|
|
||||||||





*
Baylor Institute for Immunology Research, Dallas, TX 75204; and
Department of Pediatrics, University of Texas Southwestern Medical Center, Dallas, TX 75390
| Abstract |
|---|
|
|
|---|
90% reduced,
whereas oligoclonal plasma cell precursors are 3-fold expanded,
independently of disease activity and modality of therapy. Pregerminal
center cells in SLE are decreased to a lesser extent than conventional
B cells, and therefore represent the predominant blood B cell subset in
a number of patients. Thus, SLE is associated with major blood B cell
subset alterations. | Introduction |
|---|
|
|
|---|
In recent years our laboratory has developed methods to isolate and
characterize mature peripheral B cells. Using anti-IgD and
anti-CD38 Abs, four mutually exclusive peripheral B cell
populations can be isolated (reviewed in Refs. 18 and
19). Single-positive IgD cells correspond to follicular
mantle cells (Bm1 + Bm2), whereas single-positive CD38 cells correspond
to germinal center (GC) cells (Bm3 + Bm4). Double-negative B cells
correspond to the memory population (Bm5), whereas double-positive
cells represent a combination of cells at a transitional stage between
follicular mantle and GC (Bm2') and single-isotype
IgD+ GC cells (20). More recently,
CD27 has been reported as marker of memory B cells within both the
sIgD+ and sIgD- peripheral
B cell compartments (21, 22). The phenotypic summary of
these populations is depicted in Table I
.
|
Although extensive information has accumulated on the mature B cells that populate peripheral lymphoid organs such as human tonsils, little is known about blood B cell subsets. We have thus analyzed the peripheral blood B cell compartment of healthy adults, healthy children, and children suffering from rheumatic diseases including juvenile dermatomyositis (JDM) and, most particularly, SLE. These studies have permitted us to identify a novel blood B cell population expressing a partial GC phenotype and an oligoclonal plasmablast population. Although these populations are not restricted to SLE patients, the disproportionate depletion of conventional naive and memory B cells in SLE make pre-GC cells and plasmablasts predominate in SLE blood.
| Materials and Methods |
|---|
|
|
|---|
Blood samples from 35 healthy children, 68 children with SLE, 10
with JDM, and 17 healthy adults were drawn after informed consent in
accordance with our institutional internal review board was obtained.
All pediatric SLE patients included in this study fulfil the
established American College of Rheumatology criteria for SLE
(31). The patients clinical and serological data were
gathered during clinic visits, and the corresponding SLE disease
activity index (SLEDAI) was recorded in the chart (32).
The average ± SD age and the sex ratio for each of the groups
were: 1) healthy children group, 12.15 ± 3.15 years, 3:1
female/male; 2) pediatric SLE group with SLEDAI >10 (n
= 36), 14 ± 2.67 years, 5:1 female/male; 3) pediatric SLE group
with SLEDAI <10 (n = 32), 13 ± 3.15 years, 6:1
female/male; 4) JDM group, 9.2 ± 3.8 years, 4:1 female/male; and
5) adult group, 36.8 ± 6.21 years, 3:2 female/male. SLE patients
belong to different ethnic backgrounds, including Caucasian (32.3%),
African-American (25.3%), Hispanic (23.9%), and Oriental (4.2%). The
healthy children control group had a similar ethnic distribution.
Therapy guidelines for childhood SLE are similar to those for adult SLE
patients. Most of the included patients were being treated with oral
prednisone and hydroxychloroquine, and those with type III/IV nephritis
and/or major extrarenal organ involvement were receiving i.v.
cyclophosphamide (
20% of patients) and/or methylprednisolone
(
40% of patients). Blood samples were drawn at least 4 wk after the
last i.v. pulse of either of these medications had been administered.
Selected patients with JDM had active disease and were treated with
oral prednisone and/or i.v. methylprednisolone at doses comparable to
those given the SLE patients (10/10).
Flow cytometric analysis of blood B cells
Two methods have been used to assess blood B cells. The first analyzes purified B cells, whereas the second analyzes total blood and has the considerable advantage of necessitating only 0.5 ml (rather than 1020 ml) of blood. Samples from 44 SLE patients, 22 healthy children, 10 JDM, and 17 healthy adults were analyzed using enriched B cells, whereas samples from 24 SLE patients and 13 healthy children were assessed using whole blood. The validity of the whole blood method has been established on three patients and yielded comparable results, therefore permitting us to pool the results of a 30-mo-long study. Absolute numbers of cells were calculated from the relative size of total B cells and B cell subpopulations and the absolute leukocyte and/or PBMC counts.
Isolation of peripheral blood B cells
Mononuclear cells were isolated using gradient centrifugation
over a Hystopaque cushion. The resulting population was enriched for B
cells using negative depletion with magnetic beads coupled to
anti-CD2, CD3, CD4, CD14, CD16, CD56, and glycophorin A (stem
cell). The enriched B cells were stained with fluorochrome-labeled Abs
(FITC, PE, Tricolor, PerCP, and allophycocyanin). The following were
used: anti-human CD3-FITC, CD7-FITC, CD14-PE, CD19-allophycocyanin,
CD20-PerCP (BD Biosciences, Mountain View, CA); CD10-FITC, CD40-PE,
CD71-FITC, CD79a-FITC (Immunotech Research, Quebec, Canada); CD23-PE,
CD56-FITC (Caltag, South San Francisco, CA); CD38-PE, CD5-PE,
CD138-FITC,
and
light chain-PE (Serotec, Oxford, U.K.);
CD154-FITC (Ancell, Bayport, MN); and anti-human IgD-FITC,
IgM-PE, IgG-PE, IgE-FITC, IgA-FITC (Southern Biotechnology Associates,
Birmingham, AL). Stained cells were analyzed using flow cytometry
(FACSCalibur, BD Biosciences). All experiments were analyzed after
gating on live cells according to forward side scatter/side light
scatter. A minimum of 100,000 cells was used for each staining
condition, and 5,00050,000 events were recorded for analysis.
Selected populations of cells were sorted for immunohistochemistry or
molecular studies using the FACSVantage (BD Biosciences)
instrument.
Labeling of cell surface Ags from whole blood samples
Whole blood was collected into tubes containing heparin or ACD and stained with the following Abs: IgD-FITC,CD38-PE, CD20-PerCP, and CD19-allophycocyanin and corresponding isotype controls. We used 50 µl blood and 3 µl of each Ab per tube for each staining. After staining, the blood was lysed with FACS Lysing Solution (BD Biosciences), rinsed with PBS, centrifuged at 1200 rpm for 10 min, and resuspended in 1% paraformaldehyde. Samples were then analyzed on a BD Biosciences flow cytometer (FACSCalibur).
Amplification of the centerin gene
Real-time PCR was performed using an ABI Prism 7700 sequence detector (PE Biosystems, Foster City, CA). The RT-PCR conditions were 30 min at 48°C and 10 min at 95°C, followed by 50 cycles of 15 s at 95°C and 1 min at 60°C. The Taqman PCR core kit reagents (PE Biosystems), Multiscribe reverse transcriptase (PE Biosystems), and RNase inhibitor (PE Biosystems) were used according to the manufacturers suggested concentrations for a multiplex reaction. The 18S ribosomal RNA and Centerin standard curves were generated using a serial dilution of a known quantity of Raji total RNA. Ribosomal RNA analysis was performed using the ribosomal RNA control reagent kit (PE Biosystems). The centerin probe (6-FAM-tcaccagaaccatggccgtcagaag-TAMRA) was used at a concentration of 250 nM, and the forward and reverse centerin primers (forward aagggaaggttgtagacataatcca; reverse gcttctcccacttggctttaaa) were used at a concentration of 900 nM.
Sequencing of Ig VH genes
Total RNA from between 1,000 and 100,000 sorted B cells was
prepared using the mini-RNEASY kit, (Qiagen, Valencia, CA) following
the manufacturers protocol. RT-PCR was performed on 10% of the total
RNA generated from the sorted cells using the Titan RT-PCR kit (Roche,
Indianapolis, IN). The VH region of IgM
transcripts was amplified using either a VH4 or a
VH5 leader primer in combination with a
µ-constant region reverse primer, as previously described (33, 34). The VH region of IgG was amplified
using identical forward primers with a
-specific constant region
reverse primer. The VH fragments were excised
from a low melt agarose gel and reamplified using heminested reverse
primers and the high fidelity PFU polymerase (Stratagene, La Jolla,
CA). The PCR fragments were either t-tailed with
Taq polymerase (Promega, Madison, WI) and subsequently
cloned into the pCRII-TOPO vector or directly cloned into the
pCR-blunt-II-TOPO vector (Invitrogen, Carlsbad, CA) and sequenced in
both directions using an automated DNA sequencer (ABI-377; Advanced
Biotechnologies, Columbia, MD).
Analyses of DNA sequences
Sequences were edited and analyzed using the DNAstar software package (DNAstar, Madison, WI). Cloned products were searched against the IMGT (the international ImMunoGeneTics database, http://imgt.cines.fr:8104) (35).
Statistical analysis
The data obtained in this study were evaluated using a two-tailed t test and multivariable statistical analysis, as well as the Pearson correlation ratio.
| Results |
|---|
|
|
|---|
Although lymphopenia has been described in SLE (3),
the extent of T and B cell decrease remains uncharacterized. Therefore,
we measured the absolute numbers of CD3+,
CD14+, and
CD20+/19+ cells in the
blood of 1) 68 children suffering from SLE, 2) 35 age-matched healthy
controls, 3) 10 children with JDM to control for the effect of steroid
treatment, and 4) 17 healthy adults. SLE patients were divided into two
groups according to their disease activity index (SLEDAI over or under
10) measured at the time of blood sampling. The ages (mean and
SD) of the SLE patients and healthy controls were comparable (see
Materials and Methods). As previously reported (36, 37), when compared with adults healthy children display
significantly more blood CD3+ T cells (1687
± 1139 vs 881 ± 202 cells/µl; p = 0.002) and
CD19+ B cells (394 ± 196 vs 129 ± 67
cells/µl; p < 0.0001; Fig. 1
). Children with JDM, treated with
steroid regimens similar to those of SLE
patients, display numbers of CD19+ cells
comparable to those in healthy controls
(Table II
and Fig. 2
). The slight difference (not statistically
significant) may reflect the lower average age of the JDM group
(9.2 ± 3.8 vs 12.1 ± 3.5 years in JDM and healthy controls,
respectively).
|
|
|
Blood CD19+ B cells in SLE patients were reduced
by 81% compared with those in age-matched healthy controls (82.6
± 77.5 vs 394 ± 196 cells/µl; p < 0.0001).
There was no difference in the number of circulating B cells between
the two patient groups (Table II
), suggesting that B cell lymphopenia
in SLE is independent of disease activity. Although most of our
patients had been treated for weeks to years with steroids at the time
of study, the T and B cell lymphopenia is not a consequence of this
therapy, as newly diagnosed patients (3 of 68) were also found to have
similarly decreased numbers of T and B cells before they had entered
into any therapy (64.2 ± 72.1 B cells/µl; n =
3). Additionally, nine of the patients treated with i.v. solumedrol and
cyclophosphamide who were included in this study have been followed
after discontinuation of these drugs for periods between 6 mo and 2
years without finding statistically significant differences in the
number of B cells (data not shown).
Circulating naive and memory B cells are considerably reduced in SLE
Our earlier studies on tonsillar B cells showed that
CD38 expression permits us to distinguish plasmablasts/plasma cells and
GC B cells from naive and memory B cells (reviewed in Refs.
18 and 19). Thus,
CD19+CD20+CD38-
blood cells include both naive and memory B cells. As shown in Table II
, healthy children displayed significantly more conventional
mature
(CD19+CD20+CD38-)
B cells than adults (270 ± 157 vs 97 ± 49
cells/µl; p < 0.0001). In contrast, SLE patients
showed a marked reduction (
90%) in these cells compared with
age-matched controls (28.0 ± 40.3 cells/µl; p
< 0.0001). This reduction does not appear to be related to disease
activity (27.1 ± 41.6 cells/µl for SLEDAI <10; 28.6 ±
40.2 cells/µl for SLEDAI >10; Table II
).
The blood memory B cell population is best identified as CD20+CD27+ cells. We calculated the ratio of memory/naive B cells in healthy children and children with SLE and found no difference between the two groups (0.46 ± 0.30 and 0.49 ± 0.35 in healthy and SLE children, respectively).
B cells with pre-GC phenotype recirculate in blood of healthy and SLE children
Our initial studies on SLE total blood and enriched blood B
cells revealed a strikingly high percentage of circulating
CD20+IgD+CD38+
cells. A closer analysis of samples from non-SLE patients revealed that
cells with similar phenotype were also present in the blood of healthy
children, adults, and children with autoimmune diseases other than SLE,
prompting us to report their characterization (Fig. 3
). In absolute numbers healthy children
have the highest numbers of
IgD+CD38+ cells (57.6
± 53.3 cells/µl), followed by patients with JDM (37.4 ± 31.2
cells/µl). The number of
IgD+CD38+ cells in SLE
patients (21.4 ± 27.7 cells/µl SLEDAI >10, 18.2 ± 20.6
cells/µl SLEDAI <10) is comparable to that in adults (18.1 ±
18.7 cells/µl; Table II
). Due to the more drastic reduction in
conventional CD20+CD38-
cells in SLE patients, this population overall represents 29 ±
17.7% of SLE blood B cells (range, 677%), whereas it represents
13.2 ± 8 and 18.5 ± 14.9% of the total blood B cells in
healthy adults and children, respectively (Fig. 4
).
|
|
|
|
|
Most SLE patients display a distinct population of
CD20- CD19+/lowCD38++
blood cells (Fig. 7
, A and
B). Upon staining with CD27, these cells can be further
subdivided into a CD27+ and a
CD27++ population. Although the ratio of
CD27+/CD27++ varies, the
predominant population expresses CD27 with intensity comparable to that
of memory (CD27+) B cells (Fig. 7
B).
After sorting and Wright Giemsa staining, the majority of these cells
do not look like mature plasma cells but like plasmablasts/early plasma
cells (39, 40), as they have larger, less peripheral
nuclei and less abundant cytoplasms (Fig. 5
, c and
d). The majority of these cells express both surface and
intracytoplasmic Ig, with a 
ratio close to 1 (43.5 ±
17.9%
), whereas only a small percentage (15.5 ± 8.8%) of
them expresses the mature plasma cell marker CD138 or syndecan.
|
We sorted these cells and analyzed 38 IgG VH gene
transcripts from four different SLE patients. All but two transcripts
showed a high frequency of somatic mutations (mean, 16 ± 8.5
mutations/mutated transcript). However, a striking finding was the
identification in three of four patients of clonally related
transcripts. An example of the VH sequences
corresponding to an expanded clone (seven related transcripts), with
unique and shared mutations, is displayed in Fig. 8
. The pattern of nucleotide mutation
within this clone strongly suggests that it is the product of an
Ag-driven response, as there is a high ratio of replacement vs silent
substitution, especially concentrated within the second hypervariable
region and the third framework. Clonally related, somatically mutated
transcripts were also found in the blood plasma cell precursors
isolated from two healthy adults (data not shown), suggesting that
these cells in health and disease are the product of oligoclonal
expansions.
|
To determine whether the consistently low numbers of blood B cells and/or the activated B cell phenotype that we observed in our SLE patients were due to soluble serum factors, we purified naive blood and tonsilar B cells from healthy donors and cultured them in the presence of autologous sera, sera from four lymphopenic SLE patients with different SLEDAI, and sera from two patients with JDM. The percentage and absolute numbers of viable cells were calculated at 24, 48, 72, and 96 h using a hemocytometer after trypan blue staining. Apoptotic cells were also analyzed by flow cytometry using forward side scatter/side light scatter and annexin V binding/propidium iodine staining. No consistent differences were observed (data not shown), thus suggesting that a soluble factor(s) is not responsible for mature B cell death and subsequent lymphopenia in all SLE patients.
| Discussion |
|---|
|
|
|---|
Our study shows that blood B cells in all age groups include at least four subsets: 1) naive (CD19+CD20+IgD+CD38-CD27-) B cells, 2) pre-GC (CD19+CD20+IgD+CD38+CD27-) B cells, 3) memory (CD19+CD20+CD38-CD27+) B cells, and 4) plasma cell precursors (CD19+CD20-CD27+/++CD38++). When comparing children to adults, naive and memory B cells are 2.4-fold more abundant, whereas pre-GC B cells and plasma cell precursors are 3- and 4-fold expanded, respectively, in children.
A puzzling observation is the detection in blood of sIgM+ sIgD+ B cells bearing a phenotype similar to that of tonsil GC B cell founders. As GC B cells, these cells express CD38 and centerin, but, unlike GC founders (Bm2') and centroblasts (Bm3), they lack the expression of CD10 and CD77. Furthermore, they are smaller than centroblasts, hence their denomination as pre-GC cells. Importantly, these cells have initiated the process of somatic mutation, which is another hallmark of GC reactions; sequencing the VH Ig transcripts from sorted sIgD+sIgM+CD38+ blood B cells from healthy adults revealed a mutation frequency similar to that described for tonsilar GC B cell founders (112 bp mutations/VH region in 80% transcripts) and higher than that of naive B cells (12 bp mutations/VH region in 50% transcripts) (33, 39). Thus, IgM+IgD+CD38+ blood B cells may represent the link between naive (Bm1 and Bm2) and GC founders (Bm2'). It remains to be established whether these cells result from 1) activation in lymphoid sites and recirculation in the blood, or 2) activation in nonlymphoid sites followed by recirculation in the blood and later homing to peripheral lymphoid organs.
Plasma cell precursors constitute another underestimated circulating
cell population. We show herein that they represent
1.4% of the
total B cell compartment in healthy adults and
3.3% in healthy
children. In the context of certain infections and malignancies, higher
numbers of plasmablasts have been described in the blood (reactive
plasmacytosis) (40, 41). These cells have been reported to
characteristically lack the plasma cell marker CD138, but they acquire
it in vitro upon exposure to IL-6 (41). Additionally,
these cells express variable levels of CD27 (Refs. 42 and
43 , and our own observation), suggesting caution when
using CD27 to enumerate memory cells, especially in clinical situations
where plasmacytosis may be expected.
Blood B cell subsets in children with SLE
Our studies reveal that children with SLE suffer profound B cell lymphopenia due to a dramatic reduction in all mature B cell subsets. SLE B cell lymphopenia does not correlate with any modality of therapy, SLEDAI, or anti-dsDNA or complement titers. SLE B cell lymphopenia could be due to 1) a reduction in the number of bone marrow B cell precursors, 2) shortened mature B cell life span, or 3) accelerated activation/differentiation of naive cells into downstream phenotypes including GC, memory, or plasma cells that would subsequently home into lymphoid tissues.
Killing of B cells by soluble factors (i.e., anti-lymphocytic Abs) has been implicated as a cause of SLE lymphopenia (44, 45). Although this mechanism may operate in some SLE patients, our results suggest that it is unlikely to explain the universal lymphopenia observed in this disease, as incubation of blood naive B cells from healthy donors with serum from active SLE patients failed to disclose any significant reduction in the number of viable cells. Additionally, the B and T lymphocyte propensity to undergo spontaneous and induced apoptosis has been recently described to be grossly intact in SLE (46).
The lymphopenia that we describe cannot be explained by bone marrow
aplasia, as the neutrophil and platelet counts were within normal
limits in the population that we studied. Furthermore, bone marrow
aspirates from SLE patients, usually obtained in the context of severe
blood cytopenias, have rarely revealed aplasias (47, 48, 49).
Therefore, only a selective lymphoid cell precursor defect could
explain the reduced numbers of T and B cells that we observed in the
blood of our SLE patients. The increased proportion of
CD38+ B cells in SLE blood may provide us with
some clues regarding the lymphopenia and perhaps some ethiopathogenic
factors in this disease. In trying to induce naive B cells to become GC
B cells in vitro, we identified IFN-
as one of the most efficient
signals to up-regulate CD38 expression on naive B cells
(50). Interestingly, high levels of IFN-
have been
described in the serum of SLE patients (51), and the PBMCs
of patients without circulating IFN-
display high levels of
oligoadenylate synthetase and Mx protein, a signature of exposure to
IFN-
(52, 53). The potential role of this cytokine in
SLE development is further suggested by the large proportion of
patients receiving IFN-
therapy who develop autoimmune, including
SLE-like, syndromes (reviewed in Ref. 54). Finally, and
perhaps best explaining the generalized lymphopenia of SLE patients,
administration of IFN-
to newborn mice inhibits T and B cell
development in the bone marrow, thymus, and spleen by 80%
(55). Therefore, all these findings make it tempting to
speculate that SLE may be associated with a deregulation of IFN-
production. Consistent with this hypothesis, the blood pre-GC
(IgD+CD38+) B cell
subpopulation is reduced to a lesser extent in SLE patients compared
with controls and represents the predominant blood B cell population in
many SLE patients.
In contrast to the reduction in all mature B cell subsets, children with SLE present a 3-fold expansion of blood plasma cell precursors that make up to 8.7% of their blood B cell compartment. Plasma cells expressing CD138 and high levels of CD27 have been recently reported in the blood of 13 adult SLE patients (43). In our study only a small proportion of the CD20-CD19lowCD38++ cells in the 68 patients analyzed display this more mature phenotype, whereas the majority lack CD138, express two levels of CD27 (comparable and higher than memory B cells), and upon sorting and Giemsa staining do not show a mature plasma cell morphology.
Blood plasma cell precursors are post-GC cells, as they express highly
mutated and isotype-switched Ig transcripts. Additionally, there is a
high degree of clonal relatedness within this subset, as numerous
transcripts share the same VDJ rearrangement while displaying common
and unique nucleotide substitutions. This suggests that they are the
products of a recent clonal expansion that probably occurred in a GC,
given the presence of unique mutations. This expansion may be explained
by increased IL-10, a major plasma cell differentiation factor
(56). Indeed, high levels of IL-10 are found in the serum
of SLE patients, and treatment of these patients with anti-IL-10
Abs has shown beneficial effects (57, 58, 59). Alternatively,
the recently identified B lymphocyte stimulator (BLyS/BAFF/TALL-1), a
TNF family cytokine (60, 61, 62, 63), may contribute to the
disease, as it seems to prominently enhance humoral responses. BLyS
transgenic mice show hypergammaglobulinemia and an autoimmune
lupus-like disease (61). Furthermore, the survival of
lupus-prone mice is increased by treatment with a BLyS antagonist
(63). Although altered expression of BLyS and/or its
receptors may play a role in human SLE, significant differences between
the B cell phenotype found in BLyS transgenic mice and human SLE exist,
as these transgenic mice display B cell expansion in the blood rather
than the profound B cell lymphopenia that we describe in our patients.
SLE may thus be best explained by the combined ectopic expression of
cytokines such as
-IFN, IL-10, and BLyS. The etiology of this
disease may be explained at the level of cells that produce these
cytokines, which include APC such as dendritic cells.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Virginia Pascual, Baylor Institute for Immunology Research, Dallas, TX 75204. E-mail address: virginip{at}baylordallas.edu ![]()
3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; CD40L, CD40 ligand; GC, germinal center; JDM, juvenile dermatomyositis; SLEDAI, SLE disease activity index. ![]()
Received for publication February 15, 2001. Accepted for publication June 5, 2001.
| References |
|---|
|
|
|---|
promote the survival of germinal center B cells: evidence for bifurcation in the development of centrocytes rescued from apoptosis. Eur. J. Immunol. 21:1107.[Medline]
This article has been cited by other articles:
![]() |
S. Sarantopoulos, K. E. Stevenson, H. T. Kim, C. S. Cutler, N. S. Bhuiya, M. Schowalter, V. T. Ho, E. P. Alyea, J. Koreth, B. R. Blazar, et al. Altered B-cell homeostasis and excess BAFF in human chronic graft-versus-host disease Blood, April 16, 2009; 113(16): 3865 - 3874. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lee, S. Kuchen, R. Fischer, S. Chang, and P. E. Lipsky Identification and Characterization of a Human CD5+ Pre-Naive B Cell Population J. Immunol., April 1, 2009; 182(7): 4116 - 4126. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Hostmann, A. Jacobi, H Mei, F Hiepe, and T Dorner Peripheral B cell abnormalities and disease activity in systemic lupus erythematosus Lupus, December 1, 2008; 17(12): 1064 - 1069. [Abstract] [PDF] |
||||
![]() |
B. Mietzner, M. Tsuiji, J. Scheid, K. Velinzon, T. Tiller, K. Abraham, J. B. Gonzalez, V. Pascual, D. Stichweh, H. Wardemann, et al. Autoreactive IgG memory antibodies in patients with systemic lupus erythematosus arise from nonreactive and polyreactive precursors PNAS, July 15, 2008; 105(28): 9727 - 9732. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-H. Chang, T. McKenzie, G. Bonventi, C. Landolt-Marticorena, P. R. Fortin, D. Gladman, M. Urowitz, and J. E. Wither Expanded Population of Activated Antigen-Engaged Cells within the Naive B Cell Compartment of Patients with Systemic Lupus Erythematosus J. Immunol., January 15, 2008; 180(2): 1276 - 1284. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wei, J. Anolik, A. Cappione, B. Zheng, A. Pugh-Bernard, J. Brooks, E.-H. Lee, E. C. B. Milner, and I. Sanz A New Population of Cells Lacking Expression of CD27 Represents a Notable Component of the B Cell Memory Compartment in Systemic Lupus Erythematosus J. Immunol., May 15, 2007; 178(10): 6624 - 6633. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Su, H. Yang, X. Li, X. Li, A. W. Gibson, J. M. Cafardi, T. Zhou, J. C. Edberg, and R. P. Kimberly Expression Profile of Fc{gamma}RIIb on Leukocytes and Its Dysregulation in Systemic Lupus Erythematosus J. Immunol., March 1, 2007; 178(5): 3272 - 3280. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Good, V. L. Bryant, and S. G. Tangye Kinetics of Human B Cell Behavior and Amplification of Proliferative Responses following Stimulation with IL-21 J. Immunol., October 15, 2006; 177(8): 5236 - 5247. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Cuss, D. T. Avery, J. L. Cannons, L. J. Yu, K. E. Nichols, P. J. Shaw, and S. G. Tangye Expansion of Functionally Immature Transitional B Cells Is Associated with Human-Immunodeficient States Characterized by Impaired Humoral Immunity J. Immunol., February 1, 2006; 176(3): 1506 - 1516. [Abstract] [Full Text] [PDF] |
||||
![]() |
B K Han, A M White, K H Dao, D R Karp, E K Wakeland, and L S Davis Increased prevalence of activated CD70+CD4+ T cells in the periphery of patients with systemic lupus erythematosus Lupus, August 1, 2005; 14(8): 598 - 606. [Abstract] [PDF] |
||||
![]() |
A. J. Gross, D. Hochberg, W. M. Rand, and D. A. Thorley-Lawson EBV and Systemic Lupus Erythematosus: A New Perspective J. Immunol., June 1, 2005; 174(11): 6599 - 6607. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. William, C. Euler, E. Leadbetter, A. Marshak-Rothstein, and M. J. Shlomchik Visualizing the Onset and Evolution of an Autoantibody Response in Systemic Autoimmunity J. Immunol., June 1, 2005; 174(11): 6872 - 6878. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Sims, R. Ettinger, Y. Shirota, C. H. Yarboro, G. G. Illei, and P. E. Lipsky Identification and characterization of circulating human transitional B cells Blood, June 1, 2005; 105(11): 4390 - 4398. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Tarlinton and P. D. Hodgkin Targeting Plasma Cells in Autoimmune Diseases J. Exp. Med., June 7, 2004; 199(11): 1451 - 1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. I. Ellyard, D. T. Avery, T. G. Phan, N. J. Hare, P. D. Hodgkin, and S. G. Tangye Antigen-selected, immunoglobulin-secreting cells persist in human spleen and bone marrow Blood, May 15, 2004; 103(10): 3805 - 3812. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Dorner and P E Lipsky Correlation of circulating CD27high plasma cells and disease activity in systemic lupus erythematosus Lupus, May 1, 2004; 13(5): 283 - 289. [Abstract] [PDF] |
||||
![]() |
R J Looney, J Anolik, and I Sanz B lymphocytes in systemic lupus erythematosus: lessons from therapy targeting B cells Lupus, May 1, 2004; 13(5): 381 - 390. [Abstract] [PDF] |
||||
![]() |
A. J. Cappione, A. E. Pugh-Bernard, J. H. Anolik, and I. Sanz Lupus IgG VH4.34 Antibodies Bind to a 220-kDa Glycoform of CD45/B220 on the Surface of Human B Lymphocytes J. Immunol., April 1, 2004; 172(7): 4298 - 4307. [Abstract] [Full Text] [PDF] |
||||
![]() |
R Weide, J Heymanns, A Pandorf, and H Koppler Successful long-term treatment of systemic lupus erythematosus with rituximab maintenance therapy Lupus, October 1, 2003; 12(10): 779 - 782. [Abstract] [PDF] |
||||
![]() |
M Odendahl, R Keitzer, U Wahn, F Hiepe, A Radbruch, T Dorner, and R Bunikowski Perturbations of peripheral B lymphocyte homoeostasis in children with systemic lupus erythematosus Ann Rheum Dis, September 1, 2003; 62(9): 851 - 858. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shiono, Y. L. Wong, I. Matthews, J.-L. Liu, W. Zhang, G. Sims, A. Meager, D. Beeson, A. Vincent, and N. Willcox Spontaneous production of anti-IFN-{alpha} and anti-IL-12 autoantibodies by thymoma cells from myasthenia gravis patients suggests autoimmunization in the tumor Int. Immunol., August 1, 2003; 15(8): 903 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bennett, A. K. Palucka, E. Arce, V. Cantrell, J. Borvak, J. Banchereau, and V. Pascual Interferon and Granulopoiesis Signatures in Systemic Lupus Erythematosus Blood J. Exp. Med., March 17, 2003; 197(6): 711 - 723. [Abstract] [Full Text] [PDF] |
||||
![]() |
M K Crow Studies of autologous T cell activation in the Kunkel laboratory Lupus, March 1, 2003; 12(3): 163 - 169. [Abstract] [PDF] |
||||
![]() |
K N Potter, C I Mockridge, A Rahman, S Buchan, T Hamblin, B Davidson, D A Isenberg, and F K Stevenson Disturbances in peripheral blood B cell subpopulations in autoimmune patients Lupus, December 1, 2002; 11(12): 872 - 877. [Abstract] [PDF] |
||||
![]() |
P. Blanco, A. K. Palucka, M. Gill, V. Pascual, and J. Banchereau Induction of Dendritic Cell Differentiation by IFN-alpha in Systemic Lupus Erythematosus Science, November 16, 2001; 294(5546): 1540 - 1543. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |