cell line has been
reported to be sensitive to NKT cell cytotoxicity (13).
The LA-N-1 and CHLA-20 cell lines were transfected with hCD1d cDNA
(Fig. 2
A), and NKT cell cytotoxicity was tested against the
parental CD1d- and CD1d+
targets (Fig. 2
B). NKT cells were used on days 4, 7, 10, and
14 (donor 1) and days 4, 7, and 10 (donor 2) after restimulation with
hCD1d/
GalCer-coated plates. No significant difference was observed
for NKT cell cytotoxicity at different times after specific
restimulation (p > 0.05). In all seven experiments
with NKT cell lines from two donors, only 527% (LA-N-1/CD1d) and
31% to 43% (CHLA-20/CD1d) of CD1d-transfected cells pulsed with
GalCer survived, but essentially 100% of the parental
CD1d- and nonpulsed CD1d+
cells were viable. These data indicate that the cytotoxicity of the in
vitro expanded NKT cell lines against neuroblastoma cells is CD1d
restricted and ligand specific.
|
|
|
To exclude the possibility that the CD1d restriction of NKT cell
cytotoxicity is limited to neuroblastoma, we also tested human cell
lines derived from diverse cancers and leukemias. Among these, we
identified four CD1d- and two
CD1d+ lines (Fig. 3
A). These were M-14
(melanoma), HeLa (cervical adenocarcinoma), NCI-H82 (small cell lung
carcinoma), HL-60 (promyelocytic leukemia), U937 (histiocytic
lymphoma), and Jurkat J32 (T cell leukemia). Strong NKT cell
cytotoxicity was detected only against the CD1d+
U937 and Jurkat leukemia cell lines pulsed with
GalCer (Fig. 3
B). Low level cytotoxicity was observed against the same
cell lines even without
GalCer pulsing (Fig. 3
B). In
contrast, CD1d- cell lines were not killed by
NKT cells, even if pulsed with
GalCer. Anti-CD1d-blocking mAb 42.1
partially inhibited NKT cell cytotoxicity against
GalCer-pulsed
CD1d+ leukemia cell lines (p
< 0.001) to a similar extent as
GalCer-pulsed CD1d-transfected
LA-N-1 cells (Fig. 3
C). These data indicate CD1d restriction
of human NKT cell cytotoxicity and establish that CD1d-expressing
leukemia cells can be specifically recognized and killed by NKT cells,
especially in the presence of
GalCer.
|
To test whether TCR-stimulated NKT cells produce soluble factors
that affect NK cell cytotoxicity, we cocultured purified NKT and NK
cells in a Transwell system (see Materials and Methods).
After 72 h, NK cells in transwells above NKT cells that were
incubated with hCD1d/
GalCer, but not with either hCD1d or
GalCer
alone killed the same CD1d- neuroblastoma cell
lines that were not affected by NKT cells (p
< 0.001) (Fig. 4
). NK cell cytotoxicity
was also induced in similar experiments when NKT cells were stimulated
with plate-bound anti-V
24 mAb C15 in the presence or absence of
anti-CD28 mAb (data not shown). These data indicate that soluble
factors produced by stimulated NKT cells induce NK cell
cytotoxicity.
|
To identify the cytokines produced by stimulated NKT cells,
cell-free supernatants from NKT cells stimulated with hCD1d/
GalCer
tetramers, hCD1d protein, or
GalCer were evaluated with the CBA
assay. In addition, the proportion of cells producing cytokines was
determined by multicolor immunofluorescence combining surface
phenotyping and intracellular cytokine detection (Fig. 5
). In the first 6 h,
hCD1d/
GalCer tetramers induced NKT cells to secrete significant
levels of IL-2 (1.7 ng/ml), IL-4 (5.6 ng/ml), TNF-
(28.4 ng/ml), and
IFN-
(15.2 ng/ml); little IL-5 (0.3 ng/ml) and even less IL-10 (0.06
ng/ml) were secreted (Fig. 5
, A and C).
Stimulation with rhCD1d induced very low levels of IL-4 (0.3 ng/ml),
IL-5 (0.15 ng/ml), TNF-
(1.9 ng/ml), IFN-
(1.3 ng/ml), and IL-10
(0.02 ng/ml).
GalCer alone did not induce cytokine production.
Similar profiles of cytokine secretion were induced upon stimulation of
NKT cells with anti-V
24 mAb C15 with or without agonistic
anti-CD28 mAb (data not shown). Intracellular accumulation of IL-2,
IL-4, TNF-
, and IFN-
was detected in NKT cells after 6-h
stimulation with anti-V
24 + anti-CD28 mAb 9.3 (Fig. 5
B); and TNF-
and IFN-
were detected in distinct
subpopulations (
70%). IL-10 was not detectable, and IL-5 was either
detectable at very low levels (Fig. 5
B) or present in a
minor NKT cell subset (data not shown). Intracellular IL-13 and GM-CSF
were detected by immunofluorescence in the majority of stimulated cells
(data not shown).
|
24 + anti-CD28-stimulated NKT cells within 2 h
and reached maximum levels within 612 h (Fig. 5
, IFN-
, and IL-4,
with peak levels of 40, 20, and 8 ng/ml, respectively. High IL-2
levels, reaching 2.5 ng/ml, were produced within the first 12 h
after TCR stimulation and decreased to basal levels by 30 h. IL-5
was secreted slowly, reaching a peak of 1.8 ng/ml by 36 h (data
not shown), and IL-10 was the lowest, with only 0.1 ng/ml after 12-h
stimulation. Cytokine requirement for NKT cell-induced NK cell cytotoxicity
The contribution of IL-2, IFN-
, and TNF-
to the induction of
NK cell cytotoxicity was examined by depleting each cytokine from NKT
cell-conditioned medium. NKT cells were incubated on
hCD1d/
GalCer-coated plates, and cell-free supernatant was obtained
after 6-h stimulation. Cytokines were depleted using anti-IL-2,
anti-IFN-
, and/or anti-TNF-
neutralizing mAbs and protein
A-Sepharose 4 Fast Flow medium. Cytokine concentration in the
supernatant was measured using the CBA assay before and after depletion
(Table II
). NK cells were incubated for
72 h with cytokine-depleted supernatants, and their cytotoxicity
was tested against LA-N-1 neuroblastoma cells (Fig. 6
A). Depletion of IL-2 alone
was sufficient to completely abrogate NK cell cytotoxicity induced by
the NKT cell supernatant (NKT-S) (p < 0.001).
Depletion of IFN-
reduced the cytotoxicity, increasing target
viability from 20.1 ± 1.8 to 35.3 ± 2.3%
(p < 0.001). Depletion of TNF-
, alone or
combined with IFN-
depletion, had no effect (p >
0.05). Recombinant cytokines added to the depleted supernatants in the
same concentrations as originally detected (Table II
) completely
reversed the effect of depletion, confirming the specificity of
depletion (Fig. 6
A).
|
|
,
and/or TNF-
) were added to nonconditioned tissue culture medium at
the same concentrations detected in the NKT-S. Addition of IL-2 alone
induced potent NK cell cytotoxicity, leaving only 35.5 ± 2%
(p < 0.001) of the target cells viable (Fig. 6
and TNF-
, separately
or combined, mediated no significant cytotoxicity (p
> 0.05). However, IFN-
(but not TNF-
) combined with IL-2
augmented NK cell cytotoxicity, decreasing target cell viability to
21.2 ± 3.3% (p < 0.001). These experiments
demonstrate that IL-2 produced by TCR-stimulated NKT cells is required
for induction of NK cell cytotoxicity, and in combination with IFN-
reproduces the effect of NKT-S. | Discussion |
|---|
|
|
|---|
GalCer tetramers allowed us to obtain purified
GalCer-reactive NKT cell lines (>99% pure) without restricting
their original diversity by cloning. With these cells, we demonstrated
that direct NKT cell cytotoxicity is CD1d restricted and
GalCer
dependent. We also showed for the first time that TCR-stimulated human
NKT cells produce IL-2, which is required and sufficient to strongly
activate NK cell cytotoxicity against CD1d-
target cells that are insensitive to fresh, unstimulated, NK cells.
We report that human NKT cells, unable to recognize
CD1d- cells, do not kill them. The neuroblastoma
cell lines LA-N-1 and CHLA-20 were resistant to NKT cell lysis
regardless of time after TCR stimulation, which was reported to be a
crucial factor for NKT cell cytotoxicity against U937 cells
(14). The restriction of NKT cell cytotoxicity by CD1d was
demonstrated by converting two CD1d-
neuroblastoma cell lines to CD1d+ by gene
transfection and by showing that NKT cells were cytotoxic only against
the CD1d+ cells. Moreover, direct NKT cell
cytotoxicity requires recognition of the CD1d-bound ligand because the
CD1d-transfected cells were killed only after
GalCer pulsing. CD1d
restriction and specificity of human NKT cell cytotoxicity were
confirmed by testing six other tumor cell lines of diverse tissue
origin, four and two of which were CD1d- and
CD1d+, respectively. NKT cells were highly
cytotoxic only against
GalCer-pulsed cell lines that constitutively
expressed CD1d on the cell surface, and the cytotoxicity was
specifically inhibited by an anti-CD1d-blocking mAb. Of note, however,
NKT cells mediated low-level cytotoxicity against the
CD1d+ U937 and Jurkat cell lines even when the
targets were not pulsed with
GalCer. This supports the hypothesis
that the TCR of NKT cells can interact with CD1d loaded with endogenous
lipid ligands (16, 44, 45). In agreement with this, we
have observed that NKT cells produce low amounts of certain cytokines
in response to plates coated with insect cell-derived rhCD1d protein,
which may present bound ligand derived from insect cells. We cannot
exclude the possibility that NKT cells recognize empty CD1d directly.
However, given a lack of precedent for this possibility, we favor the
endogenous lipid ligand hypothesis. We did not investigate the effector
phase of NKT cell cytotoxicity in this study, which has been described
previously as mostly perforin dependent (2, 14, 15). The
observed rapid production of TNF-
(and, possibly, other TNF family
proteins) by NKT cells upon
GalCer recognition suggests that direct
killing that follows specific target recognition may depend, in part,
on the effect of these proteins, especially against TNF-
-, FAS
ligand-, and TNF-related apoptosis-inducing ligand-sensitive cells such
as U937 and Jurkat. This is supported by the high level of FAS ligand
mRNA expression in human NKT clones (46). Also,
TNF-related apoptosis-inducing ligand has recently been found to play a
crucial role in the killing of freshly isolated acute myelomonocytic
leukemia cells by
GalCer-stimulated NKT cells (47).
GalCer-activated human NKT cells have been reported to exert
nonspecific cytolytic activity against a wide variety of human tumor
cell lines (13). Only 88% of the lymphocyte population in
that in vitro study expressed V
24/V
11, raising the possibility
that the broad cytotoxicity may have been due to contaminating cells.
Indeed, NKT cell cytotoxicity against some of the cell lines used,
including K562, Daudi, and HeLa, was not confirmed by other groups
(14, 19, 20). In our study, using >99%
GalCer-reactive human NKT cells, we also were unable to confirm the
NKT cell cytotoxicity against HeLa, as well as against any other of six
tested CD1d- tumor cell lines.
In agreement with our results, it has been reported that human NKT
cells can directly kill U937 cells (14, 15). However, this
myelomonocytic cell line, as well as peripheral blood monocytes, were
reported as CD1d negative (14). Combining this with the
fact that NKT cells were not cytotoxic against classical NK target
K562, these authors concluded that NKT cell cytotoxicity against tumors
depends on mechanisms distinct from those used by classical T and NK
cells (14, 15). However, several groups demonstrated that
human monocytes express CD1d (48, 49). Moreover, despite
their remarkably low surface CD1d expression, all monocyte lineage
cells exhibit extremely potent Ag-presenting function for NKT cell
clones (50). The U937 cells used in this study (as well as
monocytes, which are the APC in this work) express CD1d on the cell
surface, although at low density (Fig. 3
A), and CD1d gene
expression was confirmed by RT-PCR analysis (data not shown). Thus, our
data with U937 cells support the requirement of hCD1d ligand
recognition for the direct antitumor cytotoxicity of human NKT cells,
and argue against a CD1d-independent, non-T, non-NK-like cytotoxic
mechanism.
Murine NKT cells mediate NK-like cytotoxicity after short-term culture
with high concentrations of IL-2, and the killing depends upon NK1.1
and CD16 (51). However, human NKT cells do not express
CD16, and the human homologue of murine NK1.1, NKR-P1A (CD161), does
not trigger cytotoxicity by NK (52) or NKT cells, because
it lacks the cytoplasmic motif CXCP/S/T that associates with
p56Lck to signal cytotoxicity (2, 53). CD1d-dependent activation of NKT cells has been reported to
be required for the antitumor activity of
GalCer in mice (18, 54). However, NKT cells derived from the spleen of mice treated
with
GalCer directly killed melanoma B16 and T cell lymphoma RMA-S
cells (18) in a CD1d-independent manner, and this
cytotoxicity was not significantly inhibited by an
anti-NK1.1-blocking mAb. Thus, murine NKT cells activated by
GalCer may have a TCR- and NK1.1-independent mechanism of target
recognition. Importantly, however, data presented in this study with
GalCer-reactive human NKT cells argue against NKT cell cytotoxicity
being triggered by cell surface molecules other than the TCR. This
suggests that, despite conservation of the CD1d-NKT system during
mammalian evolution (16), direct antitumor cytotoxicity of
mouse and human
GalCer-reactive NKT cells is based on distinct
mechanisms. This is important to be considered in the development of
immunotherapy using NKT cells.
The ability of NKT cells to kill tumor cells in a CD1d/ligand-dependent
manner suggests that malignancies expressing CD1d could be attacked by
NKT cells. The distribution of CD1d expression in human malignancies is
not known. In normal tissues, CD1d is expressed by monocyte lineage
cells (50), a subset of B lymphocytes, intestinal
epithelial cells (55), cortical thymocytes, thymic
epithelial cells, skin keratinocytes (56), and activated T
lymphocytes (28). Some malignancies that originate from
these tissues, and which preserve or up-regulate CD1d expression, could
be targets for direct NKT cell cytotoxicity, provided they express a
natural ligand or bind added
GalCer. This could be exploited for
treatment, although possible toxicity of NKT cells against normal cells
expressing CD1d and binding
GalCer would need to be evaluated.
We have demonstrated that, upon
GalCer recognition, human NKT cells
induce NK cells to mediate cytotoxicity against
CD1d- tumor targets in the absence of any other
cell type or exogenously added cytokine, and that IL-2 is required and
sufficient for the induction of NK cell cytotoxicity. IFN-
depletion
partly reduced NK cell activation. As expected, IFN-
alone did not
have an effect and, in agreement with earlier reports for both human
and mouse NK cell cytotoxicity (57), only enhanced NK
cytotoxicity induced by IL-2 (58). IL-2 is well known to
directly activate NK cell proliferation and cytotoxicity (59, 60), and, combined with IL-2, IFN-
may augment NK cell
activation (61, 62). Moreover, IFN-
produced by NKT
cells in vivo may indirectly stimulate NK cell-mediated functions by
promoting NK cell mobilization from blood (57) and by
inducing NK cells themselves to produce IFN-
(23).
Several lines of evidence suggested that soluble factors produced by
NKT cells activate NK cells to mediate the antitumor effects of
GalCer in vivo (12, 22, 23). Treatment of mice with
GalCer induced significant serum levels of IL-2, IL-4, IL-12, and
IFN-
in a dose-dependent manner, and this
correlated with augmented NK activity of hepatic mononuclear cells and
marked growth inhibition of EL-4 lymphoma cells in liver
(63). Using CD1d- and J
281 (NKT)-deficient mice,
CD1d-dependent NKT cells were shown to be necessary for NK cell
activation by
GalCer (22). No reduction in NK cell
proliferation and cytotoxicity was observed in IL-12-deficient mice
treated with
GalCer (22), even though NKT cells
stimulated with
GalCer can induce IL-12 production by dendritic
cells (64), and IL-12 is known to induce NK cell-dependent
antitumor effects in mice with or without NKT cell contribution
(65, 66). Instead, induction of NK cell cytotoxicity by
GalCer was decreased in IFN-
-deficient animals (22).
Neutralization of IL-2 did not have an effect on NK cell activation in
that mouse model. However, the efficiency of IL-2 neutralization was
not determined and may not have been sufficient. Alternatively, as
noted above, mouse NKT cells may work differently from their human
counterparts.
Multiple factors may influence NK cell activation induced by
GalCer
in vivo. Our data suggest that, upon
GalCer recognition, NKT cells
alone may strongly activate NK cell cytotoxicity in tissues such as
liver, which contains relatively high numbers of both cell types
(19, 21). This is in agreement with a recent report that
GalCer in vitro induces cytotoxicity of human hepatic lymphocytes
that is mediated by NK cells, but that is CD1d and NKT cell dependent
(19). In this latter study, IL-12 did not play a role in
GalCer-induced NK cell cytotoxicity, and other cytokines were not
evaluated.
In summary, the present study demonstrates that, like for classical T
cells, ligand-induced TCR activation is prerequisite for the effector
functions of human
GalCer-reactive NKT cells. Our results suggest
that characterization of human malignancies for CD1d expression and
creation of an effective protocol for in vivo expansion of NKT cells
may provide a basis for developing immunotherapy based upon direct NKT
cell cytotoxicity and/or NKT cell-mediated activation of NK cells. Such
therapy would have the advantage of a defined ligand presented by the
monomorphic molecule CD1d.
| Acknowledgments |
|---|
GalCer (KRN 7000) was kindly provided by Kirin Brewery (Tokyo,
Japan). We thank Dr. S. Porcelli (Albert Einstein College of
Medicine, Bronx, NY) for the generous gift of anti-CD1d mAb 42.1. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Robert C. Seeger, Division of Hematology-Oncology, MS 57, Childrens Hospital Los Angeles, 4650 Sunset Boulevard, Los Angeles, CA 90027. E-mail address: rseeger{at}chla.usc.edu ![]()
3 Abbreviations used in this paper:
GalCer,
-galactosylceramide;
2m,
2-microglobulin; CBA, cytometric bead array; DIMSCAN, digital image microscopy scanning; hCD1d, human CD1d; TC, TriColor; NKT-S, NKT cell supernatant. ![]()
Received for publication April 9, 2001. Accepted for publication July 5, 2001.
| References |
|---|
|
|
|---|
24+ CD4-CD8- T cells. J. Exp. Med. 186:109.
24 J
Q T cell receptor
chains. J. Exp. Med. 188:867.
24J
Q T cells: a feedback mechanism for immune regulation. J. Immunol. 165:3756.
-galactosylceramides against B16-bearing mice. J. Med. Chem. 38:2176.[Medline]
-galactosylceramide, KRN7000. Cancer Res. 58:1202.
-galactosylceramide. J. Immunol. 163:2387.
-galactosylceramide, KRN7000, in mice with the melanoma B16 hepatic metastasis and immunohistological study of tumor infiltrating cells. Oncol. Res. 12:51.[Medline]
24 NKT cells. Cancer Res. 59:5102.
24+ natural killer T cells activated by
-galactosylceramide (KRN7000) have cytotoxic anti-tumor activity through mechanisms distinct from T cells and natural killer cells. Immunology 99:229.[Medline]
24+CD4+ NKT cells activated by
-glycosylceramide-pulsed monocyte-derived dendritic cells. J. Immunol. 164:4458.
-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:152.
14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.
14 NKT cells. Proc Natl. Acad. Sci. USA 95:5690.
-Glycosylceramides enhance the antitumor cytotoxicity of hepatic lymphocytes obtained from cancer patients by activating CD3-CD56+ NK cells in vitro. J. Immunol. 165:1659.
-actin expression vector system directs high-level accumulation of antisense transcripts. Proc. Natl. Acad. Sci. USA 84:4831.
2-microglobulin antibody and its use in the genetic and biochemical analysis of major histocompatibility antigens. Eur. J. Immunol. 9:536.[Medline]
2-microglobulin binding antigen encoded by the human CD1D gene. Eur. J. Immunol. 21:71.[Medline]
-galactosylceramide specifically stimulates V
14+ NK T lymphocytes. J. Immunol. 161:3271.
24 NKT cells induces in vitro and in vivo apoptosis of human acute myeloid leukemia cells. Blood 97:2067.
production by NK-T cells. J. Immunol. 165:4076.
and IL-2. Cell. Immunol. 127:311.[Medline]
: lack of a role in interleukin 2-mediated augmentation. J. Immunol. 136:2176.[Abstract]
-IL-1, interferon-
and -
. J. Immunol. 138:2728.[Abstract]
-galactosylceramide, KRN7000, in mice with EL-4 hepatic metastasis and its cytokine production. Oncol. Res. 10:561.[Medline]
-galactosylceramide demonstrates its immunopotentiating effect by inducing interleukin (IL)-12 production by dendritic cells and IL-12 receptor expression on NKT cells. J. Exp. Med. 189:1121.This article has been cited by other articles:
![]() |
K. Azakami, T. Sato, N. Araya, A. Utsunomiya, R. Kubota, K. Suzuki, D. Hasegawa, T. Izumi, H. Fujita, S. Aratani, et al. Severe loss of invariant NKT cells exhibiting anti-HTLV-1 activity in patients with HTLV-1-associated disorders Blood, October 8, 2009; 114(15): 3208 - 3215. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Bricard, V. Cesson, E. Devevre, H. Bouzourene, C. Barbey, N. Rufer, J. S. Im, P. M. Alves, O. Martinet, N. Halkic, et al. Enrichment of Human CD4+ V{alpha}24/V{beta}11 Invariant NKT Cells in Intrahepatic Malignant Tumors J. Immunol., April 15, 2009; 182(8): 5140 - 5151. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Hu, F. Venet, D. S. Heffernan, Y. L. Wang, B. Horner, X. Huang, C.-S. Chung, S. H. Gregory, and A. Ayala The Role of Hepatic Invariant NKT Cells in Systemic/Local Inflammation and Mortality during Polymicrobial Septic Shock J. Immunol., February 15, 2009; 182(4): 2467 - 2475. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Huang, S.-W. Hung, T.-R. Jan, K.-W. Liao, C.-H. Cheng, Y.-S. Wang, and R.-M. Chu CD5-low expression lymphocytes in canine peripheral blood show characteristics of natural killer cells J. Leukoc. Biol., December 1, 2008; 84(6): 1501 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Song, H. J.J. van der Vliet, Y.-T. Tai, R. Prabhala, R. Wang, K. Podar, L. Catley, M. A. Shammas, K. C. Anderson, S. P. Balk, et al. Generation of Antitumor Invariant Natural Killer T Cell Lines in Multiple Myeloma and Promotion of Their Functions via Lenalidomide: A Strategy for Immunotherapy Clin. Cancer Res., November 1, 2008; 14(21): 6955 - 6962. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ozeki and J. E. Shively Differential cell fates induced by all-trans retinoic acid-treated HL-60 human leukemia cells J. Leukoc. Biol., September 1, 2008; 84(3): 769 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Moreno, J. W. Molling, S. von Mensdorff-Pouilly, R. H. M. Verheijen, E. Hooijberg, D. Kramer, A. W. Reurs, A. J. M. van den Eertwegh, B. M. E. von Blomberg, R. J. Scheper, et al. IFN-{gamma}-Producing Human Invariant NKT Cells Promote Tumor-Associated Antigen-Specific Cytotoxic T Cell Responses J. Immunol., August 15, 2008; 181(4): 2446 - 2454. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Chen, X. Wang, G. S. Besra, and J. E. Gumperz Modulation of CD1d-restricted NKT cell responses by CD4 J. Leukoc. Biol., December 1, 2007; 82(6): 1455 - 1465. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Molling, J. A.E. Langius, J. A. Langendijk, C. R. Leemans, H. J. Bontkes, H. J.J. van der Vliet, B. M. E. von Blomberg, R. J. Scheper, and A. J.M. van den Eertwegh Low Levels of Circulating Invariant Natural Killer T Cells Predict Poor Clinical Outcome in Patients With Head and Neck Squamous Cell Carcinoma J. Clin. Oncol., March 1, 2007; 25(7): 862 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Raftery, F. Winau, S. H. E. Kaufmann, U. E. Schaible, and G. Schonrich CD1 Antigen Presentation by Human Dendritic Cells as a Target for Herpes Simplex Virus Immune Evasion J. Immunol., November 1, 2006; 177(9): 6207 - 6214. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J.J. van der Vliet, S. P. Balk, and M. A. Exley Natural Killer T Cell-Based Cancer Immunotherapy. Clin. Cancer Res., October 15, 2006; 12(20): 5921 - 5923. [Full Text] [PDF] |
||||
![]() |
K. Shimizu, M. Hidaka, N. Kadowaki, N. Makita, N. Konishi, K. Fujimoto, T. Uchiyama, F. Kawano, M. Taniguchi, and S.-i. Fujii Evaluation of the Function of Human Invariant NKT Cells from Cancer Patients Using {alpha}-Galactosylceramide-Loaded Murine Dendritic Cells. J. Immunol., September 1, 2006; 177(5): 3484 - 3492. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lin, M. Nieda, J. F. Hutton, V. Rozenkov, and A. J. Nicol Comparative gene expression analysis of NKT cell subpopulations J. Leukoc. Biol., July 1, 2006; 80(1): 164 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Osada, M. A. Morse, H. K. Lyerly, and T. M. Clay Ex vivo expanded human CD4+ regulatory NKT cells suppress expansion of tumor antigen-specific CTLs Int. Immunol., September 1, 2005; 17(9): 1143 - 1155. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Dougan, A. Salas, P. Rava, A. Agyemang, A. Kaser, J. Morrison, A. Khurana, M. Kronenberg, C. Johnson, M. Exley, et al. Microsomal triglyceride transfer protein lipidation and control of CD1d on antigen-presenting cells J. Exp. Med., August 15, 2005; 202(4): 529 - 539. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Chang, K. Osman, J. Connolly, A. Kukreja, J. Krasovsky, M. Pack, A. Hutchinson, M. Geller, N. Liu, R. Annable, et al. Sustained expansion of NKT cells and antigen-specific T cells after injection of {alpha}-galactosyl-ceramide loaded mature dendritic cells in cancer patients J. Exp. Med., May 2, 2005; 201(9): 1503 - 1517. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Crough, M. Nieda, and A. J. Nicol Granulocyte Colony-Stimulating Factor Modulates {alpha}-Galactosylceramide-Responsive Human V{alpha}24+V{beta}11+ NKT Cells J. Immunol., October 15, 2004; 173(8): 4960 - 4966. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Durante-Mangoni, R. Wang, A. Shaulov, Q. He, I. Nasser, N. Afdhal, M. J. Koziel, and M. A. Exley Hepatic CD1d Expression in Hepatitis C Virus Infection and Recognition by Resident Proinflammatory CD1d-Reactive T Cells J. Immunol., August 1, 2004; 173(3): 2159 - 2166. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Metelitsa, H.-W. Wu, H. Wang, Y. Yang, Z. Warsi, S. Asgharzadeh, S. Groshen, S. B. Wilson, and R. C. Seeger Natural Killer T Cells Infiltrate Neuroblastomas Expressing the Chemokine CCL2 J. Exp. Med., May 3, 2004; 199(9): 1213 - 1221. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nieda, M. Okai, A. Tazbirkova, H. Lin, A. Yamaura, K. Ide, R. Abraham, T. Juji, D. J. Macfarlane, and A. J. Nicol Therapeutic activation of V{alpha}24+V{beta}11+ NKT cells in human subjects results in highly coordinated secondary activation of acquired and innate immunity Blood, January 15, 2004; 103(2): 383 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Esteban, T. Tsoutsman, M. A. Jordan, D. Roach, L. D. Poulton, A. Brooks, O. V. Naidenko, S. Sidobre, D. I. Godfrey, and A. G. Baxter Genetic Control of NKT Cell Numbers Maps to Major Diabetes and Lupus Loci J. Immunol., September 15, 2003; 171(6): 2873 - 2878. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Baxevanis, A. D. Gritzapis, and M. Papamichail In Vivo Antitumor Activity of NKT Cells Activated by the Combination of IL-12 and IL-18 J. Immunol., September 15, 2003; 171(6): 2953 - 2959. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kenna, L. G. Mason, S. A. Porcelli, Y. Koezuka, J. E. Hegarty, C. O'Farrelly, and D. G. Doherty NKT Cells from Normal and Tumor-Bearing Human Livers Are Phenotypically and Functionally Distinct from Murine NKT Cells J. Immunol., August 15, 2003; 171(4): 1775 - 1779. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. J. van der Vliet, J. W. Molling, N. Nishi, A. J. Masterson, W. Kolgen, S. A. Porcelli, A. J. M. van den Eertwegh, B. M. E. von Blomberg, H. M. Pinedo, G. Giaccone, et al. Polarization of V{alpha}24+ V{beta}11+ Natural Killer T Cells of Healthy Volunteers and Cancer Patients Using {alpha}-Galactosylceramide-loaded and Environmentally Instructed Dendritic Cells Cancer Res., July 15, 2003; 63(14): 4101 - 4106. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Dhodapkar, M. D. Geller, D. H. Chang, K. Shimizu, S.-I. Fujii, K. M. Dhodapkar, and J. Krasovsky A Reversible Defect in Natural Killer T Cell Function Characterizes the Progression of Premalignant to Malignant Multiple Myeloma J. Exp. Med., June 16, 2003; 197(12): 1667 - 1676. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Gansert, V. Kiebler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky, S. A. Porcelli, R. L. Modlin, and S. Stenger Human NKT Cells Express Granulysin and Exhibit Antimycobacterial Activity J. Immunol., March 15, 2003; 170(6): 3154 - 3161. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Miyahira, M. Katae, K. Takeda, H. Yagita, K. Okumura, S. Kobayashi, T. Takeuchi, T. Kamiyama, Y. Fukuchi, and T. Aoki Activation of Natural Killer T Cells by {alpha}-Galactosylceramide Impairs DNA Vaccine-Induced Protective Immunity against Trypanosoma cruzi Infect. Immun., March 1, 2003; 71(3): 1234 - 1241. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. H. van Dommelen, H. A. Tabarias, M. J. Smyth, and M. A. Degli-Esposti Activation of Natural Killer (NK) T Cells during Murine Cytomegalovirus Infection Enhances the Antiviral Response Mediated by NK Cells J. Virol., February 1, 2003; 77(3): 1877 - 1884. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Giaccone, C. J. A. Punt, Y. Ando, R. Ruijter, N. Nishi, M. Peters, B. M. E. von Blomberg, R. J. Scheper, H. J. J. van der Vliet, A. J. M. van den Eertwegh, et al. A Phase I Study of the Natural Killer T-Cell Ligand {alpha}-Galactosylceramide (KRN7000) in Patients with Solid Tumors Clin. Cancer Res., December 1, 2002; 8(12): 3702 - 3709. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Loza and B. Perussia Peripheral Immature CD2-/low T Cell Development from Type 2 to Type 1 Cytokine Production J. Immunol., September 15, 2002; 169(6): 3061 - 3068. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takahashi, S. Chiba, M. Nieda, T. Azuma, S. Ishihara, Y. Shibata, T. Juji, and H. Hirai Cutting Edge: Analysis of Human V{alpha}24+CD8+ NK T Cells Activated by {alpha}-Galactosylceramide-Pulsed Monocyte-Derived Dendritic Cells J. Immunol., April 1, 2002; 168(7): 3140 - 3144. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Exley, Q. He, O. Cheng, R.-J. Wang, C. P. Cheney, S. P. Balk, and M. J. Koziel Cutting Edge: Compartmentalization of Th1-Like Noninvariant CD1d-Reactive T Cells in Hepatitis C Virus-Infected Liver J. Immunol., February 15, 2002; 168(4): 1519 - 1523. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |