|
|
||||||||

*
Department of Immunology, University of Washington, Seattle, WA 98195; and
Institute for Systems Biology, Seattle, WA 98105
| Abstract |
|---|
|
|
|---|
mRNA. Blockade of monocyte
influx into the peritoneal cavity using Abs to platelet endothelial
cell adhesion molecule 1 had no effect on the appearance of day 2 BCG
macrophages, suggesting this cell can differentiate from resident
peritoneal macrophages. In contrast to day 2 BCG macrophages, day 12
BCG macrophages were poorly phagocytic, but produced high levels of
reactive nitrogen intermediates, IP-10 and TNF-
mRNA, and class II
MHC molecules. We propose that day 2 BCG macrophages are specialized
for phagocytic uptake of pathogens from the extracellular space,
whereas day 12 BCG macrophages are specialized for killing of the
internalized pathogens. This functional transition during activation is
reminiscent of that seen during maturation/activation of the related
dendritic cell lineage induced by bacterial or inflammatory
stimuli. | Introduction |
|---|
|
|
|---|
Intraperitoneal infection of mice with the intracellular bacterium
Mycobacterium bovis bacillus Calmette-Guérin
(BCG)3 has been a
classical system for the study of macrophage activation. The first
interaction of the immune system with BCG is by the resident tissue
macrophages, in this case the resident peritoneal (RP) macrophage.
During phagocytosis of the bacteria, pattern recognition receptors such
as the Toll-like receptors induce a variety of inflammatory responses
in the macrophage (1, 2, 3, 4). After the initial interactions
of the RP macrophages with BCG, a complex series of events ensue that
result in macrophage activation. These events include the extravasation
of monocytes, NK cells, and T cells into the inflamed tissue, as well
as the interaction of these cells with macrophages and/or macrophage
products (5, 6, 7, 8). At the site of infection, NK cells and T
cells produce cytokines such as IFN-
that are critical for
macrophage activation (9, 10). BCG-activated macrophages
produce high levels of bacteriocidal molecules (11) and
cytokines (12), up-regulate expression of MHC class II
molecules, and down-regulate the cell surface receptor F4/80
(13).
Previous studies of the pathway by which resting macrophages or
monocytes differentiate into the classical BCG-activated macrophage
have focused on single time points after infection or on one functional
aspect of these cells. Recent studies on the differentiation of
dendritic cells (DC), a related cell type, in response to infectious or
inflammatory stimuli have suggested that the paradigm of macrophage
activation should be revisited. Immature or resting DC are efficient at
Ag uptake, while mature or activated DC down-regulate this ability and
up-regulate the capacity to stimulate naive T cells (14).
Immature DC acquire Ag through endocytosis, macropinocytosis, and
phagocytosis (15, 16, 17, 18, 19), while mature DC stimulate naive T
cells through cell surface expression of class II MHC molecules and
costimulatory molecules (20, 21, 22, 23, 24). This process allows the
DC to regulate its functional capabilities during an immune response.
DC maturation is induced by a variety of bacteria and bacterial stimuli
including bacterial endotoxin (LPS) and mycobacteria (21, 25, 26, 27), as well as host inflammatory mediators such as IL-1 and
TNF-
(16).
We hypothesized that macrophages also undergo a functional transition
during activation induced by bacterial stimuli in vivo and therefore
compared the functional capacities of RP macrophages with those
activated 2 days or 12 days after BCG infection. These three
populations of macrophages are phenotypically and functionally
distinct. Day 2 BCG macrophages are highly phagocytic while day 12 BCG
macrophages are poorly phagocytic, but produce far higher levels of
reactive nitrogen intermediates (RNI) and MHC class II molecules than
their day 2 counterparts. We propose that macrophages 2 days post-BCG
infection are specialized for bacterial clearance from the
extracellular space and that those at 12 days postinfection are
specialized for bacterial killing. Additionally, these two populations
of macrophages produce different levels of the cytokine, TNF-
, and
the chemokine, IP-10, suggesting that the influence of macrophages on
the ongoing immune response differs at distinct times after
infection.
| Materials and Methods |
|---|
|
|
|---|
M. bovis BCG (strain Pasteur; American Type Culture
Collection, Manassas, VA) was a gift from Dr. S. Smith (University of
Washington, Seattle, WA). BCG was grown in Proskauer-Beck medium with
aeration to 5 x 107 CFU/ml and stored in
aliquots at -70oC. To infect mice, an aliquot
of BCG was thawed, sonicated three times for 30 s in a water bath
sonicator, and diluted in PBS. C57BL/6 or
Fc
RII-/- mice (The Jackson Laboratory, Bar
Harbor, ME) were injected i.p. with 5 x 106
CFU of BCG in 0.5 ml. In some experiments, mice were injected i.v. with
100 µg of anti-platelet endothelial cell adhesion molecule-1
(PECAM-1) Ab 2H8 (28), a gift from Dr. W. Muller (Cornell
University), or control hamster IgG (Jackson ImmunoResearch
Laboratories, West Grove, PA) 1 h before BCG infection.
Flow cytometry and cell sorting
Cells were isolated from the peritoneal cavity of uninfected mice or mice at the indicated day after BCG infection by peritoneal lavage with 6 ml of ice-cold PBS. After blocking with 2.4G2 (American Type Culture Collection) supernatant, 5 x 105 cells were stained with Mac1 FITC, B220 PE, Gr1 PE, and biotinylated F4/80 (Caltag Laboratories, South San Francisco, CA) or IAb or with Gr1 FITC, B220 PE, and biotinylated Mac1. This was followed by staining with streptavidin TC (Caltag Laboratories) and fixation in 1% paraformaldehyde. All Abs were purchased from BD PharMingen (San Diego, CA) unless otherwise indicated. Cells were analyzed on a FACScan with CellQuest software (BD Biosciences, Mountain View, CA). Macrophages were sorted as Mac1-positive, B220, and Gr1-negative cells that were large by forward scatter and side scatter analysis on a FACSVantage (BD Biosciences).
Phagocytosis
FITC-loaded SRBC ghosts were prepared by incubating SRBC (ICN Pharmaceuticals, Cosa Mesa, CA) with FITC-labeled OVA (Molecular Probes, Eugene, OR) in hypotonic lysis buffer (1 mM MgCl2 and 100 mM EGTA in 0.02x PBS) for 1 h on ice. Isotonicity was restored with 5x PBS and the ghosts were sealed at 37oC for 1 h. Excess FITC-OVA was removed by washing three times in PBS. IgG-opsonized SRBC were prepared by incubating FITC-loaded SRBC ghosts with anti-SRBC IgG (Intercell) at a 1/200 dilution for 30 min at room temperature. C3bi-opsonized SRBC were prepared by incubating FITC-loaded SRBC ghosts with anti-SRBC IgM (Intercell Technologies, Hopewell, NJ) for 30 min at room temperature in PBS, followed by one wash and incubation in 10% C5-deficient human serum (Sigma, St. Louis, MO) in DMEM (J.R.H.) for 1 h at 37°C. FITC-zymosan was purchased from Molecular Probes.
A total of 5 x 105 macrophages isolated as above was adhered to 24-well tissue culture dishes for 4 h in DMEM (J.R.H.) with 10% FCS (HyClone Laboratories, Logan, UT) supplemented with penicillin, streptomycin, and L-glutamine (Life Technologies, Rockville, MD). Nonadherent cells were removed by washing wells with PBS and then the medium was replaced with DMEM without serum. The specified particles were centrifuged onto the macrophages at 1800 rpm for 2 min and then cells were incubated at 37°C for 20 min. In some cases, the macrophages were pretreated with 200 nM PMA for 15 min. The free particles were removed by aspiration and then the extracellular particles were lysed by a water wash for SRBC and by incubation with 100 µg/ml lyticase (Sigma) for zymosan. The cells were scraped from the wells, fixed with 1% Formalin, and analyzed by flow cytometry. The data are represented as the relative phagocytic index. This value was determined by the percentage of cells that fell into a macrophage gate by forward scatter and side scatter analysis that had phagocytosed at least one particle multiplied by the relative number of particles eaten. The relative number of particles eaten was calculated by comparing the mean fluorescent intensities for the macrophages that had phagocytosed at least one particle, normalizing the number eaten by RP macrophages to 1.
Semiquantitative RT-PCR
Approximately 1 µg of total RNA (TRIzol; Life Technologies)
from sorted macrophage populations was reverse transcribed using
Superscript II reverse transcriptase and oligo(dT) primers (Life
Technologies). Serial 1/3 dilutions of cDNA were amplified with primers
to murine hypoxanthine phosphoribosyltransferase (HPRT) to
standardize between cDNA samples (forward primer,
GATACAGGCCAGACTTTGTTG; reverse primer, GGTAGGCTGGCCTATAGGCT).
Matched 3-fold dilutions of total RNA from each sample were then
amplified with primers to FcRs. Primers: Fc
RI, forward
CCAGTCATCAGCTCCTGTCTG, reverse TTCAGGGTCAACTTTGGGAAG; Fc
RII,
forward TGACAATTGTGGCTGCTGTC, reverse GCTTGCTTTTCCCAATGCC; Fc
RIII,
forward GCTTTCTCCCTAGTGATGTGCC, reverse GGTGTCACTTGTCTTGAGGAGC; and
Fc
RI
, forward AGGATGATCTCAGCCGTGATC, reverse
CAGAGTCTCATATGTCTCCTGGCT. Amplified products were separated on 1%
agarose gels and visualized with ethidium bromide staining.
RNI detection
A total of 2 x 105 cells isolated as
described above from the peritoneal cavity of uninfected mice or mice
at day 2 or day 12 after BCG infection was plated per well of a 96-well
dish. After 4 h of plate adherence, nonadherent cells were washed
off with PBS and fresh medium was added alone or with 100 ng/ml
Salmonella minnesota LPS (List Biological Laboratories,
Campbell, CA) or LPS and 10 U/ml IFN-
(R&D Systems, Minneapolis, MN)
in triplicate. Supernatants were collected after 60 h and nitrite
in these supernatants was measured by mixing with equal volumes of
Greiss reagent (Sigma) and reading the OD540.
Amount of nitrite was determined using a standard curve generated with
NaNO2. The data were represented as nanomoles of
NO2 per 106 macrophages.
The number of macrophages was determined by multiplying the cells
plated per well by the percentage of cells that were macrophages by
flow cytometry.
Real-time PCR
cDNA from sorted macrophage populations was made as described
above and amplified with probe and primer sets for murine HPRT, IP-10,
and TNF-
as indicated below using TaqMan Universal PCR master mix
and an Applied Biosystems Prism 7700 Sequence Detector (Applied
Biosystems, Foster City, CA) following the manufacturers
instructions. Genomic DNA contamination was measured by including
template that had been mock reverse transcribed and at all times
accounted for <10% of the signal. Fold induction was determined from
Ct values normalized for HPRT expression and then normalized to
the value derived from RP macrophages. Primers were as follows: TNF-
primers: forward,
TCCAGGCGGTGCCTATGT; reverse, CACCCCGAAGTTCAGTAGACAGA; probe, TCAGCCTCTTCTCATTCCTGCTTGTGG.
IP-10 primers: forward, GACGGTCCGCTGCAACTG; reverse,
GCTTCCCTATGGCCCTCATT; probe, TCACTGGCCCGTCATCGATATGGA. HPRT
primers: forward, TGGAAAGAATGTCTTGATTGTTGAA; reverse,
AGCTTGCAACCTTAACCATTTTG; probe, CAAACTTTGCTTTCCCTGGTTAAGCAGTACAGC.
| Results |
|---|
|
|
|---|
To understand the pathway of macrophage activation during
infection with intracellular bacteria, we examined peritoneal
macrophages at days 2 and 12 after i.p. infection with live BCG. These
cells were compared with RP macrophages. We first wanted to know
whether we could phenotypically distinguish day 2 BCG macrophages from
both RP macrophages and macrophages at day 12 after infection.
Macrophages isolated from the peritoneal cavity of infected or
uninfected mice were stained for the cell surface receptors F4/80 and
Mac1 and the class II MHC molecule IAb. As shown
previously (29, 30), RP macrophages expressed high levels
of both F4/80 and Mac1 (Fig. 1
). At day 2
after infection, both of these receptors were expressed at levels lower
than seen in RP macrophages, and at day 12, F4/80 and Mac1 were even
further down-regulated (13). RP macrophages were
predominantly negative/low for MHC class II molecules (Fig. 1
), while
day 12 BCG macrophages uniformly expressed high levels of
IAb (13). At day 2 after infection,
the macrophages have begun to up-regulate IAb,
but are still expressing very low levels of this protein when compared
with day 12 BCG macrophages. Since day 2 BCG macrophages were
phenotypically distinct from RP macrophages and from day 12 BCG
macrophages, we investigated the functional capabilities of these
populations.
|
A key function of macrophages during the immune response is
phagocytosis of pathogens. Macrophages engulf pathogens through a
variety of phagocytic receptors including those for opsonized
particles, such as Fc receptors (FcR) and complement receptors (CR),
and those for nonopsonized particles, such as the phagocytic pattern
recognition receptors (31). The phagocytic capacity of
BCG-activated macrophages both for opsonized (IgG and C3bi) and
nonopsonized (zymosan) particles was examined. Day 2 BCG macrophages
were highly phagocytic for IgG-opsonized SRBC, while day 12 BCG
macrophages were no more phagocytic than RP macrophages (Fig. 2
A). The day 2 BCG macrophages
were 7-fold more phagocytic than both RP and day 12 BCG
macrophages.
|
-activated
macrophages (34). In contrast, day 12 BCG macrophages are
poorly phagocytic for complement-coated SRBC in the absence or presence
of PMA. Interestingly, all three populations of macrophages bound
C3bi-opsonized SRBC to similar extents (data not shown). For both
complement- and FcR-mediated phagocytosis, macrophages at day 2 after
infection with BCG have an enhanced phagocytic capacity. Indeed, this
increased FcR and CR phagocytosis persists until 4 days postinfection,
which is then followed by decreased phagocytosis between days 8 and 14
after infection (data not shown).
We also looked at phagocytosis of zymosan, a yeast cell wall particle,
through pattern recognition receptors including the mannose receptor
(31). As shown in Fig. 2
C, there are only small
variations in the ability of macrophages to phagocytose zymosan during
BCG infection; day 2 BCG macrophages phagocytose zymosan marginally
more effectively than RP or day 12 BCG macrophages.
Receptor levels do not fully explain the modulation of phagocytic capacity in BCG-activated macrophages
We investigated whether changes in receptor levels could explain
the enhancement of phagocytosis in day 2 BCG macrophages and the
subsequent reduction seen at day 12. The phagocytic CR for
C3bi-opsonized particles in macrophages is CR3 which is composed of the
integrin CD11b/CD18 also known as Mac1 (35). Fig. 1
shows
changes in Mac1 levels seen during BCG activation of macrophages: Mac1
is highest in RP macrophages, intermediate in day 2 BCG macrophages,
and lowest in day 12 BCG macrophages. Although low Mac1 levels in day
12 BCG macrophages may explain the poor phagocytosis of C3bi-opsonized
particles by these macrophages, Mac1 levels do not explain the
difference in phagocytosis between RP macrophages and day 2 BCG
macrophages.
Murine macrophages express three different Fc receptors, two activating
receptors, Fc
RI and Fc
RIII, and one inhibitory receptor, Fc
RII
(36). Both Fc
RI and Fc
RIII have short cytoplasmic
tails and associate with the Fc
RI
chain to transduce signals. We
looked at mRNA levels for these proteins by semiquantitative RT-PCR in
sorted macrophage populations at days 2 and 12 after BCG infection to
determine whether changes in FcR expression could influence the
phagocytic capacity of the macrophages for IgG-opsonized particles. The
mRNA for Fc
RI was higher in both day 2 and day 12 macrophages from
BCG-infected mice than in RP macrophages, whereas there was no
difference in mRNA levels between the macrophage populations for the
other activating receptor, Fc
RIII, and the signaling chain,
Fc
RI
(Fig. 3
A). It is
possible that this up-regulation of Fc
RI accounts for the increase
in phagocytosis in day 2 BCG macrophages, although this is unlikely
since Fc
RI requires the Fc
RI
chain, which does not increase in
expression, for signaling and surface expression (36).
This high level of Fc
RI is maintained in day 12 BCG macrophages that
have a poor phagocytic capacity for IgG-coated particles (Fig. 3
A). Additionally, although there is no change in the levels
of the inhibitory receptor Fc
RII, between RP and day 2 BCG
macrophages, this receptor is expressed at lower levels in day 12
macrophages (Fig. 3
A). This would suggest that day 12 BCG
macrophages should have the highest phagocytic capacity; they have
increased activating receptors and decreased inhibitory receptors
compared with RP macrophages. Despite this, the data in Fig. 2
A demonstrate that this is not the case, day 12 macrophages
have low levels of FcR phagocytosis.
|
RII. Thioglycolate-elicited macrophages, which also enter the
peritoneal cavity with a similar time course, have increased
phagocytosis of IgG-opsonized particles (37) and have a
reduced ratio of Fc
RII:Fc
RIII in comparison with RP macrophages
(38). To confirm that down-regulation of Fc
RII does not
play a role in the increased FcR phagocytosis by day 2 macrophages, we
looked at phagocytosis after BCG infection of
Fc
RII-/- mice (38). RP
macrophages from Fc
RII-/- mice have an
3-fold increased phagocytic index when given IgG-opsonized particles
in comparison to those from wild-type mice (Fig. 3
RII-/- mice. We conclude that changes
in Fc
RII levels do not cause the increase in phagocytosis at day 2
after BCG infection. Day 12 BCG macrophages actively produce RNI, whereas day 2 BCG macrophages are primed for enhanced RNI production
After phagocytosis of the bacteria, the macrophage must kill the
pathogen in the vacuole to resolve infection. We measured production of
RNI, the principal mediator of mycobacterial killing, as an indicator
of bacteriocidal activity (39). As shown in Fig. 4
A, only macrophages isolated
at day 12 after BCG infection were spontaneously generating RNI
directly ex vivo. However, day 2 BCG macrophages were primed for
enhanced RNI production, since these cells produced similar levels of
RNI to those produced by day 12 macrophages in response to in vitro
stimulation with LPS (Fig. 4
B). RP macrophages treated with
LPS secreted significantly less RNI into the medium than macrophages
from BCG-infected mice. Therefore, day 2 BCG macrophages, although not
actively producing RNI, are primed to do so by prior BCG infection,
whereas day 12 BCG macrophages appear to be highly bacteriocidal
in vivo.
|
and IP-10 production
Macrophages help coordinate the immune response to bacterial
pathogens by secreting cytokines and chemokines which activate other
cells of the immune system and/or induce their homing to the site of
infection (9, 40). We therefore wanted to look at the
kinetics of production of two such proteins, the cytokine TNF-
, and
the chemokine IP-10. We measured constitutive TNF-
and IP-10 mRNA
levels in sorted macrophage populations by real-time quantitative PCR.
There was no increase in TNF-
mRNA levels in day 2 BCG macrophages
when compared with RP macrophages, whereas day 12 BCG macrophages
showed a 5-fold increase in this cytokine message (Fig. 5
A). In contrast, IP-10 mRNA
was already >250-fold induced in day 2 BCG macrophages and was further
increased in day 12 BCG macrophages (Fig. 5
B). It is likely
that this differential production of TNF-
and IP-10 by day 2 and day
12 BCG macrophages reflects the capacity of these populations to
influence the ongoing immune response.
|
To determine whether RP macrophages have the capacity to
differentiate into day 2 BCG macrophages, we used mAbs to
PECAM-1 (28) to block monocyte extravasation
into the peritoneal cavity (41). Mice were treated with
anti-PECAM-1 Abs or control IgG 1 h before infection with BCG
and macrophages were isolated after 2 days. There was no difference in
the capacity of day 2 BCG macrophages isolated from control IgG- or
anti-PECAM-1-treated mice to phagocytose C3bi-opsonized SRBC (Fig. 6
A) or IgG-opsonized SRBC
(data not shown), or to produce RNI in response to LPS (Fig. 6
B). Confirmation that the anti-PECAM Ab blocked
monocyte influx into the peritoneal cavity was obtained by a number of
approaches, including the demonstration that the average number of
macrophages recovered from the peritoneal cavity of
anti-PECAM-1-treated, BCG-infected mice (0.54 ± 0.09 x
106), was significantly lower
(p < 0.006) than that recovered from control
IgG-treated mice (1.21 ± 0.12 x 106).
These data show that RP macrophages can serve as precursors for day 2
BCG macrophages.
|
| Discussion |
|---|
|
|
|---|
mRNA compared with RP
macrophages. In contrast, day 12 BCG macrophages were poorly
phagocytic, but produced RNI constitutively, IP-10 and TNF-
mRNA,
and expressed high levels of cell surface MHC class II molecules. We
propose that the macrophages at day 2 after BCG infection are
specialized for phagocytic uptake of pathogens from the extracellular
space, whereas day 12 BCG macrophages are specialized for bacterial
killing of internalized pathogens. This transition in functional capacities seen in BCG-activated macrophages is reminiscent of the maturation pathway of a related cell type, the DC. Immature DC in the tissues are specialized for Ag uptake via endocytosis, macropinocytosis, and phagocytosis (15, 16, 17, 18, 19), whereas mature DC in the lymph nodes are specialized for Ag presentation to naive T cells (14). We were struck by the similarities in phagocytic capacity between day 2 BCG macrophages and immature DC and that both cell types subsequently down-regulate this phagocytic capacity. Despite these similarities, we do not have evidence that day 2 BCG macrophages directly differentiate into day 12 macrophages in vivo, whereas it is clear that immature DCs differentiate into mature DCs as this can be observed in isolated cells in vitro.
Mature DC have high levels of MHC class II and costimulatory molecules
on their surface to stimulate naive T cells (20, 21, 22, 23, 24).
Although both day 12 BCG macrophages and mature DC have increased
levels of MHC class II and costimulatory molecules on their surface,
the function and identity of these proteins appear to differ. Mature DC
use high levels of class II and CD86 to stimulate naive T cells in the
lymph nodes (14), whereas day 12 BCG macrophages use MHC
class II and CD80 to stimulate previously activated T cells at the site
of infection (J. A. Hamerman and A. Aderem, unpublished
observations). This stimulation of activated CD4 T cells in the
peritoneal cavity induces the local production of IFN-
, a cytokine
required for macrophage RNI production and therefore for resolution of
BCG infection (39).
It has recently been shown that monocytes can differentiate into DC in vitro and in vivo after phagocytosis of latex beads and zymosan (42, 43). This finding, along with the similarities in phagocytosis between BCG macrophages and DC, induced us to examine whether some BCG-activated macrophages differentiate into mature DC. We did not detect expression of the DC markers CD11c, DEC-205, and CD86 on day 2 or day 12 BCG-activated macrophages (J. A. Hamerman and A. Aderem, unpublished observations). We have not exhaustively examined all DC markers, nor can we rule out the expression of those we have examined on a very small population of cells. It is also possible that some BCG-activated macrophages leave the peritoneal cavity and then differentiate into DC. Randolph et al. (43) demonstrated that after phagocytosing particles, human monocytes reverse transmigrated out of the tissues and then differentiated into DC. Similarly, inflammatory macrophages can leave the peritoneal cavity and migrate to the draining lymph nodes (44).
It is generally viewed that activated macrophages are highly phagocytic
(37, 45), although there are some conflicting reports
(46). Our results suggest that the difference in these
reports may reflect temporal differences in the experiments; in our
hands, phagocytic capacity was increased markedly from days 2 to 4
postinfection and was decreased substantially after day 8 (J. A.
Hamerman and A. Aderem, unpublished observations). We investigated the
mechanism for the modulation of phagocytic capacity by BCG-activated
macrophages. For CR-mediated phagocytosis, decreased levels of receptor
(Mac1) correlated with decreased phagocytic capacity in day 12 BCG
macrophages, although these macrophages can bind similar numbers of
C3bi-opsonized particles to both RP and day 2 BCG macrophages. However,
the major increase in CR-mediated phagocytosis in day 2 BCG macrophages
cannot be explained by receptor levels, day 2 macrophages actually
express less Mac1 than RP macrophages. It is likely that increased PKC
activation in day 2 BCG macrophages explains this increase in
phagocytosis. First, PKC is constitutively activated in day 2 BCG
macrophages as judged by the phosphorylation of the PKC substrate
MARCKS (A. Aderem, unpublished observations). Second, phorbol
ester-induced PKC activation of RP macrophages results in a similar
phagocytic index to that seen for untreated day 2 macrophages. In
addition to stimulating CR phagocytosis (32, 33), PKC
activation has also been shown to enhance FcR phagocytosis in vitro
(47), and may also account in part for our data showing
increased FcR phagocytosis by day 2 BCG macrophages. As discussed
above, it is not likely that differences in FcR expression account for
the large increase in FcR-mediated phagocytic capacity in day 2 BCG
macrophages. We confirmed that the absence of the inhibitory Fc
RII
resulted in enhanced phagocytosis of IgG-opsonized particles by RP
macrophages (48), but we show here that this
receptor was not responsible for the increased FcR phagocytosis seen in
day 2 BCG macrophages. It has recently been shown that the Rho family
GTPase, cdc42, is important in regulating the differential endocytic
capacity of immature and mature DC (49). Therefore, it was attractive
to postulate that this mechanism may underlie the differential
phagocytic responses observed between BCG-activated macrophages and
resident peritoneal macrophages. We attempted to determine whether
cdc42 activation differed in BCG-activated macrophages and resident
peritoneal macrophages; unfortunately, we could not detect sufficient
cdc42 protein in these cells to draw conclusions from this study (our
unpublished observations).
Macrophages coordinate the immune response during bacterial infections
through cytokine and chemokine production. Although day 12 BCG
macrophages have increased mRNA levels for both TNF-
and IP-10, we
observed differential regulation of these secreted mediators in the day
2 BCG macrophages. TNF-
mRNA was not increased in day 2 BCG
macrophages, although it is well established that macrophage
interaction with bacteria induces TNF-
secretion within hours of
contact. The result is consistent with that of Stein and Gordon
(12) who demonstrated that macrophages from the peritoneal
cavity of BCG-infected mice do not release any TNF-
until day 8
after infection. TNF-
has pleiotropic effects on the immune response
including neutrophil activation, induction of endothelial cell
E-selectin expression, costimulation of NK cells for IFN-
production, and induction of chemokine expression (50).
The relevance of the delay in TNF-
production until later times
after infection is unclear, but it remains possible that there is a
wave of TNF-
production by macrophages immediately after infection
that has subsided by day 2.
In contrast to TNF-
production, mRNA for the chemokine IP-10 is
already massively induced in day 2 BCG macrophages, and this level is
maintained in day 12 macrophages. IP-10 is chemotactic for monocytes,
NK cells, and activated Th1 T cells and may be important for the homing
of distinct cell types at different times after infection (40, 51, 52). At day 2, IP-10 may induce monocyte and NK cell homing
to the peritoneal cavity, while at day 12 it may act predominantly on
activated Th1 T cells. IP-10 has been shown to be critical for control
of infection with another intracellular pathogen, Toxoplasma
gondii, where it is also expressed at both early and late times
after infection (53). Differences in TNF-
and IP-10
expression at days 2 and 12 after BCG infection not only further
defines these macrophage populations, but also illustrates that the way
macrophages influence the immune response can change over the course of
infection.
To address the identity of the precursor cell of day 2 BCG macrophages, we infected mice with BCG while blocking monocyte extravasation with Abs to PECAM-1 (28, 41). Anti-PECAM-1 Abs did not affect the capacity of day 2 BCG macrophages to increase phagocytosis or to be primed for enhanced RNI production. These data demonstrate that RP macrophages can differentiate into BCG-activated macrophages, though we do not rule out that monocytes can also differentiate into these cells. We also atempted to determine a lineage relationship between day 2 and day 12 BCG macrophages using sustained blocking of PECAM-1 with Abs, but this treatment did not appear to block monocyte extravasation during this extended time period (our unpublished observations).
In this report, we have revisited a classical system used to study in vivo immune activation of macrophages; we have examined the temporal response to BCG infection, identified an early intermediate in the process, and defined a functional transition in these macrophage populations. The results demonstrate an exquisite level of regulation of macrophage function and suggest future directions for further dissection of the pathway.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Alan Aderem, Institute for Systems Biology, 4225 Roosevelt Way N.E., Suite 200, Seattle, WA 98105. E-mail address: aderem{at}systemsbiology.org ![]()
3 Abbreviations used in this paper: BCG, bacillus Calmette-Guérin; RP, resident peritoneal; PECAM-1. platelet endothelial cell adhesion molecule-1; RNI, reactive nitrogen intermediates; DC, dendritic cell; CR, complement receptor; PKC, protein kinase C; HPRT, hypoxanthine phosphoribosyltransferase. ![]()
Received for publication December 20, 2000. Accepted for publication June 8, 2001.
| References |
|---|
|
|
|---|
/
-bearing T cells during infection with Calmette Guérin bacillus. J. Immunol. 146:2754.[Abstract]
). Curr. Opin. Immunol. 9:17.[Medline]
genes. Science 259:1739.
. J. Immunol. 139:518.[Abstract]
. J. Exp. Med. 179:1109.
modulates protein kinase C activity in murine peritoneal macrophages. J. Biol. Chem. 260:1378.
RII-deficient mice. Nature 379:346.[Medline]
(TNF-
): the good, the bad and potentially very effective. Immunol. Cell Biol. 74:434.[Medline]
This article has been cited by other articles:
![]() |
D. G. Mordue and L. D. Sibley A novel population of Gr-1+-activated macrophages induced during acute toxoplasmosis J. Leukoc. Biol., December 1, 2003; 74(6): 1015 - 1025. [Abstract] [Full Text] |
||||
![]() |
J. J. Gaforio, E. Ortega, I. Algarra, M. J. Serrano, and G. Alvarez de Cienfuegos NK Cells Mediate Increase of Phagocytic Activity but Not of Proinflammatory Cytokine (Interleukin-6 [IL-6], Tumor Necrosis Factor Alpha, and IL-12) Production Elicited in Splenic Macrophages by Tilorone Treatment of Mice during Acute Systemic Candidiasis Clin. Vaccine Immunol., November 1, 2002; 9(6): 1282 - 1294. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wyllie, P. Seu, F. Q. Gao, P. Gros, and J. A. Goss Disruption of the Nramp1 (also known as Slc11a1) gene in Kupffer cells attenuates early-phase, warm ischemia-reperfusion injury in the mouse liver J. Leukoc. Biol., November 1, 2002; 72(5): 885 - 897. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. DesJardin, T. M. Kaufman, B. Potts, B. Kutzbach, H. Yi, and L. S. Schlesinger Mycobacterium tuberculosis-infected human macrophages exhibit enhanced cellular adhesion with increased expression of LFA-1 and ICAM-1 and reduced expression and/or function of complement receptors, Fc{gamma}RII and the mannose receptor Microbiology, October 1, 2002; 148(10): 3161 - 3171. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Hamerman, F. Hayashi, L. A. Schroeder, S. P. Gygi, A. L. Haas, L. Hampson, P. Coughlin, R. Aebersold, and A. Aderem Serpin 2a Is Induced in Activated Macrophages and Conjugates to a Ubiquitin Homolog J. Immunol., March 1, 2002; 168(5): 2415 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Nau, J. F. L. Richmond, A. Schlesinger, E. G. Jennings, E. S. Lander, and R. A. Young Human macrophage activation programs induced by bacterial pathogens PNAS, February 5, 2002; 99(3): 1503 - 1508. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |