|
|
||||||||

*
Department of Microbiology and Molecular Genetics, New England Regional Primate Research Center, Harvard Medical School, Southborough, MA 01772; and
Department of Pediatrics and Molecular Medicine, University of Massachusetts Medical School, Worcester, MA 01655
| Abstract |
|---|
|
|
|---|
cytokine production upon TCR stimulation and in
MLRs. Finally, SAP specifically interacted with a 75-kDa
tyrosine-phosphorylated protein upon TCR stimulation. These results
demonstrate that CD4 T cells from XLP patients exhibit aberrant TCR
signal transduction and that the defect in SAP function is likely
responsible for this phenotype. | Introduction |
|---|
|
|
|---|
-1 herpesvirus that infects most people early in
life. Infection after early childhood frequently results in infectious
mononucleosis (IM),3 a
systemic illness that is caused by the proliferation of EBV-infected B
lymphocytes and unusually strong NK and virus-specific T lymphocyte
responses (1). EBV has been shown to be associated with
various diseases in humans (2, 3, 4). These include
Burkitts lymphoma, nasopharyngeal carcinoma, Hodgkins Disease, and
T cell lymphomas (5, 6, 7, 8, 9, 10, 11, 12, 13).
A rare disease called X-linked lymphoproliferative disease (XLP), or
Duncans disease, is an inherited syndrome characterized by
uncontrolled EBV infection leading to severe or fulminant IM, acquired
agammaglobulinemia, and malignant lymphoma (14). It has
been suggested that the inability of the immune system of XLP patients
to control EBV-infected B lymphocytes is likely due to defects of Th
cells, CTLs, and NK cells (15, 16, 17). The gene
defective in XLP has recently been identified, both by positional
cloning and functional cloning approaches, and has been designated src
homology 2 (SH2) domain protein 1A, Duncans disease SH2
protein, or signaling lymphocytic activation molecule
(SLAM)-associated protein (SAP) (18, 19, 20). SAP is a small
protein of 128 residues that consists of a single SH2 domain with a
short carboxyl-terminal region (18, 19, 20). It has been shown
to bind the cytoplasmic tail of SLAM and 2B4, cell surface receptors of
the CD2 superfamily, and this interaction has been shown to be crucial
to their signal transduction activity. SLAM is expressed on T and B
lymphocytes, mediates homotypic binding, and promotes T cell
costimulation, proliferation, and production of Th1 cytokines
(21, 22, 23, 24). During EBV infection, SLAM-SLAM interactions at
the interface between EBV-infected B cells and T cells may promote the
development of EBV-specific Th responses. The cytoplasmic region of
SLAM contains three tyrosine-based motifs. Surprisingly, SAP binds to
one of these motifs irrespective of the phosphorylation state of this
site, and this binding promotes signaling by preventing
recruitment of the SH2-containing protein tyrosine phosphatase (SHP-2)
(20). In XLP patients, SAP deficiency and subsequent
recruitment of SHP-2 may impair SLAM signal transduction, leading
to reduced IFN-
production by Th cells (20, 25, 26).
Another receptor of the CD2 superfamily, 2B4, contains cytoplasmic
motifs similar to those found in SLAM. It is expressed on T and NK
cells, and the engagement of 2B4 on NK cells has been demonstrated to
promote spontaneous cytotoxicity and to augment secretion of IFN-
(27, 28, 29, 30). Recent studies have demonstrated that the
cytoplasmic region of 2B4 also interacts SAP (31). In
fact, ligation of the 2B4 ligand on NK cells from a XLP patients failed
to initiate cytotoxicity, implying that the defect in SAP function may
contribute to the pathogenesis of XLP syndrome by reducing NK cell
lysis of EBV-infected B cells (31, 32, 33, 34, 35, 36).
Despite extensive studies of SAP function in SLAM and 2B4 signal transduction, little is known about the role of SAP in TCR-mediated signal transduction. We hypothesize that the inability of the immune system to control EBV-infected B lymphocytes is partly due to defects in Th cell responses (15, 20, 37). To investigate this hypothesis, we generated continuously growing CD4 Th cells of XLP patients using herpesvirus saimiri (HVS). HVS has been shown to transform primary human T lymphocytes to continuous growth, while maintaining the original phenotype and the functional properties (38, 39, 40, 41, 42, 43). Using these cell lines, we demonstrated that CD4 Th cells from XLP patients exhibited defects in TCR signaling, as evidenced by the inability to produce cytokines. These findings suggest that, in addition to SLAM and 2B4 signal transduction, SAP is involved in the TCR signal transduction pathway and that alteration of the TCR pathway may potentially contribute to the defective EBV-specific immunity in XLP patients.
| Materials and Methods |
|---|
|
|
|---|
HVS-transformed cells were grown with RPMI 1640 medium supplemented with 20% FBS (Life Technologies, Rockville, MD), and COS-1 cells were grown in DMEM (Life Technologies) supplemented with 10% FBS. A lipofectAMINE PLUS (Life Technologies) transfection procedure was used for transient expression in COS-1 cells.
In vitro immortalization of primary lymphocytes
PBMC were isolated from 10 ml heparinized blood specimens from
healthy volunteers and two individuals with XLP from a previously
well-characterized kindred (44) by centrifugation through
lymphocyte separation medium (Organon Teknika, Malvern, PA), followed
by washing in RPMI 1640 culture medium. PBMC from each individual were
individually washed, resuspended in RPMI 1640, and then distributed in
1 ml volumes containing
106 cells into 12-well
tissue culture plates. Cells were infected at a multiplicity of
infection ranging from 1 to 5 with 1 ml purified HVS viral stocks or
with 1 ml EBV-containing supernatant from B95-8 cells. Cells were
maintained in RPMI 1640 growth medium, which was changed every 34
days. Immortalization or cell death was assessed microscopically.
RNA extraction and RT-PCR
Total RNA from HVS-transformed cells was isolated using TRIzol Reagent (Life Technologies) according to the manufacturers instructions. Approximately 5 µg total RNA was reverse-transcribed by SuperScript II RNase H- reverse transcriptase (Life Technologies) in a 20 µl reaction mixture with random hexamers for 50 min at 42°C. As a control, cDNA synthesis was performed without the reverse transcriptase. One microliter of the same cDNA preparation was used for PCR amplification in a 50-µl volume of final reaction mixture with 0.5 µM specific primers (5' primer, GCCTGGCTGCAGTAGCAGCGGCATCTCCC; and 3' primer, ATGTACAAAAGTCCATTTCAGCTTTGAC). Ten microliters of PCR mixtures was electrophoresed through 2% agarose gel. Expected DNA size from the PCR amplification was 630 bp.
Plasmid constructions
To make 6x histidine-tagged SAP cDNA and its mutant form, SAP cDNA was amplified by using following primers: 5'-CGCGAATTCGCCGCCACCATGGACGCAGTGGCTGTGTATC-3' and 5'-CGCTCTAGATGGGGCTTTCAGGCAGACATC-3'. Each PCR product was cloned into the EcoRI and XbaI cloning sites of pEF1/Myc-His A expression vector (Invitrogen, Carlsbad, CA). The EcoRI/PmeI fragment containing the His-tagged SAP sequence was cloned into pLPCX vector (CLONTECH Laboratories, Palo Alto, CA). All PCR-amplified DNA fragments were completely sequenced to verify the presence of the correct sequence and the absence of any other changes.
Cell stimulation and lysis
For Ab stimulation, 2 x 106 cells were resuspended in 200 µl complete medium. After equilibration to 37°C for 10 min, the cells were stimulated with polystyrene bead-conjugated anti-CD3 mAb (M-450 CD3 Dynabeads; Dynal Biotech, Great Neck, NY) for the indicated duration and subsequently transferred to dry ice. In some cases, 2 x 106 cells were stimulated with 20 ng/ml 12-O-tetradecanoylphorbol-13-acetate (TPA) for 6 or 12 h. Cells were lysed in ice-cold lysis buffer (0.15 M NaCl, 1% Nonidet P-40, 50 mM HEPES buffer (pH 7.5), 2 mM Na2VO3, 10 mM NaF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 10 µg/ml pepstatin, and 2 mM PMSF). After incubation in ice for 30 min, lysates were precleared by centrifugation at 4°C for 15 min and used for immunoblotting, immunoprecipitation, or kinase assays.
Immunoprecipitation, immunoblotting, and kinase assays
Lysates were precleared with protein A-Sepharose (Pierce, Rockford, IL) on ice for 30 min and were then mixed with the appropriate Ab and protein A-Sepharose for 12 h at 4°C. Immunocomplexes were recovered by centrifugation and washed three times with lysis buffer. Precleared lysates or immunocomplexes were subjected to SDS-PAGE analysis. Proteins separated by SDS-PAGE were transferred to polyvinylidene difluoride membranes (Immobilon-P; Millipore, Bedford, MA). Membranes were blocked in TBST and 10% nonfat milk, incubated with the indicated primary Abs and HRP-conjugated secondary Abs, and subjected to ECL (SuperSignal; Pierce).
Sources of commercial Abs are as follows: anti-CD3
(6B10.2),
anti-
-associated protein 70 (ZAP70) (LR), anti-Cbl (C-15),
anti-SAP (FL-128), anti-SLAM (N-19), anti-JNK1 (C-17), and
anti-glycogen synthase kinase (GSK)-3
(0011-A) were obtained
from Santa Cruz Biotechnology (Santa Cruz, CA); HRP-conjugated
anti-phosphotyrosine (4G10) was obtained from Upstate Biotechnology
(Lake Placid, NY); and anti-phospho-ERK1/2
(Thr202/Tyr204),
anti-ERK1/2, anti-phospho-p38 mitogen-activated protein kinase
(MAPK) (Thr180/Tyr182),
anti-p38 MAPK, anti-phospho-stress-activated protein
kinase/JNK
(Thr183/Tyr185),
anti-phospho-Akt (Ser473), anti-Akt, and
anti-phospho-GSK-3
and -
(Ser21/9) were
obtained from Cell Signaling Technology (Beverly, MA). Akt kinase
assays were performed with the Akt kinase assay kit (Cell Signaling
Technology) according to the manufacturers instructions.
Measurements of secreted cytokines
A total of 1 x 106 of the indicated cells were cultured in 24-well tissue culture plates with or without anti-CD3 Ab in 1 ml RPMI 1640 supplemented with 20% FBS. The supernatants were harvested 24 h later, and the cytokine production was measured by ELISA kits (BD PharMingen, San Diego, CA).
Metabolic labeling and pulse-chase analysis
COS-1 cells were cultured to 7080% confluence in 10-cm-diameter culture dishes. After 48 h of transfection with pEF1-wild-type (wt) SAP or pEF1-SAP Q99P, cells were rinsed twice with PBS, washed once with labeling medium (RPMI 1640 minus methionine and cysteine; Life Technologies), and starved for 1 h by incubation in the labeling medium. After starvation, 100 µCi [35S]methionine and [35S]cysteine (New England Nuclear, Boston, MA) was added to the labeling medium, and the cells were incubated at 37°C for 2 h. Following removal of the labeling medium, cells were cultured in DMEM supplemented with 10% FBS and chased for 1, 3, 6, or 9 h. Cells were harvested and lysed with the lysis buffer.
Flow cytometric analysis
A total of 5 x 105 cells were
washed with PBS containing 2% FCS and incubated with FITC-conjugated
or PE-conjugated mAbs for 30 min at 4°C. After washing, each sample
was fixed with 2% paraformaldehyde solution, and flow cytometry
analysis was performed with a FACScan (BD Biosciences, Mountain View,
CA). Sources of commercial Abs are as follows: RPA-2.10 Ab for CD2,
HIT3a Ab for CD3, RPA-T4 Ab for CD4, HIT8a Ab for CD8, HIT19 Ab for
CD19, BerH8 Ab for CD30, HI30 Ab for CD45, B159 Ab for CD56, DX2 Ab for
CD95, T10B9.1A-31 Ab for TCR
, and A12 Ab for SLAM were obtained
from BD PharMingen; L243 Ab for HLA-DR was obtained from BD
Biosciences; and C1.7.1 Ab for 2B4 was obtained from Immunotech
(Westbrook, ME).
| Results |
|---|
|
|
|---|
Full-length SAP cDNA of two XLP siblings (Huami and Weljo) was
amplified from PBMC by RT-PCR, followed by DNA sequence analysis. PBMC
from two healthy volunteers (JJ and SC), Jurkat T lymphocytes, and BJAB
B lymphocytes were used as controls. The full-length SAP gene was
detected in PBMC of both XLP patients as well as PBMC of healthy
individuals and Jurkat T cells, whereas it was not detected in BJAB B
lymphocytes (Fig. 1
and data not shown).
DNA sequence analysis revealed that the SAP genes of both XLP patients
harbored a missense mutation at nucleotide 382 (A
C), which changed
glutamine at residue 99 to proline. SAP genes from the PBMC of JJ and
SC were found to have wt sequences (data not shown).
|
|
Human B and T lymphocytes are efficiently immortalized to
cytokine-independent, permanent cell growth by infection with EBV and
HVS, respectively (38, 45). In addition, HVS-immortalized
lymphocytes have been shown to maintain their original phenotypes and
functional properties (38, 39, 40, 41, 42, 43). Therefore, this in vitro
immortalization was used to generate continuously growing, autologous B
and T lymphocytes of XLP patients. Lymphocytes of two healthy
individuals (JJ and SC) were also included as controls. EBV and HVS
were separately added to aliquots of unstimulated PBMCs from Huami and
Weljo, XLP patients, and JJ and SC, healthy individuals. Months after
infection, continuously growing IL-2-independent B and T cells were
established. No significant difference in growth rate was observed
between XLP and control lymphocytes after immortalization with EBV or
HVS. To examine SAP expression, equal amounts of proteins from
HVS-immortalized T cells were used for immunoblot assay with an
anti-SAP Ab. Jurkat T cells were included as controls. This showed
that SAP protein was readily detected in Jurkat T cells and the
HVS-transformed JJ and SC T cells, whereas it was not detected in
HVS-transformed Huami and Weljo T cells (Fig. 3
).
|

, HLA-DR, SLAM, and 2B4
lymphocyte Ags other than CD30 (data not shown). A large population of
the Huami and Weljo T cells displayed higher surface expression of CD30
than control JJ and SC T cells (data not shown). In addition, no
apparent difference of surface Ag expressions, including IgM, CD19,
CD23, CD80, CD86, HLA-DR, and SLAM, was also observed between
EBV-transformed Huami B cells and EBV-transformed JJ and SC B cells
(data not shown). Enhanced tyrosine phosphorylation of XLP CD4+ T cells upon TCR stimulation
The biochemical event subsequent to TCR stimulation is the
induction of tyrosine phosphorylation of a number of cellular proteins
(46, 47, 48, 49). We examined the effects of the SAP mutation on
cellular tyrosine phosphorylation upon TCR stimulation. After
anti-CD3 Ab stimulation of HVS-transformed JJ and SC CD4 T cells
and HVS-transformed Huami and Weljo CD4 T cells, the course of tyrosine
phosphorylation induction was observed by immunoblot assay with an
anti-phosphotyrosine Ab (Fig. 4
).
Stimulation with an anti-CD3 Ab rapidly induced cellular tyrosine
phosphorylation in all cell lines (Fig. 4
). However, the level of
tyrosine phosphorylation after anti-CD3 Ab stimulation was not only
higher but also more prolonged in Huami and Weljo CD4 T cells than in
JJ and SC CD4 T cells (Fig. 4
). Specifically, proteins of 25, 35, 60,
70, 120, and 160 kDa in Huami and Weljo CD4 T displayed an enhanced
level of tyrosine phosphorylation when compared with those in JJ and SC
cells (Fig. 4
). In addition, the basal level of tyrosine
phosphorylation was slightly enhanced in the Huami and Weljo CD4 T
cells compared with the JJ and SC CD4 T cells (Fig. 4
). These results
demonstrate that tyrosine phosphorylation upon TCR stimulation is more
extensive in HVS-transformed Huami and Weljo CD4 T cells than that in
HVS-transformed JJ and SC CD4 T cells.
|
-chain, ZAP70, and Cbl
in XLP CD4+ T cells
To delineate the enhanced tyrosine phosphorylation of XLP CD4 T
cells, we further examined the level of tyrosine phosphorylation of
several cellular proteins, including CD3
, ZAP70, and Cbl. These
signaling molecules are extensively tyrosine phosphorylated upon TCR
stimulation, and this modification is important for their
signal-transducing activity in TCR signal transduction pathway. After
stimulation with an anti-CD3 Ab, precleared lysates of
HVS-transformed JJ and Huami CD4 T cells were used for
immunoprecipitation with anti-CD3
, anti-ZAP70, and
anti-Cbl Abs, followed by immunoblot assay with an
anti-phosphotyrosine Ab. Upon TCR stimulation, tyrosine
phosphorylation of CD3
, ZAP70, and Cbl proteins were induced in both
JJ and Huami T cells (Fig. 5
A). However, as seen with
overall tyrosine phosphorylation, basal and TCR-induced tyrosine
phosphorylation of CD3
, ZAP70, and Cbl was significantly higher in
Huami CD4 T cells than in JJ CD4 T cells (Fig. 5
A). These
results demonstrate that XLP CD4 T cells have an enhanced level of
basal and TCR-induced tyrosine phosphorylation of CD3
, ZAP70,
and Cbl.
|
Altered activation of ERK1/2, JNK, p38, and Akt activities in XLP CD4+ T cells upon TCR stimulation
Downstream of the early activation events, three major subfamilies
of MAPKs, ERKs, JNKs, and p38 kinase are activated upon TCR stimulation
(51, 52, 53, 54, 55, 56). In addition, Akt/protein kinase B and GSK, which
are pleotropic protein serine/threonine kinases, are implicated in a
variety of cellular functions such as survival, metabolism,
transcription, and translation (57, 58, 59, 60, 61, 62). Specific
phosphorylations of these kinases have been shown to be critical for
their kinase activation (63, 64). To examine the effect of
the SAP mutation on the downstream serine/threonine kinase activity, in
situ kinase activities were monitored after TCR stimulation by
immunoblot analysis with phospho-specific Abs that react only with the
activated forms of these kinases. Upon anti-CD3 Ab stimulation,
phosphorylation of ERK1/2, p38, and JNK were markedly increased in JJ,
Huami, and Weljo CD4 T cells (Fig. 6
A). However, a significant
level of phosphorylation of ERK1/2, p38, and JNK was detected in Huami
and Weljo T cells without TCR stimulation, whereas it was not detected
in JJ T cells (Fig. 6
A). Conversely, TCR-induced
phosphorylation of ERK1/2 and JNK rapidly declined after 5 min of
stimulation in Huami and Weljo T cells, whereas it was prolonged until
30 min of stimulation in JJ T cells (Fig. 6
A). This
indicates that these serine/threonine kinases in HVS-transformed XLP
CD4 T cells are transiently activated upon TCR stimulation.
|
and -3
kinases was observed between JJ and Huami cells
(Fig. 6
|
Triggering of SLAM and TCR on CD4+ T cells
has been shown to strongly induce IFN-
production (21).
In addition, Akt kinase has been shown to provide the costimulatory
signal for up-regulation of IL-2 and IFN-
production of CD4 Th cells
(65). To examine the effect of the SAP defect on cytokine
production, 1 x 105 HVS-transformed Huami,
Weljo, and JJ CD4 T cells were engaged with an anti-SLAM Ab
overnight, and IFN-
production was assessed by ELISA. Although Huami
and Weljo CD4 T cells had a high level of basal IFN-
production,
these cells showed little or no up-regulation of IFN-
production
upon anti-SLAM stimulation (Fig. 8
A and data not shown). In
contrast, JJ CD4 T cells exhibited a low level of IFN-
production
without stimulation, and a significant up-regulation of IFN-
production was detected upon anti-SLAM stimulation (Fig. 8
A). All three cells displayed an equivalent level of SLAM
surface expression (data not shown).
|
and IL-2 cytokine production was assessed by
ELISA. As seen with an anti-SLAM stimulation, control JJ
CD4+ T cells showed a drastic increase in IFN-
and IL-2 production upon anti-CD3 stimulation, whereas Huami and
Weljo CD4+ T cells did not up-regulate IFN-
and IL-2 cytokine production under the same conditions (Fig. 8Defects of cytokine production in XLP CD4+ T cells upon MLR
A MLR induces drastic activation of target cells, which induces a
significant level of cytokine production (66, 67). To
further examine T cell responsiveness, we examined the MLR response of
HVS-transformed control CD4 T cells and HVS-transformed XLP CD4 T cells
with autologous or heterologous B lymphocytes by measuring IL-2 and
IFN-
cytokine production. After 24 h of mixing 1 x
106 autologous B cells and T cells, IFN-
and
IL-2 production was measured by ELISA. JJ CD4 T cells produced
significant amounts of IL-2 and IFN-
upon syngenic MLR, whereas
Huami CD4 T cells showed little or no up-regulation of IL-2 and IFN-
production under the same conditions (Fig. 9
). To further examine T cell
responsiveness, JJ T cells were mixed with Huami B cells, or Huami T
cells were mixed with JJ B cells overnight. Allogenic MLR response was
assessed by measuring IFN-
and IL-2 production with ELISA. These
experiments also showed that Huami CD4 T cells did not induce IL-2 and
IFN-
production upon allogenic MLR, whereas JJ CD4 T cells produced
significant amounts of IL-2 and IFN-
as they did upon syngenic MLR
(Fig. 9
). These results demonstrate that, besides abnormal SLAM and TCR
signal transduction, XLP CD4+ T cells also
exhibit severe defects in MLR.
|
| Discussion |
|---|
|
|
|---|
SAP is a small protein of 128 residues that consists of a single SH2
domain with a short carboxyl-terminal region (18, 19, 20). A
large portion of SAP mutations results in truncation of the produced
protein due to either nonsense or frame shift mutation or to gross
deletion (18, 19, 20). In addition, several identified
mutations introduce a change in the most conserved amino acid among SH2
domains. These include R32T, C42W, T53I, E67D, and T68I (18, 68, 69, 70). These mutations have been suggested to impair the SH2
function of SAP. Because glutamine at residue 99 is located outside of
the SH2 domain, Q99P mutation does not appear to affect the SH2
function. Indeed, x-ray structural study suggests that Q99P mutation
likely disrupts hydrophobic and hydrogen bonding interactions that are
necessary for stabilizing the
G strand (71). Consistent
with this hypothesis, we demonstrate that Q99P mutation of SAP in our
XLP patients drastically diminishes its protein stability, demonstrated
by the undetectable level of SAP protein in XLP CD4 T cells.
SAP protein functions as a regulator of the signal transduction pathways initiated by at least two distinct surface receptors belonging to the CD2 family: SLAM, which is expressed on T and B cells, and 2B4, which is primarily expressed on NK cells (20, 31). It has been shown that binding of SAP to SLAM prevents an association of SLAM with SHP-2 (20). In addition, this molecular interaction is crucial for transducing activating signals via SLAM to induce up-regulation of cytokine production. In contrast, the signal mediated by 2B4 and SAP interaction affects not only the spontaneous cytotoxicity, but also the NK cell activation induced via CD16 and natural cytotoxicity receptors (32). In this report, we demonstrate that, besides SLAM and 2B4 signal transduction, SAP protein is involved in the TCR signal transduction pathway. The lack of a functional SAP protein in XLP CD4 T cells leads to aberrant TCR signal transduction. Because SAP is involved in a variety of cellular activities, its mutation in XLP patients may induce various defects in host immune effectors, including Th cells, CTLs, and NK cells, which lead to the inability of the immune system to control EBV infection.
The fact that SAP consists of a single SH2 domain suggests that SAP does not independently transduce signals. Instead, SAP recruits signal transduction molecules to regulate cellular signal transduction networks. Dok1, a major tyrosine-phosphorylated protein downstream of numerous signaling molecules (50), has been shown to strongly interact with SAP in a tyrosine phosphorylation-dependent manner (50). Here, we find that upon TCR stimulation, the SAP protein strongly interacts with a 75-kDa tyrosine-phosphorylated protein. Our limited study revealed that the 75-kDa protein associated with SAP upon TCR stimulation is not Dok1, ZAP70, SLAM, 2B4, SHP-2, Ku70, Ku86, or p85 phosphatidylinositol 3-kinase, indicating that an additional cellular protein that remains to be identified is likely involved in SAP-mediated signal transduction. In addition, because SAP interacts with a 75-kDa tyrosine-phosphorylated protein upon TCR stimulation, this interaction likely plays an important role in transducing the TCR signal to elicit cellular activation. Further study including an identification of a 75-kDa protein associated with SAP potentially delineates detailed roles of SAP in the TCR signal transduction pathway. Thus, through interactions with cellular signaling molecules, SAP likely plays pleotropic roles in numerous signal transduction pathways, and this activity may be relevant to the failure of XLP patients to survive following acute EBV infection (20, 31, 32, 33, 34, 35, 36, 44, 72).
The host T cell responses are particularly important for controlling
herpesvirus infection. XLP patients appear to be normal in their
response to childhood infections before they encounter EBV (44, 73). A unique feature of EBV infection is the extraordinary
proliferation of activated Ag-specific T cells and the EBV-infected B
cells (73). For example, as much as 10% of the total B
cell population may be infected in the course of normal infection.
Dramatic numbers of responding NK cells and CD4+
and CD8+ T lymphocytes are typically involved in
the normal response to primary EBV infection. Furthermore, the large
number of activated effector T cells are associated with the release of
cytokines and inflammatory mediators that ordinarily lead to IM. These
factors suggest that EBV infection is the foremost trigger for the
phenotypic expression of XLP syndrome due to the excessive T cell
activation. During EBV infection, SLAM-SLAM and MHC II molecule-TCR
interactions at the interface between EBV-infected B cells and CD4 T
cells, or CD482B4 interaction between EBV-infected B cells and NK
cells, may promote the development of EBV-specific Th responses.
However, SAP deficiency in XLP patients impairs SLAM and 2B4 signal
transduction, leading to reduced IFN-
production by Th cells and
decreased cytotoxicity of NK cells (20, 31, 32, 33, 34, 35, 36, 72). In
addition, aberrant TCR signal transduction in XLP patients may result
in abnormalities of CD4 Th cell function and CD8 cytotoxic T cell
function, contributing to the inability of the immune system to control
EBV infection. Further study of SAP function in lymphocyte signal
transduction pathways will pave the way for new strategies for the
treatment and cure of XLP syndrome.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint request to Dr. Jae U. Jung, Tumor Virology Division, Department of Microbiology and Molecular Genetics, New England Regional Primate Research Center, Harvard Medical School, 1 Pine Hill Drive, Southborough, MA 01772. E-mail address: jae_jung{at}hms.harvard.edu ![]()
3 Abbreviations used in this paper in this paper: IM, infectious mononucleosis; XLP, X-linked lymphoproliferative disease; SH2, src homology 2; SLAM, signaling lymphocytic activation molecule; SAP, SLAM-associated protein; SHP-2, SH2-containing protein tyrosine phosphatase; HVS, herpesvirus saimiri; TPA, 12-O-tetradecanoylphorbol-13-acetate; ZAP70,
-associated protein-70; GSK, glycogen synthase kinase; ERK, extracellular signal-regulated kinases; JNK, c-Jun NH2-terminal kinase; EF1, elongation factor 1; MAPK, mitogen-activated protein kinase; wt, wild type. ![]()
Received for publication April 16, 2001. Accepted for publication June 28, 2001.
| References |
|---|
|
|
|---|
production. J. Immunol. 158:4036.[Abstract]
/TNF-
receptors and CD2/CD58 interactions. J. Immunol. 153:4872.[Abstract]
B. Proc. Natl. Acad. Sci. USA 97:7470.
but not TH2 cytokines. Nat. Immunol. 2:37.[Medline]
interferon, and interleukins 3 and 4 is random in murine alloreactive T-lymphocyte clones. Proc. Natl. Acad. Sci. USA 85:9189.This article has been cited by other articles:
![]() |
N. J. Hare, C. S. Ma, F. Alvaro, K. E. Nichols, and S. G. Tangye Missense mutations in SH2D1A identified in patients with X-linked lymphoproliferative disease differentially affect the expression and function of SAP Int. Immunol., July 1, 2006; 18(7): 1055 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Chuang, J.-D. Lay, W.-C. Hsieh, H.-C. Wang, Y. Chang, S.-E. Chuang, and I.-J. Su Epstein-Barr virus LMP1 inhibits the expression of SAP gene and upregulates Th1 cytokines in the pathogenesis of hemophagocytic syndrome Blood, November 1, 2005; 106(9): 3090 - 3096. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chen, A. K. Tai, M. Lin, F. Chang, C. Terhorst, and B. T. Huber Signaling Lymphocyte Activation Molecule-Associated Protein Is a Negative Regulator of the CD8 T Cell Response in Mice J. Immunol., August 15, 2005; 175(4): 2212 - 2218. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Dupre, G. Andolfi, S. G. Tangye, R. Clementi, F. Locatelli, M. Arico, A. Aiuti, and M.-G. Roncarolo SAP controls the cytolytic activity of CD8+ T cells against EBV-infected cells Blood, June 1, 2005; 105(11): 4383 - 4389. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Martin-Fernandez, J. A. Cabanillas, M. Rivero-Carmena, E. Lacasa, J. Pardo, A. Anel, P. R. Ramirez-Duque, F. Merino, C. Rodriguez-Gallego, and J. R. Regueiro Herpesvirus saimiri-transformed CD8+ T cells as a tool to study Chediak-Higashi syndrome cytolytic lymphocytes J. Leukoc. Biol., May 1, 2005; 77(5): 661 - 668. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sharifi, J. C. Sinclair, K. C. Gilmour, P. D. Arkwright, C. Kinnon, A. J. Thrasher, and H. B. Gaspar SAP mediates specific cytotoxic T-cell functions in X-linked lymphoproliferative disease Blood, May 15, 2004; 103(10): 3821 - 3827. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Simarro, A. Lanyi, D. Howie, F. Poy, J. Bruggeman, M. Choi, J. Sumegi, M. J. Eck, and C. Terhorst SAP increases FynT kinase activity and is required for phosphorylation of SLAM and Ly9 Int. Immunol., May 1, 2004; 16(5): 727 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Sorokina, J. J. Merlo Jr., and A. Y. Tsygankov Molecular Mechanisms of the Effect of Herpesvirus saimiri Protein StpC on the Signaling Pathway Leading to NF-{kappa}B Activation J. Biol. Chem., April 2, 2004; 279(14): 13469 - 13477. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sanzone, M. Zeyda, M. D. Saemann, M. Soncini, W. Holter, G. Fritsch, W. Knapp, F. Candotti, T. M. Stulnig, and O. Parolini SLAM-associated Protein Deficiency Causes Imbalanced Early Signal Transduction and Blocks Downstream Activation in T Cells from X-linked Lymphoproliferative Disease Patients J. Biol. Chem., August 8, 2003; 278(32): 29593 - 29599. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shinozaki, H. Kanegane, H. Matsukura, R. Sumazaki, M. Tsuchida, M. Makita, Y. Kimoto, R. Kanai, K. Tsumura, T. Kondoh, et al. Activation-dependent T cell expression of the X-linked lymphoproliferative disease gene product SLAM-associated protein and its assessment for patient detection Int. Immunol., October 1, 2002; 14(10): 1215 - 1223. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |