The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Aderem, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Aderem, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
The Journal of Immunology, 2001, 167: 2227-2233.
Copyright © 2001 by The American Association of Immunologists

Functional Transitions in Macrophages During In Vivo Infection with Mycobacterium bovis Bacillus Calmette-Guérin1

Jessica A. Hamerman* and Alan Aderem2,*,{dagger}

* Department of Immunology, University of Washington, Seattle, WA 98195; and {dagger} Institute for Systems Biology, Seattle, WA 98105


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Macrophage activation during the immune response to intracellular bacteria is critical for resolution of the infection. We have investigated the pathway of macrophage activation during murine Mycobacterium bovis bacillus Calmette-Guérin (BCG) infection. Three distinct phenotypes of macrophages were identified and compared: resident peritoneal macrophages, day 2 postinfection macrophages, and 12-day postinfection macrophages. Compared with resident peritoneal macrophages, day 2 BCG macrophages expressed intermediate levels of the cell surface receptors Mac1 and F4/80 and low levels of MHC class II molecules. These cells were highly phagocytic and produced large amounts of mRNA encoding the chemokine IP-10. In addition, day 2 BCG macrophages did not generate reactive nitrogen intermediates, though they were primed to do so, and did not have increased levels of TNF-{alpha} mRNA. Blockade of monocyte influx into the peritoneal cavity using Abs to platelet endothelial cell adhesion molecule 1 had no effect on the appearance of day 2 BCG macrophages, suggesting this cell can differentiate from resident peritoneal macrophages. In contrast to day 2 BCG macrophages, day 12 BCG macrophages were poorly phagocytic, but produced high levels of reactive nitrogen intermediates, IP-10 and TNF-{alpha} mRNA, and class II MHC molecules. We propose that day 2 BCG macrophages are specialized for phagocytic uptake of pathogens from the extracellular space, whereas day 12 BCG macrophages are specialized for killing of the internalized pathogens. This functional transition during activation is reminiscent of that seen during maturation/activation of the related dendritic cell lineage induced by bacterial or inflammatory stimuli.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Macrophages are a critical component of the innate and adaptive immune response to bacterial pathogens; they internalize and degrade bacteria and induce inflammatory responses. In addition to their effector function, macrophages also coordinate the host response by producing chemokines and cytokines, and by Ag presentation to activated T cells.

Intraperitoneal infection of mice with the intracellular bacterium Mycobacterium bovis bacillus Calmette-Guérin (BCG)3 has been a classical system for the study of macrophage activation. The first interaction of the immune system with BCG is by the resident tissue macrophages, in this case the resident peritoneal (RP) macrophage. During phagocytosis of the bacteria, pattern recognition receptors such as the Toll-like receptors induce a variety of inflammatory responses in the macrophage (1, 2, 3, 4). After the initial interactions of the RP macrophages with BCG, a complex series of events ensue that result in macrophage activation. These events include the extravasation of monocytes, NK cells, and T cells into the inflamed tissue, as well as the interaction of these cells with macrophages and/or macrophage products (5, 6, 7, 8). At the site of infection, NK cells and T cells produce cytokines such as IFN-{gamma} that are critical for macrophage activation (9, 10). BCG-activated macrophages produce high levels of bacteriocidal molecules (11) and cytokines (12), up-regulate expression of MHC class II molecules, and down-regulate the cell surface receptor F4/80 (13).

Previous studies of the pathway by which resting macrophages or monocytes differentiate into the classical BCG-activated macrophage have focused on single time points after infection or on one functional aspect of these cells. Recent studies on the differentiation of dendritic cells (DC), a related cell type, in response to infectious or inflammatory stimuli have suggested that the paradigm of macrophage activation should be revisited. Immature or resting DC are efficient at Ag uptake, while mature or activated DC down-regulate this ability and up-regulate the capacity to stimulate naive T cells (14). Immature DC acquire Ag through endocytosis, macropinocytosis, and phagocytosis (15, 16, 17, 18, 19), while mature DC stimulate naive T cells through cell surface expression of class II MHC molecules and costimulatory molecules (20, 21, 22, 23, 24). This process allows the DC to regulate its functional capabilities during an immune response. DC maturation is induced by a variety of bacteria and bacterial stimuli including bacterial endotoxin (LPS) and mycobacteria (21, 25, 26, 27), as well as host inflammatory mediators such as IL-1 and TNF-{alpha} (16).

We hypothesized that macrophages also undergo a functional transition during activation induced by bacterial stimuli in vivo and therefore compared the functional capacities of RP macrophages with those activated 2 days or 12 days after BCG infection. These three populations of macrophages are phenotypically and functionally distinct. Day 2 BCG macrophages are highly phagocytic while day 12 BCG macrophages are poorly phagocytic, but produce far higher levels of reactive nitrogen intermediates (RNI) and MHC class II molecules than their day 2 counterparts. We propose that macrophages 2 days post-BCG infection are specialized for bacterial clearance from the extracellular space and that those at 12 days postinfection are specialized for bacterial killing. Additionally, these two populations of macrophages produce different levels of the cytokine, TNF-{alpha}, and the chemokine, IP-10, suggesting that the influence of macrophages on the ongoing immune response differs at distinct times after infection.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
BCG and infection

M. bovis BCG (strain Pasteur; American Type Culture Collection, Manassas, VA) was a gift from Dr. S. Smith (University of Washington, Seattle, WA). BCG was grown in Proskauer-Beck medium with aeration to 5 x 107 CFU/ml and stored in aliquots at -70oC. To infect mice, an aliquot of BCG was thawed, sonicated three times for 30 s in a water bath sonicator, and diluted in PBS. C57BL/6 or Fc{gamma}RII-/- mice (The Jackson Laboratory, Bar Harbor, ME) were injected i.p. with 5 x 106 CFU of BCG in 0.5 ml. In some experiments, mice were injected i.v. with 100 µg of anti-platelet endothelial cell adhesion molecule-1 (PECAM-1) Ab 2H8 (28), a gift from Dr. W. Muller (Cornell University), or control hamster IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) 1 h before BCG infection.

Flow cytometry and cell sorting

Cells were isolated from the peritoneal cavity of uninfected mice or mice at the indicated day after BCG infection by peritoneal lavage with 6 ml of ice-cold PBS. After blocking with 2.4G2 (American Type Culture Collection) supernatant, 5 x 105 cells were stained with Mac1 FITC, B220 PE, Gr1 PE, and biotinylated F4/80 (Caltag Laboratories, South San Francisco, CA) or IAb or with Gr1 FITC, B220 PE, and biotinylated Mac1. This was followed by staining with streptavidin TC (Caltag Laboratories) and fixation in 1% paraformaldehyde. All Abs were purchased from BD PharMingen (San Diego, CA) unless otherwise indicated. Cells were analyzed on a FACScan with CellQuest software (BD Biosciences, Mountain View, CA). Macrophages were sorted as Mac1-positive, B220, and Gr1-negative cells that were large by forward scatter and side scatter analysis on a FACSVantage (BD Biosciences).

Phagocytosis

FITC-loaded SRBC ghosts were prepared by incubating SRBC (ICN Pharmaceuticals, Cosa Mesa, CA) with FITC-labeled OVA (Molecular Probes, Eugene, OR) in hypotonic lysis buffer (1 mM MgCl2 and 100 mM EGTA in 0.02x PBS) for 1 h on ice. Isotonicity was restored with 5x PBS and the ghosts were sealed at 37oC for 1 h. Excess FITC-OVA was removed by washing three times in PBS. IgG-opsonized SRBC were prepared by incubating FITC-loaded SRBC ghosts with anti-SRBC IgG (Intercell) at a 1/200 dilution for 30 min at room temperature. C3bi-opsonized SRBC were prepared by incubating FITC-loaded SRBC ghosts with anti-SRBC IgM (Intercell Technologies, Hopewell, NJ) for 30 min at room temperature in PBS, followed by one wash and incubation in 10% C5-deficient human serum (Sigma, St. Louis, MO) in DMEM (J.R.H.) for 1 h at 37°C. FITC-zymosan was purchased from Molecular Probes.

A total of 5 x 105 macrophages isolated as above was adhered to 24-well tissue culture dishes for 4 h in DMEM (J.R.H.) with 10% FCS (HyClone Laboratories, Logan, UT) supplemented with penicillin, streptomycin, and L-glutamine (Life Technologies, Rockville, MD). Nonadherent cells were removed by washing wells with PBS and then the medium was replaced with DMEM without serum. The specified particles were centrifuged onto the macrophages at 1800 rpm for 2 min and then cells were incubated at 37°C for 20 min. In some cases, the macrophages were pretreated with 200 nM PMA for 15 min. The free particles were removed by aspiration and then the extracellular particles were lysed by a water wash for SRBC and by incubation with 100 µg/ml lyticase (Sigma) for zymosan. The cells were scraped from the wells, fixed with 1% Formalin, and analyzed by flow cytometry. The data are represented as the relative phagocytic index. This value was determined by the percentage of cells that fell into a macrophage gate by forward scatter and side scatter analysis that had phagocytosed at least one particle multiplied by the relative number of particles eaten. The relative number of particles eaten was calculated by comparing the mean fluorescent intensities for the macrophages that had phagocytosed at least one particle, normalizing the number eaten by RP macrophages to 1.

Semiquantitative RT-PCR

Approximately 1 µg of total RNA (TRIzol; Life Technologies) from sorted macrophage populations was reverse transcribed using Superscript II reverse transcriptase and oligo(dT) primers (Life Technologies). Serial 1/3 dilutions of cDNA were amplified with primers to murine hypoxanthine phosphoribosyltransferase (HPRT) to standardize between cDNA samples (forward primer, GATACAGGCCAGACTTTGTTG; reverse primer, GGTAGGCTGGCCTATAGGCT). Matched 3-fold dilutions of total RNA from each sample were then amplified with primers to FcRs. Primers: Fc{gamma}RI, forward CCAGTCATCAGCTCCTGTCTG, reverse TTCAGGGTCAACTTTGGGAAG; Fc{gamma}RII, forward TGACAATTGTGGCTGCTGTC, reverse GCTTGCTTTTCCCAATGCC; Fc{gamma}RIII, forward GCTTTCTCCCTAGTGATGTGCC, reverse GGTGTCACTTGTCTTGAGGAGC; and Fc{epsilon}RI{gamma}, forward AGGATGATCTCAGCCGTGATC, reverse CAGAGTCTCATATGTCTCCTGGCT. Amplified products were separated on 1% agarose gels and visualized with ethidium bromide staining.

RNI detection

A total of 2 x 105 cells isolated as described above from the peritoneal cavity of uninfected mice or mice at day 2 or day 12 after BCG infection was plated per well of a 96-well dish. After 4 h of plate adherence, nonadherent cells were washed off with PBS and fresh medium was added alone or with 100 ng/ml Salmonella minnesota LPS (List Biological Laboratories, Campbell, CA) or LPS and 10 U/ml IFN-{gamma} (R&D Systems, Minneapolis, MN) in triplicate. Supernatants were collected after 60 h and nitrite in these supernatants was measured by mixing with equal volumes of Greiss reagent (Sigma) and reading the OD540. Amount of nitrite was determined using a standard curve generated with NaNO2. The data were represented as nanomoles of NO2 per 106 macrophages. The number of macrophages was determined by multiplying the cells plated per well by the percentage of cells that were macrophages by flow cytometry.

Real-time PCR

cDNA from sorted macrophage populations was made as described above and amplified with probe and primer sets for murine HPRT, IP-10, and TNF-{alpha} as indicated below using TaqMan Universal PCR master mix and an Applied Biosystems Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA) following the manufacturer’s instructions. Genomic DNA contamination was measured by including template that had been mock reverse transcribed and at all times accounted for <10% of the signal. Fold induction was determined from Ct values normalized for HPRT expression and then normalized to the value derived from RP macrophages. Primers were as follows: TNF-{alpha} primers: forward, TCCAGGCGGTGCCTATGT; reverse, CACCCCGAAGTTCAGTAGACAGA; probe, TCAGCCTCTTCTCATTCCTGCTTGTGG. IP-10 primers: forward, GACGGTCCGCTGCAACTG; reverse, GCTTCCCTATGGCCCTCATT; probe, TCACTGGCCCGTCATCGATATGGA. HPRT primers: forward, TGGAAAGAATGTCTTGATTGTTGAA; reverse, AGCTTGCAACCTTAACCATTTTG; probe, CAAACTTTGCTTTCCCTGGTTAAGCAGTACAGC.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Activated macrophages are distinguished by cell surface receptor expression

To understand the pathway of macrophage activation during infection with intracellular bacteria, we examined peritoneal macrophages at days 2 and 12 after i.p. infection with live BCG. These cells were compared with RP macrophages. We first wanted to know whether we could phenotypically distinguish day 2 BCG macrophages from both RP macrophages and macrophages at day 12 after infection. Macrophages isolated from the peritoneal cavity of infected or uninfected mice were stained for the cell surface receptors F4/80 and Mac1 and the class II MHC molecule IAb. As shown previously (29, 30), RP macrophages expressed high levels of both F4/80 and Mac1 (Fig. 1Go). At day 2 after infection, both of these receptors were expressed at levels lower than seen in RP macrophages, and at day 12, F4/80 and Mac1 were even further down-regulated (13). RP macrophages were predominantly negative/low for MHC class II molecules (Fig. 1Go), while day 12 BCG macrophages uniformly expressed high levels of IAb (13). At day 2 after infection, the macrophages have begun to up-regulate IAb, but are still expressing very low levels of this protein when compared with day 12 BCG macrophages. Since day 2 BCG macrophages were phenotypically distinct from RP macrophages and from day 12 BCG macrophages, we investigated the functional capabilities of these populations.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 1. Cell surface phenotype of day 2 BCG macrophages in comparison with RP macrophages and day 12 BCG macrophages. Macrophages were isolated from the peritoneal cavities of uninfected mice (RP) or mice infected i.p. 2 or 12 days previously with 1 x 107 CFU M. bovis BCG. For F4/80 and IAb profiles, macrophages were gated on as large cells that were Mac1 positive, B220 and Gr1 negative, whereas for the Mac1 profile, macrophages were gated on as large cells that were B220 and Gr1 negative. One-parameter histograms were generated showing fluorescence for the cell surface marker indicated on the x-axis vs relative cell number on the y-axis.

 
Day 2 BCG macrophages are highly phagocytic for IgG- and C3bi-opsonized particles

A key function of macrophages during the immune response is phagocytosis of pathogens. Macrophages engulf pathogens through a variety of phagocytic receptors including those for opsonized particles, such as Fc receptors (FcR) and complement receptors (CR), and those for nonopsonized particles, such as the phagocytic pattern recognition receptors (31). The phagocytic capacity of BCG-activated macrophages both for opsonized (IgG and C3bi) and nonopsonized (zymosan) particles was examined. Day 2 BCG macrophages were highly phagocytic for IgG-opsonized SRBC, while day 12 BCG macrophages were no more phagocytic than RP macrophages (Fig. 2GoA). The day 2 BCG macrophages were 7-fold more phagocytic than both RP and day 12 BCG macrophages.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 2. Phagocytosis by days 2 and 12 BCG macrophages. Plate-adhered macrophages from uninfected mice (RP) or mice at 2 (day 2) or 12 days (day 12) after BCG infection were incubated with FITC-OVA-filled IgG-opsonized SRBC (A), C3bi-opsonized SRBC (B), or FITC-labeled zymosan (C). Phagocytosis proceeded for 20 min and then extracellular particles were lysed by hypotonic lysis (A and B) or lyticase digestion (C). The cells were fixed and then analyzed by flow cytometry. The relative phagocytic index is derived from the percentage of cells that had phagocytosed at least one particle multiplied by the relative number of particles eaten on average for this population. Data shown are the mean of 4–11 independent experiments with two to three mice per condition + SEM.

 
We observed a similar pattern when looking at CR phagocytosis of C3bi-coated SRBC (Fig. 2GoB). It has been well established that resting macrophages do not phagocytose efficiently through their CRs without prior activation of protein kinase C (PKC) (32, 33). This is demonstrated in Fig. 2GoB; RP macrophages did not efficiently phagocytose C3bi-opsonized SRBC unless they were pretreated in vitro with the PKC activator PMA. Interestingly, day 2 BCG macrophages were constitutively able to phagocytose through CRs in the absence of in vitro PKC stimulation, although they did not phagocytose more C3bi-opsonized particles in the presence of PMA. This suggests that PKC is already maximally activated in macrophages at day 2 after BCG infection, as has been shown for IFN-{gamma}-activated macrophages (34). In contrast, day 12 BCG macrophages are poorly phagocytic for complement-coated SRBC in the absence or presence of PMA. Interestingly, all three populations of macrophages bound C3bi-opsonized SRBC to similar extents (data not shown). For both complement- and FcR-mediated phagocytosis, macrophages at day 2 after infection with BCG have an enhanced phagocytic capacity. Indeed, this increased FcR and CR phagocytosis persists until 4 days postinfection, which is then followed by decreased phagocytosis between days 8 and 14 after infection (data not shown).

We also looked at phagocytosis of zymosan, a yeast cell wall particle, through pattern recognition receptors including the mannose receptor (31). As shown in Fig. 2GoC, there are only small variations in the ability of macrophages to phagocytose zymosan during BCG infection; day 2 BCG macrophages phagocytose zymosan marginally more effectively than RP or day 12 BCG macrophages.

Receptor levels do not fully explain the modulation of phagocytic capacity in BCG-activated macrophages

We investigated whether changes in receptor levels could explain the enhancement of phagocytosis in day 2 BCG macrophages and the subsequent reduction seen at day 12. The phagocytic CR for C3bi-opsonized particles in macrophages is CR3 which is composed of the integrin CD11b/CD18 also known as Mac1 (35). Fig. 1Go shows changes in Mac1 levels seen during BCG activation of macrophages: Mac1 is highest in RP macrophages, intermediate in day 2 BCG macrophages, and lowest in day 12 BCG macrophages. Although low Mac1 levels in day 12 BCG macrophages may explain the poor phagocytosis of C3bi-opsonized particles by these macrophages, Mac1 levels do not explain the difference in phagocytosis between RP macrophages and day 2 BCG macrophages.

Murine macrophages express three different Fc receptors, two activating receptors, Fc{gamma}RI and Fc{gamma}RIII, and one inhibitory receptor, Fc{gamma}RII (36). Both Fc{gamma}RI and Fc{gamma}RIII have short cytoplasmic tails and associate with the Fc{epsilon}RI{gamma} chain to transduce signals. We looked at mRNA levels for these proteins by semiquantitative RT-PCR in sorted macrophage populations at days 2 and 12 after BCG infection to determine whether changes in FcR expression could influence the phagocytic capacity of the macrophages for IgG-opsonized particles. The mRNA for Fc{gamma}RI was higher in both day 2 and day 12 macrophages from BCG-infected mice than in RP macrophages, whereas there was no difference in mRNA levels between the macrophage populations for the other activating receptor, Fc{gamma}RIII, and the signaling chain, Fc{epsilon}RI{gamma} (Fig. 3GoA). It is possible that this up-regulation of Fc{gamma}RI accounts for the increase in phagocytosis in day 2 BCG macrophages, although this is unlikely since Fc{gamma}RI requires the Fc{epsilon}RI{gamma} chain, which does not increase in expression, for signaling and surface expression (36). This high level of Fc{gamma}RI is maintained in day 12 BCG macrophages that have a poor phagocytic capacity for IgG-coated particles (Fig. 3GoA). Additionally, although there is no change in the levels of the inhibitory receptor Fc{gamma}RII, between RP and day 2 BCG macrophages, this receptor is expressed at lower levels in day 12 macrophages (Fig. 3GoA). This would suggest that day 12 BCG macrophages should have the highest phagocytic capacity; they have increased activating receptors and decreased inhibitory receptors compared with RP macrophages. Despite this, the data in Fig. 2GoA demonstrate that this is not the case, day 12 macrophages have low levels of FcR phagocytosis.



View larger version (68K):
[in this window]
[in a new window]
  		FIGURE 3. The role of FcRs in the modulation of phagocytosis of IgG-coated particles at days 2 and 12 after BCG infection. A, Semiquantitative RT-PCR analysis of cDNA generated from RNA derived from sorted macrophage populations from uninfected mice (RPM{phi}) or mice infected with BCG. Three-fold serial dilutions of cDNA were standardized for HPRT levels (lower panel) and then amplified with primers to Fc{gamma}RI, Fc{gamma}RIII, Fc{epsilon}RI{gamma} chain, or Fc{gamma}RII. PCR products were separated on agarose gels and visualized by ethidium bromide staining. B, Macrophages from C57BL/6 (wt) or Fc{gamma}RII-/- mice were isolated from uninfected mice (RP) or mice at day 2 or day 12 after BCG infection and fed IgG-opsonized SRBC. Phagocytosis was assayed as in Fig. 2Go. The results are the average of values from three mice + SEM and are representative of two independent experiments.

 
We were surprised that day 2 macrophages did not have decreased levels of Fc{gamma}RII. Thioglycolate-elicited macrophages, which also enter the peritoneal cavity with a similar time course, have increased phagocytosis of IgG-opsonized particles (37) and have a reduced ratio of Fc{gamma}RII:Fc{gamma}RIII in comparison with RP macrophages (38). To confirm that down-regulation of Fc{gamma}RII does not play a role in the increased FcR phagocytosis by day 2 macrophages, we looked at phagocytosis after BCG infection of Fc{gamma}RII-/- mice (38). RP macrophages from Fc{gamma}RII-/- mice have an ~3-fold increased phagocytic index when given IgG-opsonized particles in comparison to those from wild-type mice (Fig. 3GoB). Consistent with the expression data, there was no difference in FcR-mediated phagocytosis between day 2 BCG macrophages from wild-type and Fc{gamma}RII-/- mice. We conclude that changes in Fc{gamma}RII levels do not cause the increase in phagocytosis at day 2 after BCG infection.

Day 12 BCG macrophages actively produce RNI, whereas day 2 BCG macrophages are primed for enhanced RNI production

After phagocytosis of the bacteria, the macrophage must kill the pathogen in the vacuole to resolve infection. We measured production of RNI, the principal mediator of mycobacterial killing, as an indicator of bacteriocidal activity (39). As shown in Fig. 4GoA, only macrophages isolated at day 12 after BCG infection were spontaneously generating RNI directly ex vivo. However, day 2 BCG macrophages were primed for enhanced RNI production, since these cells produced similar levels of RNI to those produced by day 12 macrophages in response to in vitro stimulation with LPS (Fig. 4GoB). RP macrophages treated with LPS secreted significantly less RNI into the medium than macrophages from BCG-infected mice. Therefore, day 2 BCG macrophages, although not actively producing RNI, are primed to do so by prior BCG infection, whereas day 12 BCG macrophages appear to be highly bacteriocidal in vivo.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 4. RNI production by BCG macrophages. Macrophages from uninfected mice (RP) or mice at day 2 or day 12 after infection with BCG were incubated in medium alone (A) or medium with 100 ng/ml LPS (B). Supernatants were collected after 60 h and nitrite was measured by the Greiss assay. The data are represented as nanomoles of NO2 per 106 macrophages as determined by flow cytometry and are the mean of triplicate wells from three mice per condition + SEM.

 
Day 2 and day 12 macrophages differ in TNF-{alpha} and IP-10 production

Macrophages help coordinate the immune response to bacterial pathogens by secreting cytokines and chemokines which activate other cells of the immune system and/or induce their homing to the site of infection (9, 40). We therefore wanted to look at the kinetics of production of two such proteins, the cytokine TNF-{alpha}, and the chemokine IP-10. We measured constitutive TNF-{alpha} and IP-10 mRNA levels in sorted macrophage populations by real-time quantitative PCR. There was no increase in TNF-{alpha} mRNA levels in day 2 BCG macrophages when compared with RP macrophages, whereas day 12 BCG macrophages showed a 5-fold increase in this cytokine message (Fig. 5GoA). In contrast, IP-10 mRNA was already >250-fold induced in day 2 BCG macrophages and was further increased in day 12 BCG macrophages (Fig. 5GoB). It is likely that this differential production of TNF-{alpha} and IP-10 by day 2 and day 12 BCG macrophages reflects the capacity of these populations to influence the ongoing immune response.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 5. TNF-{alpha} and IP-10 mRNA levels in BCG macrophages. Real-time quantitative PCR analysis of cDNA generated from RNA derived from sorted macrophage populations from uninfected mice (RP) or mice infected 2 or 12 days previously with BCG. cDNA was amplified with primers and probes specific for TNF-{alpha}, IP-10, or HPRT and fluorescence associated with product formation was measured. The cDNA levels were normalized for HPRT expression and then expressed as fold induction over the levels seen in RP macrophages.

 
Day 2 BCG macrophages can be derived directly from RP macrophages

To determine whether RP macrophages have the capacity to differentiate into day 2 BCG macrophages, we used mAbs to PECAM-1 (28) to block monocyte extravasation into the peritoneal cavity (41). Mice were treated with anti-PECAM-1 Abs or control IgG 1 h before infection with BCG and macrophages were isolated after 2 days. There was no difference in the capacity of day 2 BCG macrophages isolated from control IgG- or anti-PECAM-1-treated mice to phagocytose C3bi-opsonized SRBC (Fig. 6GoA) or IgG-opsonized SRBC (data not shown), or to produce RNI in response to LPS (Fig. 6GoB). Confirmation that the anti-PECAM Ab blocked monocyte influx into the peritoneal cavity was obtained by a number of approaches, including the demonstration that the average number of macrophages recovered from the peritoneal cavity of anti-PECAM-1-treated, BCG-infected mice (0.54 ± 0.09 x 106), was significantly lower (p < 0.006) than that recovered from control IgG-treated mice (1.21 ± 0.12 x 106). These data show that RP macrophages can serve as precursors for day 2 BCG macrophages.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 6. RP macrophages can act as precursor cells of day 2 BCG macrophages. Mice were given 100 µg of control IgG or anti-PECAM-1 Ab i.v. and then 1 h later infected with BCG i.p. Two days later, macrophages were isolated and tested for phagocytosis of C3bi-coated particles in the absence of PMA (A) and production of RNI (B) as described in the legends to Figs. 2Go and 4Go, respectively. The results are the average of values from three mice per condition + SEM.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have identified macrophages early in the pathway of macrophage activation during infection with M. bovis BCG that can be phenotypically and functionally distinguished from the resident tissue macrophage as well as from the typical immune-activated macrophage found at later times after infection. Compared with RP macrophages, these cells, found at day 2 postinfection with BCG, expressed decreased levels of the cell surface receptors Mac1 and F4/80 and slightly elevated levels of MHC class II molecules. Day 2 BCG macrophages were highly phagocytic and produced large amounts of mRNA for the chemokine IP-10. These cells did not produce RNI, although they were primed to do so, and did not have increased levels of TNF-{alpha} mRNA compared with RP macrophages. In contrast, day 12 BCG macrophages were poorly phagocytic, but produced RNI constitutively, IP-10 and TNF-{alpha} mRNA, and expressed high levels of cell surface MHC class II molecules. We propose that the macrophages at day 2 after BCG infection are specialized for phagocytic uptake of pathogens from the extracellular space, whereas day 12 BCG macrophages are specialized for bacterial killing of internalized pathogens.

This transition in functional capacities seen in BCG-activated macrophages is reminiscent of the maturation pathway of a related cell type, the DC. Immature DC in the tissues are specialized for Ag uptake via endocytosis, macropinocytosis, and phagocytosis (15, 16, 17, 18, 19), whereas mature DC in the lymph nodes are specialized for Ag presentation to naive T cells (14). We were struck by the similarities in phagocytic capacity between day 2 BCG macrophages and immature DC and that both cell types subsequently down-regulate this phagocytic capacity. Despite these similarities, we do not have evidence that day 2 BCG macrophages directly differentiate into day 12 macrophages in vivo, whereas it is clear that immature DCs differentiate into mature DCs as this can be observed in isolated cells in vitro.

Mature DC have high levels of MHC class II and costimulatory molecules on their surface to stimulate naive T cells (20, 21, 22, 23, 24). Although both day 12 BCG macrophages and mature DC have increased levels of MHC class II and costimulatory molecules on their surface, the function and identity of these proteins appear to differ. Mature DC use high levels of class II and CD86 to stimulate naive T cells in the lymph nodes (14), whereas day 12 BCG macrophages use MHC class II and CD80 to stimulate previously activated T cells at the site of infection (J. A. Hamerman and A. Aderem, unpublished observations). This stimulation of activated CD4 T cells in the peritoneal cavity induces the local production of IFN-{gamma}, a cytokine required for macrophage RNI production and therefore for resolution of BCG infection (39).

It has recently been shown that monocytes can differentiate into DC in vitro and in vivo after phagocytosis of latex beads and zymosan (42, 43). This finding, along with the similarities in phagocytosis between BCG macrophages and DC, induced us to examine whether some BCG-activated macrophages differentiate into mature DC. We did not detect expression of the DC markers CD11c, DEC-205, and CD86 on day 2 or day 12 BCG-activated macrophages (J. A. Hamerman and A. Aderem, unpublished observations). We have not exhaustively examined all DC markers, nor can we rule out the expression of those we have examined on a very small population of cells. It is also possible that some BCG-activated macrophages leave the peritoneal cavity and then differentiate into DC. Randolph et al. (43) demonstrated that after phagocytosing particles, human monocytes reverse transmigrated out of the tissues and then differentiated into DC. Similarly, inflammatory macrophages can leave the peritoneal cavity and migrate to the draining lymph nodes (44).

It is generally viewed that activated macrophages are highly phagocytic (37, 45), although there are some conflicting reports (46). Our results suggest that the difference in these reports may reflect temporal differences in the experiments; in our hands, phagocytic capacity was increased markedly from days 2 to 4 postinfection and was decreased substantially after day 8 (J. A. Hamerman and A. Aderem, unpublished observations). We investigated the mechanism for the modulation of phagocytic capacity by BCG-activated macrophages. For CR-mediated phagocytosis, decreased levels of receptor (Mac1) correlated with decreased phagocytic capacity in day 12 BCG macrophages, although these macrophages can bind similar numbers of C3bi-opsonized particles to both RP and day 2 BCG macrophages. However, the major increase in CR-mediated phagocytosis in day 2 BCG macrophages cannot be explained by receptor levels, day 2 macrophages actually express less Mac1 than RP macrophages. It is likely that increased PKC activation in day 2 BCG macrophages explains this increase in phagocytosis. First, PKC is constitutively activated in day 2 BCG macrophages as judged by the phosphorylation of the PKC substrate MARCKS (A. Aderem, unpublished observations). Second, phorbol ester-induced PKC activation of RP macrophages results in a similar phagocytic index to that seen for untreated day 2 macrophages. In addition to stimulating CR phagocytosis (32, 33), PKC activation has also been shown to enhance FcR phagocytosis in vitro (47), and may also account in part for our data showing increased FcR phagocytosis by day 2 BCG macrophages. As discussed above, it is not likely that differences in FcR expression account for the large increase in FcR-mediated phagocytic capacity in day 2 BCG macrophages. We confirmed that the absence of the inhibitory Fc{gamma}RII resulted in enhanced phagocytosis of IgG-opsonized particles by RP macrophages (48), but we show here that this receptor was not responsible for the increased FcR phagocytosis seen in day 2 BCG macrophages. It has recently been shown that the Rho family GTPase, cdc42, is important in regulating the differential endocytic capacity of immature and mature DC (49). Therefore, it was attractive to postulate that this mechanism may underlie the differential phagocytic responses observed between BCG-activated macrophages and resident peritoneal macrophages. We attempted to determine whether cdc42 activation differed in BCG-activated macrophages and resident peritoneal macrophages; unfortunately, we could not detect sufficient cdc42 protein in these cells to draw conclusions from this study (our unpublished observations).

Macrophages coordinate the immune response during bacterial infections through cytokine and chemokine production. Although day 12 BCG macrophages have increased mRNA levels for both TNF-{alpha} and IP-10, we observed differential regulation of these secreted mediators in the day 2 BCG macrophages. TNF-{alpha} mRNA was not increased in day 2 BCG macrophages, although it is well established that macrophage interaction with bacteria induces TNF-{alpha} secretion within hours of contact. The result is consistent with that of Stein and Gordon (12) who demonstrated that macrophages from the peritoneal cavity of BCG-infected mice do not release any TNF-{alpha} until day 8 after infection. TNF-{alpha} has pleiotropic effects on the immune response including neutrophil activation, induction of endothelial cell E-selectin expression, costimulation of NK cells for IFN-{gamma} production, and induction of chemokine expression (50). The relevance of the delay in TNF-{alpha} production until later times after infection is unclear, but it remains possible that there is a wave of TNF-{alpha} production by macrophages immediately after infection that has subsided by day 2.

In contrast to TNF-{alpha} production, mRNA for the chemokine IP-10 is already massively induced in day 2 BCG macrophages, and this level is maintained in day 12 macrophages. IP-10 is chemotactic for monocytes, NK cells, and activated Th1 T cells and may be important for the homing of distinct cell types at different times after infection (40, 51, 52). At day 2, IP-10 may induce monocyte and NK cell homing to the peritoneal cavity, while at day 12 it may act predominantly on activated Th1 T cells. IP-10 has been shown to be critical for control of infection with another intracellular pathogen, Toxoplasma gondii, where it is also expressed at both early and late times after infection (53). Differences in TNF-{alpha} and IP-10 expression at days 2 and 12 after BCG infection not only further defines these macrophage populations, but also illustrates that the way macrophages influence the immune response can change over the course of infection.

To address the identity of the precursor cell of day 2 BCG macrophages, we infected mice with BCG while blocking monocyte extravasation with Abs to PECAM-1 (28, 41). Anti-PECAM-1 Abs did not affect the capacity of day 2 BCG macrophages to increase phagocytosis or to be primed for enhanced RNI production. These data demonstrate that RP macrophages can differentiate into BCG-activated macrophages, though we do not rule out that monocytes can also differentiate into these cells. We also atempted to determine a lineage relationship between day 2 and day 12 BCG macrophages using sustained blocking of PECAM-1 with Abs, but this treatment did not appear to block monocyte extravasation during this extended time period (our unpublished observations).

In this report, we have revisited a classical system used to study in vivo immune activation of macrophages; we have examined the temporal response to BCG infection, identified an early intermediate in the process, and defined a functional transition in these macrophage populations. The results demonstrate an exquisite level of regulation of macrophage function and suggest future directions for further dissection of the pathway.


   Acknowledgments
 
We thank Dr. Sherilyn Smith for providing BCG, Dr. William Muller for anti-PECAM-1 Ab, Dr. David Underhill for primers and probes for real-time PCR, and Kathy Allen for cell sorting. We also thank Drs. Thomas Hawn, Kelly Smith, David Sester, and Ananda Goldrath for critical reading of this manuscript.


   Footnotes
 
1 This work was supported in part by National Institutes of Health Grants AI25032 and AI32972 (to A.A.). J.A.H. was a Predoctoral Fellow of the Howard Hughes Medical Institute. Back

2 Address correspondence and reprint requests to Dr. Alan Aderem, Institute for Systems Biology, 4225 Roosevelt Way N.E., Suite 200, Seattle, WA 98105. E-mail address: aderem{at}systemsbiology.org Back

3 Abbreviations used in this paper: BCG, bacillus Calmette-Guérin; RP, resident peritoneal; PECAM-1. platelet endothelial cell adhesion molecule-1; RNI, reactive nitrogen intermediates; DC, dendritic cell; CR, complement receptor; PKC, protein kinase C; HPRT, hypoxanthine phosphoribosyltransferase. Back

Received for publication December 20, 2000. Accepted for publication June 8, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Aderem, A., R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782.[Medline]
  2. Underhill, D. M., A. Ozinsky, K. D. Smith, A. Aderem. 1999. Toll-like receptor-2 mediates mycobacteria-induced proinflammatory signaling in macrophages. Proc. Natl. Acad. Sci. USA 96:14459.[Abstract/Free Full Text]
  3. Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, M. J. Fenton. 1999. Human Toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J. Immunol. 163:3920.[Abstract/Free Full Text]
  4. Brightbill, H. D., D. H. Libraty, S. R. Krutzik, R. B. Yang, J. T. Belisle, J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al 1999. Host defense mechanisms triggered by microbial lipoproteins through Toll-like receptors. Science 285:732.[Abstract/Free Full Text]
  5. Unanue, E. R.. 1997. Inter-relationship among macrophages, natural killer cells and neutrophils in early stages of Listeria resistance. Curr. Opin. Immunol. 9:35.[Medline]
  6. Tracey, D. E., S. A. Wolfe, J. M. Durdik, C. S. Henney. 1977. BCG-induced murine effector cells. I. Cytolytic activity in peritoneal exudates: an early response to BCG. J. Immunol. 119:1145.[Abstract/Free Full Text]
  7. Wolfe, S. A., D. E. Tracey, C. S. Henney. 1977. BCG-induced murine effector cells. II. Characterization of natural killer cells in peritoneal exudates. J. Immunol. 119:1152.[Abstract/Free Full Text]
  8. Inoue, T., Y. Yoshikai, G. Matsuzaki, K. Nomoto. 1991. Early appearing {gamma}/{delta}-bearing T cells during infection with Calmette Guérin bacillus. J. Immunol. 146:2754.[Abstract]
  9. Trinchieri, G.. 1997. Cytokines acting on or secreted by macrophages during intracellular infection (IL-10, IL-12, IFN-{gamma}). Curr. Opin. Immunol. 9:17.[Medline]
  10. Dalton, D. K., M.-S. Pitts, S. Keshav, I. S. Figari, A. Bradley, T. A. Stewart. 1993. Multiple defects of immune cell function in mice with disrupted interferon-{gamma} genes. Science 259:1739.[Abstract/Free Full Text]
  11. Stuehr, D. J., M. A. Marletta. 1987. Induction of nitrite/nitrate synthesis in murine macrophages by BCG infection, lymphokines, or interferon-{gamma}. J. Immunol. 139:518.[Abstract]
  12. Stein, M., S. Gordon. 1991. Regulation of tumor necrosis factor (TNF) release by murine peritoneal macrophages: role of cell stimulation and specific phagocytic plasma membrane receptors. Eur. J. Immunol. 21:431.[Medline]
  13. Ezekowitz, R. A., J. Austyn, P. D. Stahl, S. Gordon. 1981. Surface properties of bacillus Calmette-Guérin-activated mouse macrophages: reduced expression of mannose-specific endocytosis, Fc receptors, and antigen F4/80 accompanies induction of Ia. J. Exp. Med. 154:60.[Abstract/Free Full Text]
  14. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  15. Sallusto, F., A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha}. J. Exp. Med. 179:1109.[Abstract/Free Full Text]
  16. Sallusto, F., M. Cella, C. Danieli, A. Lanzavecchia. 1995. Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. J. Exp. Med. 182:389.[Abstract/Free Full Text]
  17. Inaba, K., M. Inaba, M. Naito, R. M. Steinman. 1993. Dendritic cell progenitors phagocytose particulates, including bacillus Calmette-Guérin organisms, and sensitize mice to mycobacterial antigens in vivo. J. Exp. Med. 178:479.[Abstract/Free Full Text]
  18. Reis e Sousa, C., P. D. Stahl, J. M. Austyn. 1993. Phagocytosis of antigens by Langerhans cells in vitro. J. Exp. Med. 178:509.[Abstract/Free Full Text]
  19. Jiang, W., W. J. Swiggard, C. Heufler, M. Peng, A. Mirza, R. M. Steinman, M. C. Nussenzweig. 1995. The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing. Nature 375:151.[Medline]
  20. Pierre, P., S. J. Turley, E. Gatti, M. Hull, J. Meltzer, A. Mirza, K. Inaba, R. M. Steinman, I. Mellman. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells. Nature 388:787.[Medline]
  21. Cella, M., A. Engering, V. Pinet, J. Pieters, A. Lanzavecchia. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782.[Medline]
  22. Nijman, H. W., M. J. Kleijmeer, M. A. Ossevoort, V. M. Oorschot, M. P. Vierboom, M. van de Keur, P. Kenemans, W. M. Kast, H. J. Geuze, C. J. Melief. 1995. Antigen capture and major histocompatibility class II compartments of freshly isolated and cultured human blood dendritic cells. J. Exp. Med. 182:163.[Abstract/Free Full Text]
  23. Caux, C., B. Vanbervliet, C. Massacrier, M. Azuma, K. Okumura, L. L. Lanier, J. Banchereau. 1994. B70/B7-2 is identical to CD86 and is the major functional ligand for CD28 expressed on human dendritic cells. J. Exp. Med. 180:1841.[Abstract/Free Full Text]
  24. Inaba, K., M. Witmer-Pack, M. Inaba, K. S. Hathcock, H. Sakuta, M. Azuma, H. Yagita, K. Okumura, P. S. Linsley, S. Ikehara, et al 1994. The tissue distribution of the B7-2 costimulator in mice: abundant expression on dendritic cells in situ and during maturation in vitro. J. Exp. Med. 180:1849.[Abstract/Free Full Text]
  25. Henderson, R. A., S. C. Watkins, J. L. Flynn. 1997. Activation of human dendritic cells following infection with Mycobacterium tuberculosis. J. Immunol. 159:635.[Abstract]
  26. Thurnher, M., R. Ramoner, G. Gastl, C. Radmayr, G. Bock, M. Herold, H. Klocker, G. Bartsch. 1997. Bacillus Calmette-Guérin mycobacteria stimulate human blood dendritic cells. Int. J. Cancer 70:128.[Medline]
  27. Reis e Sousa, C., A. Sher, P. Kaye. 1999. The role of dendritic cells in the induction and regulation of immunity to microbial infection. Curr. Opin. Immunol. 11:392.[Medline]
  28. Bogen, S. A., H. S. Baldwin, S. C. Watkins, S. M. Albelda, A. K. Abbas. 1992. Association of murine CD31 with transmigrating lymphocytes following antigenic stimulation. Am. J. Pathol. 141:843.[Abstract]
  29. Austyn, J. M., S. Gordon. 1981. F4/80, a monoclonal antibody directed specifically against the mouse macrophage. Eur. J. Immunol. 11:805.[Medline]
  30. Springer, T., G. Galfre, D. S. Secher, C. Milstein. 1979. Mac-1: a macrophage differentiation antigen identified by monoclonal antibody. Eur. J. Immunol. 9:301.[Medline]
  31. Aderem, A., D. M. Underhill. 1999. Mechanisms of phagocytosis in macrophages. Annu. Rev. Immunol. 17:593.[Medline]
  32. Wright, S. D., S. C. Silverstein. 1982. Tumor-promoting phorbol esters stimulate C3b and C3bi receptor-mediated phagocytosis in cultured human monocytes. J. Exp. Med. 156:1149.[Abstract/Free Full Text]
  33. Pommier, C. G., S. Inada, L. F. Fries, T. Takahashi, M. M. Frank, E. J. Brown. 1983. Plasma fibronectin enhances phagocytosis of opsonized particles by human peripheral blood monocytes. J. Exp. Med. 157:1844.[Abstract/Free Full Text]
  34. Hamilton, T. A., D. L. Becton, S. D. Somers, P. W. Gray, D. O. Adams. 1985. Interferon-{gamma} modulates protein kinase C activity in murine peritoneal macrophages. J. Biol. Chem. 260:1378.[Abstract/Free Full Text]
  35. Brown, E. J.. 1991. Complement receptors and phagocytosis. Curr. Opin. Immunol. 3:76.[Medline]
  36. Ravetch, J. V., R. A. Clynes. 1998. Divergent roles for Fc receptors and complement in vivo. Annu. Rev. Immunol. 16:421.[Medline]
  37. Bianco, C., Jr F. M. Griffin, S. C. Silverstein. 1975. Studies of the macrophage complement receptor: alteration of receptor function upon macrophage activation. J. Exp. Med. 141:1278.[Abstract/Free Full Text]
  38. Takai, T., M. Ono, M. Hikida, H. Ohmori, J. V. Ravetch. 1996. Augmented humoral and anaphylactic responses in Fc{gamma}RII-deficient mice. Nature 379:346.[Medline]
  39. Nathan, C., M. U. Shiloh. 2000. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc. Natl. Acad. Sci. USA 97:8841.[Abstract/Free Full Text]
  40. Proost, P., A. Wuyts, J. van Damme. 1996. The role of chemokines in inflammation. Int. J. Clin. Lab. Res. 26:211.[Medline]
  41. Bogen, S., J. Pak, M. Garifallou, X. Deng, W. A. Muller. 1994. Monoclonal antibody to murine PECAM-1 (CD31) blocks acute inflammation in vivo. J. Exp. Med. 179:1059.[Abstract/Free Full Text]
  42. Randolph, G. J., S. Beaulieu, S. Lebecque, R. M. Steinman, W. A. Muller. 1998. Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking. Science 282:480.[Abstract/Free Full Text]
  43. Randolph, G. J., K. Inaba, D. F. Robbiani, R. M. Steinman, W. A. Muller. 1999. Differentiation of phagocytic monocytes into lymph node dendritic cells in vivo. Immunity 11:753.[Medline]
  44. Bellingan, G. J., H. Caldwell, S. E. Howie, I. Dransfield, C. Haslett. 1996. In vivo fate of the inflammatory macrophage during the resolution of inflammation: inflammatory macrophages do not die locally, but emigrate to the draining lymph nodes. J. Immunol. 157:2577.[Abstract]
  45. Ratzan, K. R., D. M. Musher, G. T. Keusch, L. Weinstein. 1972. Correlation of increased metabolic activity, resistance to infection, enhanced phagocytosis, and inhibition of bacterial growth by macrophages from Listeria- and BCG-infected mice. Infect. Immun. 5:499.[Abstract/Free Full Text]
  46. Nathan, C. F., W. D. Terry. 1977. Decreased phagocytosis by peritoneal macrophages from BCG-treated mice: induction of the phagocytic defect in normal macrophages with BCG in vitro. Cell. Immunol. 29:295.[Medline]
  47. Karimi, K., M. R. Lennartz. 1995. Protein kinase C activation precedes arachidonic acid release during IgG-mediated phagocytosis. J. Immunol. 155:5786.[Abstract]
  48. Clynes, R., J. S. Maizes, R. Guinamard, M. Ono, T. Takai, J. V. Ravetch. 1999. Modulation of immune complex-induced inflammation in vivo by the coordinate expression of activation and inhibitory Fc receptors. J. Exp. Med. 189:179.[Abstract/Free Full Text]
  49. Garrett, W. S., L. M. Chen, R. Kroschewski, M. Ebersold, S. Turley, S. Trombetta, J. E. Galan, I. Mellman. 2000. Developmental control of endocytosis in dendritic cells by Cdc42. Cell 102:325.[Medline]
  50. Barbara, J. A., X. Van ostade, A. Lopez. 1996. Tumour necrosis factor-{alpha} (TNF-{alpha}): the good, the bad and potentially very effective. Immunol. Cell Biol. 74:434.[Medline]
  51. Farber, J. M.. 1997. Mig and IP-10: CXC chemokines that target lymphocytes. J. Leukocyte Biol. 61:246.[Abstract]
  52. Narumi, S., T. A. Hamilton. 1991. Inducible expression of murine IP-10 mRNA varies with the state of macrophage inflammatory activity. J. Immunol. 146:3038.[Abstract]
  53. Khan, I. A., J. A. MacLean, F. S. Lee, L. Casciotti, E. DeHaan, J. D. Schwartzman, A. D. Luster. 2000. IP-10 is critical for effector T cell trafficking and host survival in Toxoplasma gondii infection. Immunity 12:483.[Medline]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
D. G. Mordue and L. D. Sibley
A novel population of Gr-1+-activated macrophages induced during acute toxoplasmosis
J. Leukoc. Biol., December 1, 2003; 74(6): 1015 - 1025.
[Abstract] [Full Text]

Home page
 CVIHome page
J. J. Gaforio, E. Ortega, I. Algarra, M. J. Serrano, and G. Alvarez de Cienfuegos
NK Cells Mediate Increase of Phagocytic Activity but Not of Proinflammatory Cytokine (Interleukin-6 [IL-6], Tumor Necrosis Factor Alpha, and IL-12) Production Elicited in Splenic Macrophages by Tilorone Treatment of Mice during Acute Systemic Candidiasis
Clin. Vaccine Immunol., November 1, 2002; 9(6): 1282 - 1294.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
S. Wyllie, P. Seu, F. Q. Gao, P. Gros, and J. A. Goss
Disruption of the Nramp1 (also known as Slc11a1) gene in Kupffer cells attenuates early-phase, warm ischemia-reperfusion injury in the mouse liver
J. Leukoc. Biol., November 1, 2002; 72(5): 885 - 897.
[Abstract] [Full Text] [PDF]

Home page
 MicrobiologyHome page
L. E. DesJardin, T. M. Kaufman, B. Potts, B. Kutzbach, H. Yi, and L. S. Schlesinger
Mycobacterium tuberculosis-infected human macrophages exhibit enhanced cellular adhesion with increased expression of LFA-1 and ICAM-1 and reduced expression and/or function of complement receptors, Fc{gamma}RII and the mannose receptor
Microbiology, October 1, 2002; 148(10): 3161 - 3171.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. A. Hamerman, F. Hayashi, L. A. Schroeder, S. P. Gygi, A. L. Haas, L. Hampson, P. Coughlin, R. Aebersold, and A. Aderem
Serpin 2a Is Induced in Activated Macrophages and Conjugates to a Ubiquitin Homolog
J. Immunol., March 1, 2002; 168(5): 2415 - 2423.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. J. Nau, J. F. L. Richmond, A. Schlesinger, E. G. Jennings, E. S. Lander, and R. A. Young
Human macrophage activation programs induced by bacterial pathogens
PNAS, January 17, 2002; (2002) 22649799.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. J. Nau, J. F. L. Richmond, A. Schlesinger, E. G. Jennings, E. S. Lander, and R. A. Young
Human macrophage activation programs induced by bacterial pathogens
PNAS, February 5, 2002; 99(3): 1503 - 1508.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Aderem, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Aderem, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS