| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
College of Veterinary Medicine and Department of Veterinary Pathology, Michigan State University, East Lansing, MI 48824;
Department of Internal Medicine, Harold C. Simmons Arthritis Research Center, University of Texas Southwestern Medical Center, Dallas, TX 75390; and
Department of Medicine, New York University Medical Center, New York, NY 10016
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In higher eukaryotes, deficiencies in any of DNA-PK’s three component polypeptides effectively disrupt the organism’s capacity to efficiently repair DNA DSBs, resulting in extreme sensitivity to ionizing radiation. This radiosensitivity is not in and of itself lethal. However, in normal environments, DNA-PK deficiencies are generally lethal postnatally because vertebrate immune systems are dependent on the NHEJ pathway to complete V(D)J recombination, the site-specific recombination process that provides for assembly of unique Ag receptor genes (10, 11, 12). If V(D)J recombination is disrupted, lymphocyte development is blocked at the prolymphocyte stage, resulting in a profound deficiency of mature B and T lymphocytes and the disease SCID.
The lymphocyte-specific endonuclease which initiates V(D)J recombination is comprised of the recombinase- activating gene (RAG) 1 and RAG2 proteins and is targeted to immune receptor gene segments by recombination signal sequences (RSS) which abut the coding sequences of all functional immune receptor gene segments (13, 14). During V(D)J recombination, the RAG proteins introduce two DSBs generating four DNA ends with structurally distinct termini (15, 16). The coding ends have covalently sealed hairpinned ends, whereas signal ends have blunt and 5'-phosphorylated termini. The NHEJ pathway mediates the resolution of both coding and signal ends.
Two spontaneous germline mutations of DNA-PKcs have been characterized previously. The first was discovered in a colony of C.B-17 mice which were shown to have markedly reduced numbers of both B and T lymphocytes (17). Later it was determined that the lack of mature lymphocytes was due to a severe defect in V(D)J recombination (18). This defect in V(D)J recombination produced a dramatic deficit in coding joint formation, but had a negligible effect on signal end joining, and, in 1995, DNA-PKcs was implicated as the defective factor (19). In 1975, McGuire and Poppie (20) described an autosomal recessive form of combined immunodeficiency that occurs at high frequency in Arabian foals (20). Like SCID mice, these animals are profoundly deficient in both B and T cells. In 1995, we characterized the molecular defect in these horses as faulty V(D)J recombination that could be explained by a severe deficiency in DNA-PKcs expression (21). In contrast to SCID mice, lymphocytes from SCID foals have dramatically reduced levels of signal joints. We first hypothesized that this difference might be explained by the specific DNA-PKcs mutations in these two animal models of SCID. The DNA-PKcs mutation in SCID foals deletes 967 aa from the C terminus, including the entire phosphatidylinositol 3-kinase domain (22). In contrast, the mutation in SCID mice deletes only 83 aa from the C terminus, leaving the phosphatidylinositol 3-kinase domain intact and generating a potentially partially active mutant enzyme (23, 24). Thus, we attributed the less severe phenotype in SCID mice to an incomplete mutation. This hypothesis was negated by targeted deletion of DNA-PKcs (25, 26, 27, 28). The phenotype of DNA-PKcs null animals is indistinguishable from C.B-17 SCID mice, although these recent studies establish that signal joint formation in SCID mice is also modestly defective—being both slightly reduced (0- to 10- fold) and less precise than in normal animals.
Another potential explanation for the phenotypic differences between SCID mice and foals is that the equine mutation might generate a functional protein that blocks other components of the NHEJ pathway in a dominant negative manner. We negated this hypothesis using site-directed mutagenesis of DNA-PKcs (29). Furthermore, we established that signal end joining in SCID foals is reduced by at least 4 logs and that coding end joining is reduced by 5 logs. Thus, both signal and coding joint formation is more dramatically reduced in SCID foals than in SCID mice (where coding joints are reduced by 2–3 logs maximally). We hypothesize that in normal lymphocytes, DNA-PKcs functions in both the efficient joining of coding ends and the efficient and precise joining of signal ends. In the absence of DNA-PKcs, alternative DNA end-joining pathways may facilitate inefficient and imprecise joining of recombination intermediates. Furthermore, this alternative pathway must not be utilized equivalently in all species.
We recently discovered another genetic form of non-B/non-T SCID in a litter of Jack Russell terriers.4 Briefly, 12 of 32 siblings from a single breeding pair of Jack Russell terriers succumbed to opportunistic infections within 8–14 wk of age. To investigate this potential genetic immunodeficiency, an additional litter was whelped. From this litter, we determined that four of seven puppies displayed a phenotype of SCID which included extreme lymphopenia, aggamaglobulinemia, thymic dysplasia, peripheral lymphoid aplasia, and apparent autosomal recessive inheritance.4 In this report, we assess cells or tissues from these animals for the following activities: adenosine deaminase (ADA), purine nucleoside phosphorylase (PNP), Ig and TCR gene rearrangement, radiation resistance, and DNA-PK. We have determined that immunodeficiency in these animals is the result of defective V(D)J recombination that can be explained by a deficiency in DNA-PKcs. Our data indicate that as in SCID foals, both coding and signal joint resolution are impaired although the degree of both is intermediate between the murine and equine phenotypes.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The presence of ADA and PNP was detected by electrophoresis in starch gels and in situ staining essentially as described previously (30).
DNA isolation
DNA was prepared from thymus and bone marrow collected from 6-wk-old SCID and normal Jack Russell terrier littermates and from bone marrow of C.B-17 SCID and BALB/c mice using commercially available DNA extraction buffer (Applied Biosystems, Foster City, CA).
Oligonucleotides
Sequences of oligonucleotides used in this study were as follows: can 5'VH-2, GCAGACGCTGTGAAGGGCC; can 5'VH-1, CAGATGAACAGCCTGAGAGC; can 3'VH, GCACAGTAATACATGGCCG; can 3'JH, TCTGAGGAGACGGTGACCAGGG; can 5'VB1, CCAGACATCTGTGTACTTCTG; can 3'JB1, AGGACCGTGAGCCTGGTGCC; can VB screen, ATGTTCTGGTATCGACAAGACCC; can 3'VB, CAGAAGTACACAGATGTCTG; can 5'JBds, GGGCGCCTGGTCGGGGAA; can 5'JB inner, CCCTCAGCTTGTGCCAAG; can 5'JB outer, CAGCTAGCTCTGGAGGTG; can 3'DB outer, ACCAGCTAGAGAGACACC; can 3'DB inner: TCCCAGCCACTCCCCATC; can 3'DB probe, CAGGTGGAGGGGGTCCTT; 150, GCTATGTACTACCCGGGAATTCGTG; 149, CACGAATTCCC; 150 + cac, GCTATGTACTACCCGGGAATTCGTGCAC; mur 5'JH4, ATCGATGCATAATGTCTGAGTTGCCC; mur 3'JH4, GACCTGCAGAGGCCATTCTTACCTGAGGAG; 5'J558, TCCAGCACAGCCTACATGCAGCTC; mur JH screen, TCACXGTYTCYTCYKCAGGT; 5'DNA-PKcs exon 5, CTCATGGATGAATTTAAAATTGGAGA; 3'DNA-PKcs exon 6, TCACTAGGATGAACTTCACC; 5'DNA-PKcs intron 5, GACCAGATCTTTCTTTCCTG; 3'DNA-PKcs intron 5, GAAATAATTTCATGGAGTGTTTGG; and DNA-PKcs diagnostic primer, AGCAAAAAGAATTCCTCTGTAGTA; altered base is underlined.
PCR
PCR were conducted in a volume of 100 µl using amplification
primers described in each figure legend and the indicated amounts of
DNA. For the experiment depicted in Fig. 1
, 40 cycles of amplification were
performed using the following conditions: 94°C for 1.5 min, 55°C
for 2 min, and 72°C for 3 min. For nested PCR experiments, initial
amplification conditions were: 94°C for 1.5 min, 2°C for 2 min, and
72°C for 3 min for 40 cycles. Ten microliters of each reaction was
subsequently amplified as follows: 94°C for 1 min, 56°C for 1 min,
and 72°C for 1 min for 40 cycles. Twenty microliters of each PCR was
analyzed by Southern blot filter hybridization analysis. For sequence
analysis, amplified rearrangements were gel purified and ligated into
pCR2.1 (Invitrogen, Carlsbad, CA) and transformed into competent
Escherichia coli. Recombinant colonies were identified by
hybridization and sequenced on an Applied Biosystems sequencer (Applied
Biosystems).
|
LMPCR was performed similar to the method described by Roth et al. (15). Briefly, 300 pmol of annealed linker (oligonucleotides 150 and 149) were ligated to 20 µg of normal canine lung, normal canine thymus, or SCID canine thymus DNA. Ligated DNA was extracted with phenol-chloroform and ethanol precipitated. Subsequently, linker-ligated DNA was used in PCR using primers 150 +cac and 5'JBds for 40 cycles as follows: 94oC for 1.5 min, 64oC for 45 min, and 72oC for 45 min.
Cell lines
The JRSC and JN005 cell lines were established from dermal biopsies from a SCID puppy and from an unrelated normal dog, respectively. The MSU1.1 is a normal immortalized human fibroblast line, the generous gift of Justin McCormick (Michigan State University, East Lansing, MI). The 0176 and 1821 cell lines were derived from normal and SCID foals, respectively, and have been described previously (21). NS47, a wild-type mouse fibroblast cell line, was generously provided by Dr. K. Ariizumi (University of Texas Southwestern Medical Center, Dallas, TX). Sf19, a SCID mouse fibroblast cell line, was generously provided by Dr. M. Bosma (Fox Chase Cancer Center, Philadelphia, PA).
Assessment of radiation sensitivity
Cells (103) were exposed to various amounts of ionizing radiation using a 60Co source and immediately seeded in complete medium containing 20% FBS. After 14 days, cell colonies were fixed with 2% formaldehyde followed by 100% methanol. Subsequently, the colonies were stained with trypan blue and colony numbers were assessed.
DNA-PK microfractionation and measurement of kinase activity
Whole-cell extracts were prepared by a modification of the method of Finnie et al. (31). Briefly, 20 x 106 cells were harvested, washed three times in PBS, and cell pellets were frozen at -80°C. Frozen cell pellets were resuspended in 20 µl of extraction buffer (50 mM NaF, 20 mM HEPES (pH 7.8), 450 mM NaCl, 25% (v/v) glycerol, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml protease inhibitor, and 1.0 µg/ml trypsin inhibitor), subjected to three freeze/thaw cycles (liquid nitrogen/37°C), and centrifuged at 8160 x g for 7 min at 4°C. Supernatants were stored at -80°C before use and concentrations were determined by Bradford analysis using BSA as a standard.
The SignaTECT DNA-PK assay system (Promega, Madison, WI) was used to assay DNA-PK activity with the following modifications. Two hundred micrograms of extract was incubated with 20 µl of preswollen dsDNA-cellulose beads (Amersham Pharmacia Biotech, Piscataway, NJ) for 30 min at 4°C. The dsDNA-cellulose was then washed three times with 1 ml of buffer A (25 mM HEPES (pH 7.9), 50 mM KCl, 10 mM MgCl2, 10% (v/v) glycerol, 1 mM EDTA, 1 mM EGTA, and 1 mM DTT) before it was resuspended in 20 µl of DNA-PK reaction buffer containing 100 µg/ml BSA. Kinase reactions were conducted with 10-µl aliquots of the resuspended DNA-PK-absorbed cellulose beads and were performed in both the presence and absence of a biotinylated DNA-PK p53-derived substrate peptide. Terminated reactions were analyzed by spotting onto SAM2 membrane, washing, and counting in a scintillation counter as per the manufacturer’s instructions. All assays were performed in duplicate with at least two different extract preparations.
Immunoblot analysis
The indicated amounts of whole-cell extracts were electrophoresed in a 5% SDS-polyacrylamide gel and transferred to polyvinylidene difluoride. A mAb (32) (18-1, generous gift from Dr. T. Carter, St. Johns University, New York, NY) was used as the primary Ab (1:300). This monoclonal can detect DNA-PKcs from many diverse mammalian species and detects an epitope within the N-terminal 250 kDa of the protein. A goat anti-mouse IgG conjugated to HRP was used as the secondary Ab. The membrane was then incubated with a chemiluminescent substrate (ECL; DuPont Pharmaceuticals, Wilmington, DE) according to the manufacturer’s recommendations.
Genetic marker in the canine DNA-PKcs gene
Primers were designed to conserved regions in exons 5 and 6 of the human and mouse DNA-PKcs gene sequences (33, 34). A 650-bp dog DNA-PKcs fragment was amplified in a 25-µl reaction using 50 mM KCl, 10 mM Tris (pH 8.3 at 21°C), 1.5 mM MgCl2, 100 µM dNTPs, 20 µM of each primer, and 50 x 10-9 g of canine genomic DNA. Cycling conditions were 95°C for 1 min, 55°C for 2 min, and 72°C for 3 min for 35 cycles. The identity of the sequence was confirmed by performing a BLAST search (35). Two additional primers were made to determine the complete sequence of intron 5 (GenBank accession number in process). A single nucleotide polymorphism (SNP) was found in intron 5 using a pool-and-sequence approach (36). Briefly, genomic DNA samples from 10 different dog breeds were pooled, amplified, and sequenced using a Thermosequenase cycle sequencing kit according to the manufacturer’s instructions (United States Biochemical, Cincinnati, OH). The SNP was identified as two bands (A and G) at the identical position in the sequencing ladder. An RsaI restriction site was created for the G allele by altering one base in a diagnostic primer. Amplification conditions were the same as above, except that cycling conditions were 94°C for 1 min, 54°C for 2 min, and 72°C for 3 min for 35 cycles. Three microliters of 50 mM MgCl2 and 1 µl of RsaI (10 U) were added directly to the PCR product, followed by incubation at 37°C for 1 h. Products were analyzed by electrophoresis on a 2% agarose gel. The A allele was recognized by the presence of a 202-bp band and the G allele was recognized by the presence of 178- and 24-bp bands.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Abnormalities in purine metabolism due to defective ADA or PNP account for a significant percentage of the cases of SCID in humans. To date, no such naturally occurring mutations have been documented in animals (37). We assessed both ADA and PNP activity in normal and SCID dogs by assaying enzymatic activity in hemolysates after electrophoresis in starch gels, as described previously (30). In sum, levels of PNP and ADA activity were similar in hemolysates from normal and SCID dogs (data not shown), and we conclude that ADA and PNP defects cannot explain the immunodeficiency observed in Jack Russell terriers.
Ig and TCR coding joints are severely diminished in SCID puppies
To determine whether V(D)J recombination is intact in SCID
puppies, DNA was isolated from thymus and bone marrow samples from
affected and unaffected Jack Russell Terrier littermates. Using PCR
amplification primers derived from published canine cDNAs, both TCR
and Ig coding joints were assessed. As can be seen, unrearranged
VH (Fig. 1
A, top panel) and
VB (Fig. 1C, top panel)
gene segments are equivalently amplified from normal and SCID bone
marrow and thymus DNA, respectively. Complete
VHDHJH
(Fig. 1A, bottom panel) or
VBDBJB
(Fig. 1C, bottom panel) coding joints were only
consistently detected from DNA derived from normal animals.
Furthermore, coding joints in normal dogs were easily detected using as
little as 5 ng of thymus or bone marrow DNA. In contrast, only
extremely low levels of
VBDBJB
coding joints could be detected from SCID thymus and detection of
coding joints required 5 µg of SCID thymus DNA.
VHDHJH
coding joints were not detected from SCID bone marrow DNA. This level
of coding joint depression is representative of experiments when
comparing TCR (representative of six different experiments) and Ig
(representative of three different experiments) rearrangements from two
normal and two SCID animals (data not shown). Thus, we conclude that
coding end resolution is diminished by at least 4 logs in SCID dog
lymphocytes as compared with normal canine lymphocytes implicating
V(D)J recombination as the mechanistic defect in this animal model
of SCID.
In our attempt to detect coding joints from SCID dogs and previously
from SCID foals (29), a more aggressive PCR strategy than
that used in studies of SCID mouse Ig and TCR rearrangements was used.
Both the quantity of template DNA and the cycle number were increased
to detect coding joints in SCID dogs. Therefore, to more directly
compare the relative coding joint diminution in SCID dogs to that
observed in SCID mice, which was previously reported to be depressed
100- to 1000-fold compared with normal animals (18, 25, 26, 27), we assessed Ig
VHDHJH
rearrangements in murine bone marrow DNA using our PCR strategy and a
VH region primer specific for the J558
VH gene family (Fig. 1B, bottom
panel). As can be seen, the sensitivity of detecting Ig
rearrangements from normal mouse and dog bone marrow is similar.
Furthermore, Ig
VHDHJH
rearrangements are depressed by 
100-fold in bone marrow from SCID
mice, consistent with the reports from other investigators. This level
of coding joint depression was also observed using another
VH segment primer (the X24 gene segment family,
data not shown). Thus, we conclude that the block in coding joint
resolution is more dramatic in SCID dogs than in SCID mice.
V(D)J recombination is initiated normally in SCID puppies
To date, several different spontaneous germline mutations have been documented which result in defective V(D)J recombination and the disease SCID. In children, mutations in either RAG1 or RAG2 have been shown to account for SCID (38). Similarly in mice, targeted mutation of either RAG1 or RAG2 results in a severe form of SCID (39, 40) which does not include the "leaky" phenotype seen in DNA-PKcs-deficient mice. RAG-deficient mice completely lack either signal or coding rearrangements because, in the absence of the RAG proteins, rearrangement is not initiated and Ig and TCR genes remain in germline configuration. This has been documented using the technique of LMPCR to assess free signal ends that are present in developing lymphocytes as recombination intermediates (16). We reasoned that the RAG proteins could be implicated (or eliminated) as the defective factor in these SCID puppies by assessing free signal ends by LMPCR.
Using LMPCR, free JB signal ends were assessed
from normal canine thymus DNA, canine SCID thymus DNA, and normal
canine lung DNA. As can be seen (Fig. 2A), free signal ends are
equivalently detected in normal and SCID thymus DNA (compare
lanes 3 and 4 to lanes 5 and
6). As expected, free signal ends are not detected in
nonlymphoid DNA (lanes 1 and 2). These
data suggest that TCR gene rearrangement is initiated normally in SCID
dogs and that the RAG proteins are fully functional.
|
Using amplification primers from conserved regions of
DB2 and JB2.1, the
intergenic region between the two gene segments was cloned and
sequenced so that DBJB
signal joints could be examined. Although signal joints were easily
detected from normal canine thymus DNA with a standard PCR assay,
signal joints were not detected from canine SCID thymus DNA (data not
shown). Thus, a more sensitive nested PCR strategy was used which is
completely analogous to the strategy used to detect signal joints from
SCID foals in our recent study (29). As can be seen (Fig. 2B), signal joints can be detected in as little as 0.5 ng of
normal canine thymus DNA; in contrast, signal joints could only be
detected in 50 ng of canine SCID thymus DNA. This degree of signal
joint diminution was consistent when comparing two SCID and two normal
animals and is representative of four independent experiments.
Thus, we conclude that the frequency of
DBJB signal joints in
canine SCID thymus is 2 logs lower than in normal canine thymus.
As discussed above, signal joints are generally precise, lacking either
nucleotide addition or deletion. Structurally, signal joints are head
to head ligations of the two heptamer sequences which generates a de
novo restriction endonuclease site, ApaLI. It has been
demonstrated that the signal joints formed in SCID mice are less
precise than in normal animals (27). The fidelity of
signal ligation was examined by subjecting the amplified signal joints
to ApaLI restriction. As can be seen (Fig. 2C),
90% of the signal joints amplified from normal dogs are sensitive
to ApaLI, whereas only 10–20% of the joints amplified from
SCID dogs are sensitive to ApaLI. Thus, we conclude that
both the rate and fidelity of signal end resolution in SCID dogs is
diminished. Furthermore, the relative diminution in signal end
resolution in SCID dogs is intermediate as compared with SCID mice or
SCID horses such that the degree of signal joint reduction in these
three models of SCID is as follows: equine SCID > canine
SCID > murine SCID.
Hybrid joints are modestly reduced in SCID puppies
Hybrid joints are examples of aberrant end resolution and result
from ligation of the coding end of one gene segment to the signal end
of a second gene segment (41). The frequency of hybrid
rearrangements of endogenous immune receptor gene segments has been
shown to be 100- to 1000-fold less than standard joining depending
on the specific rearrangements analyzed (42, 43). It has
recently been shown that hybrid rearrangements can be mediated solely
by the RAG proteins in a reversal of the normal cleavage reaction
(44, 45). Thus, in the absence of intact nonhomologous DNA
end joining, the relative number of hybrid joints should be relatively
normal, as compared with either signal or coding joints. We recently
examined hybrid joining of TCR gene segments in equine SCID lymphocytes
(29). We found that although certain hybrid rearrangements
occurred at relatively normal levels, other hybrid joints were severely
diminished, suggesting that some hybrid rearrangements are mediated by
the NHEJ pathway.
Hybrid rearrangements were also assessed in canine thymocytes. As can
be seen (Fig. 3A),
JB coding 3'DB RSS hybrid
joints are diminished by 2 logs in canine SCID thymocytes, similar to
the reduction observed in signal joints. These data support our
previous conclusion that certain hybrid joints are mediated
predominately by the NHEJ pathway.
|
It has previously been reported that hybrid and coding joints
isolated from animals deficient in Ku or DNA-PKcs exhibit less
junctional diversity than rearrangements isolated from normal animals
(46). This is primarily due to diminished numbers and
length of N segments (the random nucleotides added at the coding
junctions by the enzyme terminal deoxynucleotidyl transferase). We
chose to assess junctional diversification of rare rearrangements
present in canine lymphocytes by analyzing hybrid joints (as opposed to
coding joints) for two reasons. First, hybrid joints are significantly
more abundant than coding joints; furthermore, it has been shown that
hybrid joints display similar levels of N and P segment additions as
compared with coding joints (46), and thus should be
representative with regard to junctional modification. Therefore,
hybrid joints were cloned and sequenced from thymus DNA from both
normal and SCID dogs (Fig. 3B). As can be seen, excessive P
segments (the palindromic nucleotides at the junctions generated by
asymmetric opening of the hairpinned coding termini) derived from the
J
coding segment are observed in the SCID rearrangements. Fifty
percent of the rearrangements have P elements which range from 1 to 9
nt. None of the hybrid joints isolated from the normal animals have P
elements. There is a slight decrease in the number of N
segment-positive rearrangements when comparing normal animals to SCID
as well as a modest decrease in N segment length (2.4 vs 8.9 nt).
Hybrid and coding joints from Ku-deficient mice have virtually no N
segments, whereas SCID mice have only a modest deficiency in N segment
addition (46). Thus, the structural characteristics of
these hybrid joints are more analogous to those observed from SCID mice
than from those observed from Ku-deficient mice.
Radiosensitivity of canine SCID fibroblasts
The data presented thus far are consistent with the NHEJ pathway
being defective in these animals. Thus, we next assessed
radiosensitivity in fibroblasts derived from a SCID puppy and from a
normal dog. As can be seen in Fig. 4A, the normal canine
fibroblast cell line is more radioresistant than fibroblasts derived
from the SCID puppy. These data suggest that the genetic defect in
these animals results in impaired NHEJ.
|
Of the five known factors known to be requisite for both the V(D)J
recombination and NHEJ, three are components of DNA-PK. Thus, to
further investigate the NHEJ pathway in these animals, DNA-PK activity
was assessed using whole-cell extracts prepared from canine SCID and
normal fibroblasts. It is well appreciated that DNA-PK activity is
abundantly expressed in human cells but much more minimally expressed
in rodent cells. We previously established that equine cells express
intermediate levels of DNA-PK activity as compared with human and
rodent cells. To compare the relative level of DNA-PK in normal canine
cells to the level in human, equine, and murine cells, we assessed
DNA-PK activity in normal fibroblast cell lines from these species. As
can be seen (Fig. 4B), in normal canine fibroblasts, DNA-PK
activity is intermediate as compared with that observed in horse and
mouse fibroblasts. Finally, DNA-PK activity was undetectable in the
canine, equine, or murine SCID fibroblasts, implicating either DNA-PKcs
or Ku as the defective factor in SCID dogs.
Next, we performed immunoblot assays to assess levels of DNA-PKcs,
Ku70, and Ku86 in whole-cell extracts from canine SCID fibroblasts
compared with normal canine cells. Whereas Ku levels did not differ in
SCID cells compared with the normal cells (data not shown), canine SCID
fibroblasts were found to be defective in DNA-PKcs expression (Fig. 4C). The 465-kDa DNA-PKcs polypeptide is easily detected in
the normal canine cells, but not in the canine SCID fibroblasts, and we
conclude that DNA-PKcs expression is markedly diminished in canine SCID
cells.
Identification of a SNP in the DNA-PKcs gene and segregation of one allele with the mutant phenotype
To obtain genetic evidence that DNA-PKcs is in fact the defective
factor in these animals, we attempted to identify a polymorphism within
the canine DNA-PKcs gene to determine whether within a lineage a single
allele segregated with the mutant phenotype. A polymorphic transition
(A/G) was identified at position 95 of intron 5 by using a
pool-and-sequence method. A diagnostic PCR-based test was then
developed to distinguish the two alleles. When DNA samples were
analyzed from members of the pedigree in which the SCID gene was
segregating, it was found that segregation of the G allele
was consistent with the SCID gene being DNA-PKcs, under the assumption
that the G allele is linked with the mutation in the gene
(Fig. 4D). The three affected animals are homozygous for the
G allele. The three unaffected siblings are either
homozygous for the A allele or heterozygotes (Fig. 4D). We have recently tested an additional five animals from
a subsequent litter, and homozygosity for the G allele
segregates exclusively with the SCID phenotype. Thus, in this limited
pedigree analysis, the mutant phenotype segregates with homozygosity of
one DNA-PKcs allele. These data are consistent with (although
certainly not indicative of) DNA-PKcs being the defective factor in
these animals.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
First, are all cell types affected by species-dependent differences in the absolute requirement for DNA-PKcs? Alternatively, are just lymphocytes from dogs and horses more dependent on DNA-PKcs than murine lymphocytes? In some situations, DNA-PKcs has been implicated as being crucial in preventing apoptosis (48) although in others it has been suggested to promote apoptosis (49). Also, it has been demonstrated previously that unrepaired recombination intermediates in the thymus of SCID mice results in p53 activation (23) which may facilitate apoptosis. Our data could be explained by an increased susceptibility to apoptosis of equine and canine prolymphocytes as compared with mouse prolymphocytes. If canine and equine SCID prolymphocytes undergo rapid apoptosis in response to unrepaired recombination intermediates, any potential leaky rearrangements might not be detected. Thus, the more stringent DNA-PKcs requirement we observe might not actually reflect a more stringent requirement for end joining per se, but instead reflect a lack of rescue from apoptosis or perhaps more rapid apoptosis in prolymphocytes. However, in our previous study, a severe deficit in signal end resolution was demonstrated in SCID horse fibroblasts using a transient recombination assay (21); this assay should be insensitive to apoptotic effects. Using the same assay in our laboratory, most SCID mouse fibroblasts support wild-type levels of signal end joining (29). This suggests that the more stringent requirement for DNA-PKcs in some species is important for DNA end joining, as opposed to rescue from apoptosis, and that this more stringent requirement may be consistent in all cell types. Finally, it has recently been demonstrated that the NHEJ pathway is important for the maintenance of genomic stability (50, 51). Whereas loss of either XRCC4 or DNA ligase IV in mouse embryonic fibroblasts results in a significant increase in various chromosomal aberrations, loss of DNA-PKcs has a clear although less dramatic effect (50). This difference in chromosomal stability in mice with mutations in distinct components of the NHEJ pathway is reminiscent of differences in the rate and fidelity of signal end joining in the same animals (52). It follows that DNA-PKcs deficiency in dogs and horses may result in more significant chromosomal instability than in mice. This question is currently under examination.
A second question is why are there species differences in absolute
DNA-PKcs requirements? The severity of the V(D)J recombination defects
in these three examples of genetic DNA-PKcs deficiency (this report;
Refs, 18, 25, 26, 27, 29) appears to inversely correlate
with two factors: life span and normal DNA-PK enzymatic activity. The
correlation between severity of V(D)J recombination defects in each of
the DNA-PKcs deficiencies and the relative DNA-PK activity expressed in
normal cells from the same species is illustrated in Fig. 5. As can be seen, there is a highly
significant correlation between relative DNA-PK activity and the log
depression in either signal or coding joint formation. Fig. 5 also
illustrates that DNA-PKcs deficiency in each of these species affects
signal end joining more severely than coding end joining.
|
Here, we show that horses (life span 28 years) and dogs (life span
14 years) express intermediate levels of DNA-PK activity as compared
with rodents and humans. Thus, these data extend this general
correlation between relative DNA-PK activity and natural life span.
This correlation might predict that loss of DNA-PKcs expression in
humans would result in the most severe phenotype. It is interesting
that three spontaneous DNA-PKcs germline mutations have now been
documented in animals whereas no germline mutations of DNA-PKcs have
been implicated in the numerous incidences of genetic combined
immunodeficiency disease in humans. This raises the question of whether
a germline DNA-PKcs deficiency in humans might be lethal.
It seems reasonable that animals that express very high levels of an enzymatic activity might have a more absolute requirement for that activity in vivo as compared with animals which express minimal levels of the activity. Thus, horse cells that express relatively high levels of DNA-PK have a more stringent requirement for DNA-PKcs than mouse cells. Perhaps expression of high DNA-PK levels reflects an evolutionary preference for NHEJ in some species over other end joining pathways. The question remains: are alternative end joining pathways less active in species which express abundant levels of DNA-PK? If so, perhaps the low expression of this alternative pathway explains the relative lack of "leakiness" in the V(D)J recombination deficits in SCID dogs and SCID horses.
In summary, here we describe the third example of genetic DNA-PKcs deficiency. As is the case with SCID mice and SCID foals, DNA-PKcs deficiency in dogs results in a block in V(D)J recombination and extreme radiosensitivity. The severity of the V(D)J recombination defects in these three examples of SCID are as follows: equine SCID > canine SCID > murine SCID. Finally, the severity of the V(D)J recombination deficits in these three species inversely correlates with differences in DNA-PK levels expressed normally.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Katheryn Meek, Department of Veterinary Pathology, Michigan State University, 350 Food Safety and Toxicology, East Lansing, MI 48824. E-mail address: kmeek{at}msu.edu
3 Abbreviations used in this paper: DNA-PK, DNA-dependent protein kinase; DNA-PKcs, DNA-PK catalytic subunit; NHEJ, nonhomologous DNA end joining; RAG, recombinase-activating gene; RSS, recombination signal sequence; PI3, phosphatidylinositol 3-kinase; ADA, adenosine deaminase; PNP, purine nucleoside phosphorylase; LMPCR, ligation-mediated PCR; SNP, single nucleotide polymorphism.
4 T. G. Bell, K. L. Butler, H. B. Sill, J. E. Stickle, J. A. Ramos-Vera, and M. J. Dark. Autosomal recessive severe combined immunodeficiency of Jack Russell terriers. Submitted for publication.
Received for publication December 26, 2000. Accepted for publication June 7, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
rearrangements substantiate a profound deficit in recombination signal sequence joining in SCID foals: implications for the role of DNA-dependent protein kinase in V(D)J recombination. J. Immunol. 164:1416.This article has been cited by other articles:
|
|
 |
|
  B. L. Ruis, K. R. Fattah, and E. A. Hendrickson The Catalytic Subunit of DNA-Dependent Protein Kinase Regulates Proliferation, Telomere Length, and Genomic Stability in Human Somatic Cells Mol. Cell. Biol., October 15, 2008; 28(20): 6182 - 6195. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yotsumoto, K. Saegusa, and Y. Aramaki Endosomal Translocation of CpG-Oligodeoxynucleotides Inhibits DNA-PKcs-Dependent IL-10 Production in Macrophages J. Immunol., January 15, 2008; 180(2): 809 - 816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Douglas, X. Cui, W. D. Block, Y. Yu, S. Gupta, Q. Ding, R. Ye, N. Morrice, S. P. Lees-Miller, and K. Meek The DNA-Dependent Protein Kinase Catalytic Subunit Is Phosphorylated In Vivo on Threonine 3950, a Highly Conserved Amino Acid in the Protein Kinase Domain Mol. Cell. Biol., March 1, 2007; 27(5): 1581 - 1591. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Seymour, J. P. Sundberg, and H. HogenEsch Abnormal lymphoid organ development in immunodeficient mutant mice. Vet. Pathol., July 1, 2006; 43(4): 401 - 423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Dip and H. Naegeli More than just strand breaks: the recognition of structural DNA discontinuities by DNA-dependent protein kinase catalytic subunit FASEB J, May 1, 2005; 19(7): 704 - 715. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Perryman Molecular Pathology of Severe Combined Immunodeficiency in Mice, Horses, and Dogs Vet. Pathol., March 1, 2004; 41(2): 95 - 100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Ding, Y. V. R. Reddy, W. Wang, T. Woods, P. Douglas, D. A. Ramsden, S. P. Lees-Miller, and K. Meek Autophosphorylation of the Catalytic Subunit of the DNA-Dependent Protein Kinase Is Required for Efficient End Processing during DNA Double-Strand Break Repair Mol. Cell. Biol., August 15, 2003; 23(16): 5836 - 5848. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Rooney, F. W. Alt, D. Lombard, S. Whitlow, M. Eckersdorff, J. Fleming, S. Fugmann, D. O. Ferguson, D. G. Schatz, and J. Sekiguchi Defective DNA Repair and Increased Genomic Instability in Artemis-deficient Murine Cells J. Exp. Med., March 3, 2003; 197(5): 553 - 565. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Woods, W. Wang, E. Convery, A. Errami, M. Z. Zdzienicka, and K. Meek A single amino acid substitution in DNA-PKcs explains the novel phenotype of the CHO mutant, XR-C2 Nucleic Acids Res., December 1, 2002; 30(23): 5120 - 5128. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or coding joints (
) and the relative DNA-PK
activity expressed in fibroblasts from normal individuals
(x-axis). Relative coding and signal joint formation for
SCID mice are taken from Refs.