|
|
||||||||





*
Surgery Branch,
Department of Transfusion Medicine, Clinical Center, and
Department of Cytopathology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The expression of TAA throughout the disease process has not been accurately documented. Most published studies compare different primary or metastatic lesions surgically removed from patients at different time points throughout the natural course of the disease or in response to therapy (2). With this approach, we and others have been able to demonstrate a decrease in TAA in some patients that appears to be specific to the Ag adopted for active immunization (3, 7, 13). In particular, Jager et al. could demonstrate an inverse relationship in TAA expression in melanoma metastases and CD8+ cytotoxic T cell responses that suggested immune selection of Ag-loss variants in vivo (13). The excision of tissue for correlative studies with clinical outcome presumes that metastases are representative of each other. However, even synchronous metastases can be quite heterogeneous (6, 14, 15), and the experimental noise created by such heterogeneity can most suitably be eliminated by studying the kinetics of expression of given genes within the same metastasis by the use of serial fine-needle aspirations (FNA) (2). We were impressed by a case in which serial FNA demonstrated that tumor recurrence in response to MDA-specific vaccination was associated with maintenance of the expression of CT and loss of expression of the MDA targeted by the vaccine (16, 17). Based on these considerations, we have recently proposed that tumor-host interactions could be best followed by serial gene expression analysis of identical lesions through time by repeated FNA (18).
Until recently, the serial analysis of identical tumor deposits by repeated FNA has been hampered by the limited amount of material obtainable, which allows analysis of the expression of only a few gene products. Furthermore, traditional use of this technique generally involved the assessment of expression by immunochemical methods using the few markers for which appropriate reagents were available. We have recently developed a method of high fidelity anti-sense RNA (aRNA) amplification that uses a combination of template switching and in vitro transcription (19). This method yields 1:10,0001:100,000 amplification of transcripts from conventional total RNA preparations that maintain gene expression profiles comparable to that of conventional poly(A) and total RNA based sources in cDNA microarrays.
Therefore, we tested whether aRNA could be used as a source material for accurate measurement of relative gene expression among different samples using quantitative real-time PCR (qRT-PCR). The aRNA was amplified from sequential FNA of 52 metastases from 30 patients with metastatic cutaneous melanoma. After amplification, aRNA was used as the template for qRT-PCR-based measurement of MDA and CT expression in a short-term (13 mo) follow-up period. This made it possible to study a larger number of genes compared with conventional methods. Furthermore, it was possible to study the expression of genes for which no serologic markers were available. The second goal of this study was to explore the change of expression of TAA during Ag-specific immunotherapy and to correlate the observed findings with therapy.
| Materials and Methods |
|---|
|
|
|---|
Patients who presented to the Surgery Branch of the National Cancer Institute of the National Institutes of Health (Bethesda, MD) for treatment of metastatic malignant melanoma were enrolled in treatment protocols after signing an informed consent. Upon identification of suitable candidates, metastatic melanoma masses were biopsied with a 23-gauge needle coupled to a 10-cc syringe. To ensure that the FNA was representative of the whole lesion, aspirations were obtained from four quadrants and pooled in a 15-ml Falcon tube (Sarstedt, Newton, NC) containing refrigerated RPMI 1640 medium (Biofluids, Rockville, MD). Sequential FNA of the same metastatic tumor site were performed. Part of the FNA material was forwarded to cytopathology for confirmation of the diagnosis of melanoma. Only specimens containing at least 100 cancer cells per cytospin preparation were collected further and used for this study. These specimens were also assessed for the quantity of expression of gp100/Pmel-17 and MART-1/MelanA by immunochemical methods. The remainder of the aspirate was placed in RNA lysis buffer (Qiagen, Santa Clarita, CA) and stored at -180°C until ready for processing.
RNA isolation, cDNA synthesis, and aRNA preparation
RNA isolation, RNA amplification, and cDNA transcription from the aspirate material were performed in batches containing patients pre- and posttherapy samples to minimize variability. RNA isolation was performed with RNeasy mini kits (Qiagen). RNA concentrations were determined by OD260 reading in 50 mM sodium hydroxide (GeneQuant, Clamart, France). The aRNA was prepared from total RNA in 9 µl diethyl pyrocarbonate (DEPC)-treated H2O containing 1 µg/µl oligo(dT) (15)-T7 primer (5'-AAA CGA CGG CCA GTG AAT TGT AAT ACG ACT CAC TAT AGG CGC-3'). Total RNA was denatured at 70°C for 3 min and primed while cooling to room temperature. T7 bacteriophage promoter was incorporated into cDNA synthesis in a reverse transcription reaction by adding 4 µl of first-strand reaction buffer, 2 µl 0.1 M DTT (Life Technologies, Rockville, MD), 2 µl 10 mM dNTP, 1 µl RNsin (Promega, Madison, WI), 1 µg/µl template switch primer (5'-AAG CAG TGG TAT CAA CGC AGA GTA CGC GGG-3'; Clontech Laboratories, Palo Alto, CA), and 2 µl SuperScript II reverse transcriptase (Life Technologies). The cDNA synthesis was completed at 42°C for 1 h. Full-length double-stranded cDNA was synthesized by adding 106 µl of DNase-free water, 15 µl Advantage PCR buffer (Clontech Laboratories), 3 µl 10 mM dNTP, 1 µl RNase-H (Promega), and 3 µl Advantage cDNA polymerase (Clonetech Laboratories). The following temperature cycle was used: 2 min at 37°C for RNA digestion, 3 min at 94°C for denaturation, 3 min at 65°C for priming, and 30 min at 75°C for extension. Reactions were terminated by incubation in 7.5 µl 1 M NaOH with 2 mM EDTA at 65°C for 10 min. The cDNA was phenol-chloroform-isoamyl extracted and ethanol precipitated in the presence of 0.1 µg/µl linear acrylamide (Ambion, Austin, TX). The cDNA, resuspended in 16 µl DEPC H2O, was passed through a Bio-6 chromatography column (Bio-Rad, Cambridge, MA) and washed three times with 700 µl DEPC-treated H2O. Samples were lyophilized to 16 µl. For the second round of amplification, 16 µl of purified full-length double-stranded cDNA was incubated with 4 µl of each 75 mM NTP (ATP, GTP, CTP, and UTP), 4 µl 10x reaction buffer, and 4 µl transcription enzyme mixture (MEGAscript T7 kit number 1334; Ambion) in 40 µl vol at 37°C for 5 h. RNA recovery and removal of template DNA was achieved by TRIzol purification (Life Technologies). The aRNA was prepared using 1 µg or less of one-amplification aRNA prepared from source total RNA that was reverse transcribed into cDNA using 2 µg random hexamer with 5 µl first-strand buffer, 2 µl 0.1 M DTT, 1 µl RNAsin, 2 µl of 10 mM dNTP, and 2 µl of SuperScript II. The reaction mixture was heated to 65°C for 10 min before adding SuperScriptII, and then synthesis was continued at 42°C for 1 h. Second-strand cDNA synthesis was initiated by 1 µg oligo(dT) T7 primer in the conditions used in the first round. In vitro transcription of aRNA was conducted as for the first round. Reverse transcription reaction from T RNA and aRNA was accomplished by adding 2 µg random hexamer, 4 µl first strand-reaction buffer, 2 µl 0.1 M DTT (Life Technologies), 2 µl 10 mM dNTP, and 2 µl SuperScript-II reverse transcriptase (Life Technologies). The cDNA synthesis was completed at 42°C for 1 h, and cDNA was stored at -30°C until ready for qRT-PCR analysis.
qRT-PCR anlaysis
Measurement of gene expression was performed using the ABI Prism
7700 sequence detection system (PerkinElmer, Foster City, CA) as
previously described (20, 21). Primers and TaqMan probes
(Custom Oligonucleotide Factory, Foster City, CA) were designed to span
exon-intron junctions to prevent amplification of genomic DNA and to
result in amplicons <150 bp to enhance efficiency of PCR
amplification. Only the primers and probes for MAGE-3 and MAGE-12 did
not span exon-intron junctions due to the extreme 5' position of these
boundaries in these genes; alternatively, these primers and probes were
designed to incorporate areas of the known antigenic regions of these
genes. Genomic DNA amplification was further reduced by using aRNA,
which selectively amplifies mRNA, in addition to multiple aRNA
purification steps. TaqMan probes were labeled at the 5' end with the
reporter dye molecule 6-carboxy-fluorescein (FAM; emission
max = 518 nm) and at the 3' end with the
quencher dye molecule 6-carboxytetramethyl-rhodamine (TAMRA; emission
max = 582 nm). The cDNA standards were
generated by reverse-transcriptase primer-specific amplification of
mRNA of the relevant genes using a technique identical with the one
used for the preparation of test cDNA. The resulting cDNA was then
purified and quantified by spectrophotometry
(OD260). Copies were calculated using the m.w. of
individual gene amplicons. RT-PCR of cDNA specimens and cDNA standards
were conducted in a total volume of 25 µl with 1x TaqMan Master Mix
(PerkinElmer) and primers and probes at optimized concentrations. We
have previously presented the sequences of the primer probe pairs for
gp100 (22),
-actin (22), MAGE-12
(17), tyrosine-related protein (TRP)2, MAGE-3, and
MART-1/MelanA (23). The sequences for the other genes are:
Fas-associated death domain-like IL-1-converting enzyme-like inhibitory
protein (FLIP), FAM-TCAAACGTATCTTGAAGATGGACAGAAAAGCTG-TAMRA,
AGAGTGAGGCGATTTGACCTG, and AAGGTGAGGGTTCCTGAGCA; and TRP-1,
FAM-TGATGAATGGCTGAGGAGATACAATGCTGATATA-TAMRA,
TCCTGCACACCTTCACAGATG, and TGGCACCATGTTGTATTGTCTATTATG. Thermal
cycler parameters included 2 min at 50°C, 10 min at 95°C, 40 cycles
involving denaturation at 95°C for 15 s, and annealing/extension
at 60°C for 1 min. Real-time monitoring of fluorescent emission from
cleavage of sequence-specific probes by the nuclease activity of
Taq polymerase allowed definition of the threshold cycle
during the exponential phase of amplification (20).
Standard curves were generated for each gene and found to have
excellent PCR amplification efficiency (90100% with 100% meaning
that, in each cycle, the amount of template is doubled) as determined
by the slope of the standard curves. Linear regression analysis of all
standard curves was
0.99. Standard curve extrapolation of copy
number was performed for the gene of interest as well as an endogenous
reference gene for each sample. To correct for cellularity and
concentration of starting material, normalization of samples was
performed by dividing the copies of the gene of interest by copies of
the reference gene.
Immunohistochemistry (IHC)
Immunocytochemistry was performed on cytospins and frozen sections by standard methods (24). Without exception, multiple cytospins could be obtained from each FNA, and comparisons of expression of MDA within each lesion were determined from cytospins prepared from the same aspiration. Cytospins and frozen sections were fixed in acetone for 10 min, then rinsed in PBS and blocked in 35% goat serum in PBS for 20 min. The following primary mAbs were used: HMB-45 for assessment of gp100/Pmel-17 expression (Biogenex, San Ramon, CA), M2-7C10 for the assessment of MART-1/MelanA expression (6, 25), and KS-1 for the assessment of HLA-A2 Ag expression (26). Primary Ab was applied for 2 h at room temperature. After washing, the slides were incubated with goat anti-mouse IgG secondary Ab followed by avidin-biotin-peroxidase complex (Vector Laboratories, Burlingame, CA). For color development, 3,3'-diaminobenzidine solution (Sigma, St. Louis, MO) was applied for 6 min at room temperature. For tumor samples that were heavily pigmented, 3-amino-9-ethylcarbazole, which stains red, was used for color development to provide better contrast. The slides were rinsed in H20, counterstained with hematoxylin, and cover-slipped. All specimens were processed and stained by the same researcher (P. Fetsch) and read in a blinded fashion by two pathologists (A. Fillie and A. Abati).
The level of TAA and/or HLA Ag expression within a tumor population was measured by two criteria: 1) the percentage of tumor cells within a tumor population that were positive for the relevant Ag and grouped as negative, < 25%, 2550%, 5075%, and > 75%; and 2) the intensity of tissue staining scored from 0 to 4+, with 0 being equivalent to a negative control using nonspecific myeloma-associated protein for background staining and 4+ staining equivalent to the relevant mAb of a control positive cell line. For this analysis, all the malignant cells included in a cytospin were counted. The number of cells present in each cytospin varied; however, at least 100 cells were present and evaluated in each sample. The IHC score (sIHC) consisted of the prevalence of cells expressing a given Ag (percentage) multiplied by the overall intensity of expression for each specimen using the methods described above.
In vitro sensitization assay
Parallel in vitro sensitization of cryopreserved pre- and
postvaccination PBMC was performed as previously described (27, 28). Briefly, PBMC were thawed into complete medium consisting
of Iscoves modified DMEM with 25 mM HEPES buffer (Biofluids), 10%
heat-inactivated human AB serum (Pel-Freez Biologicals, Brown Deer,
WI), and 100 µg/ml of streptomycin (Sigma). Cells were resuspended at
1.5 x 106 cells/ml in 2 ml containing 1
µM sensitizing peptide. After 12 days, 300 IU/ml rIL-2 (Chiron,
Emeryville, CA) was added to the culture. On day 5 and/or when cultures
became acidic, complete medium (1 ml) was withdrawn and replaced with
fresh complete medium containing IL-2. After 1013 days from the
original stimulation, PBMC were tested by 24-h coculture with T2 cells
pulsed with 1 µM peptide. Supernatants were tested for IFN-
concentration by ELISA (Endogen, Cambridge, MA).
Statistical analysis
To emphasize the central tendency of the variables presented independently of the nonsymmetric nature of expected changes in TAA expression with time, data are reported nonparametrically using median values. However, statistical values obtained with nonparametric vs parametric methods were similar. Wilcoxon signed rank test and Students t test for paired samples were used to compare values derived from pre- and posttreatment FNA samples. Correlation between values obtained with different source materials or between various methods of assessment of gene expression was performed using the Spearman correlation test. Regression analysis was used for parametric assessment of linearity of the relationship between two parameters.
| Results |
|---|
|
|
|---|
The efficiency of aRNA amplification was tested from limiting
dilutions of source total RNA prepared from a melanoma cell line (A375;
Table I
). An
102- to 103-fold higher
amount of aRNA from source mRNA (
1% of total RNA) was obtained with
one round of amplification. With a second amplification, an additional
10- to 100-fold increase in aRNA was obtained. Because of the very low
amounts of starting total RNA yielded by some FNA, it was decided to
apply two rounds of amplification to all specimens used in this study.
This strategy minimizes differences secondary to possible aRNA
amplification bias and provides consistency among different
specimens.
|
-actin transcripts in 21 FNA samples chosen at random. The location
of primers and probes used for qRT-PCR is shown in Fig. 1
-actin and vice versa. Because
-actin was used
as the denominator for all the data reported, we first addressed the
raw estimates of abundance of this transcript in amplified vs
nonamplified material. Raw estimates of
-actin expression based on
aRNA vs total RNA templates were highly correlated
(p < 0.0001) and highly balanced with mean and
median values of estimated transcripts within the same
log10. For gp100 and MART-1, comparative
estimates of
-actin-adjusted gene expression using aRNA or total RNA
as source material were very similar. In both cases, the trend equation
expressed as a power-based regression formula approximated a perfect
correlation (y =
kx1.0). However, it was noted that
aRNA-based qRT-PCR underestimated the
-actin-corrected values for
MAGE-3 and MAGE-12 compared with total RNA-based values (Fig. 2
|
|
Gene expression was compared with expression of the respective
protein product according to IHC for gp100/Pmel-17 and MART-1/MelanA,
for which reliable mAbs were available to us. TAA transcript levels
adjusted to
-actin levels were compared in pairs to the sIHC of
expression by the same lesion. In this fashion, the estimated overall
amount of protein in a given specimen was correlated with the overall
amount of transcript estimated to be present in the same specimen
independently from the level of expression in individual cells and the
frequency of cell subpopulations in each specimen. gp100 aRNA
expression was compared with sIHC in 149 consecutive FNA from melanoma
metastases (Fig. 2
B, insert). Nonparametric
ranking of the two data sets suggested a tight link between them
(Spearmans
= 0.5, p < 0.0001), but there
was not a linear correlation because aRNA values reached a plateau in
association with sIHC >50. However, if FNA samples with sIHC values
50 were tested, a strong linear correlation was noted (Fig. 2
B; Spearmans
= 0.7, p < 0.0001;
and R2 = 0.5, p value < 0.001).
This suggests that aRNA-based RT-PCR yields informative data at low
levels of protein expression but is not quantitatively informative
above this threshold. This limitation was not intrinsic to the aRNA
amplification method because a nearly identical pattern was noted when
total RNA was used as template for qRT-PCR (data not shown). Thus, in
samples with high transcript abundance, TaqMan-based qRT-PCR may have a
limited ability to discriminate variations in levels of gene
expression. Because the purpose of the study was to evaluate the
kinetics of TAA expression throughout the natural history of melanoma
or in response to immunological treatment, this model fit the
requirements for such analysis. Comparative analysis of MART-1/MelanA
expression using aRNA vs sIHC yielded comparable results (data not
shown). Furthermore, tumor cells in metastases from HLA-A*0201
Ag-expressing patients who received vaccination with a TAA including a
T cell epitope associated with HLA-A2 presentation were tested for
HLA-A2 Ag expression. Loss of HLA-A2 Ag was not detected in any case.
These findings excluded, in this cohort of patients, loss of the HLA
class I allele associated with the vaccine epitope as a factor
affecting the interpretation of the results.
Heterogeneity of tumors
Analysis of 116 synchronous metastases from 58 simultaneous FNA biopsies in 58 patients was then performed to evaluate the heterogeneity of expression of various MDA and CT at a given time point. The expression of all TAA appeared to be heterogeneous in a large percentage of synchronous lesions. If 1 log10 difference in expression was considered significant, all TAA were heterogeneously expressed in 4050% of the lesions with the exception of MART-1/MelanA, which was heterogeneously expressed in only 28% of them. If a more stringent parameter was used to define differences of expression, more variability in the pattern of expression of various TAA was noted. For instance, if differences of at least 3 log10 were considered, then heterogeneity was identified in 16, 14, 12, 10, 10, and 9% of lesions for MAGE-3, MAGE-12, gp100/Pmel-17, TRP-1, MART-1/MelanA, and TRP-2, respectively.
Short-term changes in expression of MDA and CT in melanoma metastases
The expression of gp100/Pmel-17, MART-1/MelanA, TRP-1 and TRP-2,
and MAGE-3 and MAGE-12 was assessed in 49 metastases from 28 patients
who were undergoing different immunological treatments (Tables II
and III
). Three additional lesions from two
patients regressed during treatment so rapidly (4256 days) that no
tumors suitable for biopsy were observed when the patients returned for
follow-up. Therefore, 31% (16 of 52) of the lesions exhibited a
complete regression, and 40% of the patients (12 of 30) followed
prospectively had at least one lesion that regressed. This is a
proportion of responses comparable to historical results, suggesting
that repeated FNA does not substantially affect the ability of tumor
masses to respond to immunologic manipulation. (We should emphasize
that these rates refer to individual lesions and should not be confused
with clinical response rates, in which the overall clinical outcome is
accounted). FNA were obtained before treatment and during treatment in
an interval ranging from 14 mo from the initiation of treatment. At
the initial time point, the various TAA were expressed with the
following frequencies: 85, 85, 67, 63, 90, and 76% for
gp100/Pmel-17, MART-1/MelanA, TRP-1, TRP-2, MAGE-3, and MAGE-12,
respectively. Neither the frequency nor their level of expression
predicted response of a given lesion to treatment. We then analyzed
changes with time in TAA expression in all lesions independently of
treatment received. Fig. 3
A
(left panel) shows the kinetics of expression of the
TAA studied. We noted a significant decrease in expression of
gp100/Pmel-17 (Wilcoxon singed rank test,
p2 < 0.0; Students t
test, p < 0.05) and no significant change in any of
the other TAA studied. Of the metastases followed by this study, 42
were from patients who had received a gp100/Pmel-17-specific vaccine
(Table III
). Thirty-six lesions were in patients who had received
repeated s.c. administrations of a peptide modified from the natural
gp100209217 epitope by substituting a
methionine for a tyrosine in position 210 to induce stronger
immunogenicity in vitro and in vivo (28). The
remaining six lesions were from patients who received the s.c.
administration of an HLA-A*0301-restricted gp100 epitope (ALLAVGATK;
Ref. 33) or intramuscular administration of a pox-virus
encoding the full-length gp100/Pmel-17 protein. Therefore, we
stratified the data according to treatment and noted that the
significant decrease in gp100/Pmel-17 gene expression could be noted in
particular in patients who had been vaccinated against this TAA
(Wilcoxon singed rank test, p < 0.05; Fig. 3
A, right panel). No significant change in
gp100/Pmel-17 expression was noted in lesions from patients not
immunized against this TAA. However, because only 8 lesions were
included in this subgroup, the power of the analysis is not sufficient
to allow definitive conclusions.
|
|
|
We then analyzed the kinetics of TAA expression in lesions
stratified according to their clinical behavior. A total of 16 lesions
from 12 patients underwent complete regression in response to
treatment. The median interval between initiation of treatment (and
harvest of the pretreatment FNA) and documentation of lesion
disappearance was 118 days with a range spanning between 42 and 243
days (Fig. 4
). Three lesions from two
patients disappeared so quickly that no posttreatment FNA could be
performed. A total of 13 lesions from 10 patients that underwent a
complete regression in response to treatment could be serially sampled
during treatment, and of those, changes in TAA expression were
documented. FNA biopsies were usually obtained at 6-wk intervals. These
intervals sometimes varied in response to the clinical needs of the
patient and the healthcare team. The median time for posttreatment FNA
harvest in responding lesions was 70 days with a range spanning between
21 and 116 days from the beginning of treatment. Similar time points
were compared for nonresponding lesions whose FNA were obtained within
a median interval from initiation of treatment of 71 days (range of
25140 days).
|
|
|
| Discussion |
|---|
|
|
|---|
Probes and primers to be used for measurement of gene expression by quantitative PCR were selected, when possible, according to the following criteria: specificity and uniqueness for the given gene, intron-spanning range, and linkage to epitopic sequences. These criteria could be fully satisfied for some of the genes but not others. For instance, primers and probes for gp100/Pmel-17 and MART-1/MelanA shared little homology with any other known genes, were intron spanning, and were relatively close to described epitopic sequences. In contrast, MAGE-3 primer and probes shared 9095% homology with other MAGE genes (particularly MAGE-6), although they were epitope spanning. Because epitopic sequences in the MAGE genes appear to be clustered in the central region of exon 3 (30), it was impossible to design intron-spanning primer/probe pairs including immunologically relevant regions. As a consequence, the MAGE-12 primer/probe pair was also not intron-spanning, although it did not share homology with other MAGE genes and spanned a recently described HLA-Cw*0702-associated epitope (17, 33). Primer/probe pairs for other genes such as TRP-1 and TRP-2 were designed to be intron spanning and without homology with other known genes; however, their linkage with epitopic sequences was low. The concern that selection of non-intron-spanning primer/probes for the MAGE genes might affect qRT-PCR measurements because of genomic contamination is excluded by the aRNA amplification strategy that is highly specific for mRNA. Finally, a criterion not sought in this study was the preferential selection of 5'-located primer and probes. This criterion was not adopted because the method applied here limits the measurement of gene expression to full-length transcripts insensitive to the location of the primer/probe set by exploiting the template-switching effect at the 5' end (19). Although transcript size bias could be introduced by this method, previous work with cDNA microarrays does not support this concern (19).
The information obtained in this study suggests that, given an effective treatment, immune selection can rapidly occur in some of the target tissues, although some lesions regressed without evidence of selection, and some lesions that exhibited decrease in Ag expression did not regress. Because most patients had been actively immunized against gp100/Pmel-17 throughout the duration of this study, it is likely that the preferential loss of expression of the same TAA in responding lesions is more than coincidental. Interestingly, loss of gp100/Pmel-17 did not interfere with regression of the metastases. This suggests that the interaction between gp100/Pmel-17-specific T cells and their targets could represent only an initiating event toward tumor regression. More importantly, in the group of lesions that did not respond to therapy, overall, gp100/Pmel-17 did not decrease significantly (although few exceptions were noted), suggesting that loss of target TAA expression is not in itself the primary reason for failure of these treatment protocols. This result is not a complete surprise, as we have already noted that, in a small cohort of patients receiving TAA-specific vaccination, evidence of vaccine-elicited T cell reactivity could be detected in tumors expressing target TAA. However, the dialogue initiated between tumor cells and vaccine-elicited T cells was not sufficient per se to induce clinical regression (22, 34). The possibility that lack of clinical response is due predominantly to insufficient inflammatory response at the tumor site rather than tumor cell escape from a vigorous Ag-specific CTL response is also supported by a recently concluded study.3 In this study, comparison of molecular phenotypes in pre- vs posttreatment FNA samples of lesions that responded compared with those that did not respond identified significantly different gene expression patterns in posttreatment samples from responding lesions and no significant changes among nonresponding lesions.
These findings do not exclude that immune selection may lead to immune escape later on in the long-term natural history of cancer, as previously shown by others (3, 13). Loss of TAA or HLA Ags might play a later role in the metastatic process by allowing TAA-deprived cells that have survived the short-term effects of treatment to grow undisturbed and reconstitute new lesions (16). However, this phenomenon can be documented only with a longer-term analysis that was beyond the purposes of this study.
No correlation was noted between evidence of systemic sensitization
against gp100 and regression of metastatic lesions or loss of gp100
expression. This phenomenon has been previously described
(28) and suggests that factors other than the presence of
circulating immune cells play a role in the localization and effector
function of vaccine-elicited T cells at the tumor site. For consistency
with previous reports from our group (28), the monitoring
data reported was obtained by a comparative single in vitro
sensitization of pre- and postvaccination PBMC. We have previously
shown that this method yields comparable results to other methods
directly assessing precursor T cells number and function, such as
enumeration with tetrameric HLA/epitope complexes or evidence of
specific IFN-
expression by intracellular cytokine staining and/or
qRT-PCR assessment (35, 36). However, these studies have
shown a strong correlation of results obtained with in vitro
sensitization that maintains the highest sensitivity in the detection
of vaccine-responsive cells. These data emphasize the necessity of
studying tumor host interactions where they are more likely to occur
within the tumor microenvironment as we have recently emphasized
(18, 22).
Difficult to explain is the decreased expression of the other MDA noted in responding lesions in some patients. Theoretically, immune selection operates by destroying cells bearing a specific target Ag and should be insensitive to the expression of irrelevant Ags. However, the mechanism(s) responsible for the reduced expression of gp100/Pmel-17 may be common to other MDA. In addition, we cannot exclude that the patients may have developed an immune response to the other MDA whose expression was found to be reduced. Therefore, broader effects of systemic IL-2 administration or epitope spreading in the tumor microenvironment might have been at the basis of the extended loss of MDA (37, 38). However, this explanation would leave unanswered the question of why epitope spreading would preferentially affect MDA compared with CT, whose expression was not affected in responding lesions.
In lesions responding to therapy, a statistically significant reduction in expression of three MDA was noted (gp100/Pmel-17, MART-1/MelanA, and TRP-2) with no simultaneous reduction in CT. This loss of MDA expression was not always directly related to the specificity of the vaccine because most patients had been vaccinated against gp100/Pmel-17 in combination with IL-2 and not against the other two MDA. Thus, it could be hypothesized that, in response to the inflammatory insult provided either by the specific or the nonspecific immune stimulation, cells more sensitive to death signals might have cleared more rapidly. Alizadeh et al. (39) have recently noted over-expression of genes whose products inhibit programmed cell death in B cell lymphomas most resistant to conventional treatment. For instance, they identified FLIP as an antiapoptosis factor that has been associated with poor prognosis and responsiveness to treatment of large cell lymphomas (39). It is possible that more anaplastic cells might resist immune-related insult in the melanoma model as well, and in this case, MDA and CT would represent only bipolar markers of the level of differentiation of various cell populations within a metastasis. However, decreased expression of gp100/Pmel-17 was highly specific, and FLIP expression was no significantly different between pretreatment lesions that did or did not regress with treatment (data not shown). Finally, it is possible that the decreased expression of MDA transcript observed in this study could have been related to a decreased number of cancer cells in the posttreatment specimens. However, the unchanged expression of CT Ags expressed only by cancer cells and not normal cells (40) suggests that this is not a likely explanation.
Whatever the explanation for the decreased expression of MDA in some responding lesions, this study provides the surprising demonstration that, before a tumor metastasis disappears, a profound change in expression of target TAA can occur, whether immunologically mediated or not. Yet this loss of epitopic determinants does not seem to affect the final outcome, perhaps because of epitope spreading secondary to the primary insults specific to the vaccine or in relation to a more generalized anti-neoplastic effect of the systemic administration of IL-2. Also, interestingly, minimal and insignificant changes in TAA expression (particularly those targeted by the vaccination) were observed in lesions that did not respond to treatment suggesting that, at least in this human model, this is not the primary reason for the lack of effectiveness of these treatments. Perhaps lack of effective immunization against the target epitopes is the culprit in these cases, or the loss or lack of a secondary inflammatory signal within these nonresponding lesions (41). In addition, we cannot totally exclude that changes in MDA expression might have no effect on the recognition of melanoma cells by CTL. Finally, although addressed in a more controlled system based on sequential biopsies of the same lesion before and after treatment, the studies of this paper are not, per se, totally surprising. Still, the major question of the mechanism(s) directly involved in tumor regression remains unanswered, and such question warrants continued investigation in this vein.
| Footnotes |
|---|
2 Abbreviations used in this paper: TAA, tumor-associated Ag; MDA, melanoma differentiation Ag; aRNA, anti-sense RNA; IHC, immunohistochemistry; FNA, fine needle aspiration biopsy, MDA, melanoma differentiation Ag; qRT-PCR, quantitative real-time PCR; sIHC, immunohistochemistry score; CT, cancer testis; DEPC, diethyl pyrocarbonate; FAM, 6-carboxy-fluorescein; TAMRA, 6-carboxytetramethyl-rhodamine; FLIP. Fas-associated death domain-like IL-1-converting enzyme-like inhibitory protein; TRP, tyrosine-related protein. ![]()
3 E. Wang et al. Submitted for publication. ![]()
4 E. Wang et al. Submitted for publication. ![]()
Received for publication March 13, 2001. Accepted for publication May 29, 2001.
| References |
|---|
|
|
|---|
and IL-2. J. Immunother. 19:375.[Medline]
This article has been cited by other articles:
![]() |
M. Sensi and A. Anichini Unique Tumor Antigens: Evidence for Immune Control of Genome Integrity and Immunogenic Targets for T Cell-Mediated Patient-Specific Immunotherapy Clin. Cancer Res., September 1, 2006; 12(17): 5023 - 5032. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Basil, Y. Zhao, K. Zavaglia, P. Jin, M. C. Panelli, S. Voiculescu, S. Mandruzzato, H. M. Lee, B. Seliger, R. S. Freedman, et al. Common cancer biomarkers. Cancer Res., March 15, 2006; 66(6): 2953 - 2961. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Valasek and J. J. Repa The power of real-time PCR Advan Physiol Educ, September 1, 2005; 29(3): 151 - 159. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Avogadri, C. Martinoli, L. Petrovska, C. Chiodoni, P. Transidico, V. Bronte, R. Longhi, M. P. Colombo, G. Dougan, and M. Rescigno Cancer Immunotherapy Based on Killing of Salmonella-Infected Tumor Cells Cancer Res., May 1, 2005; 65(9): 3920 - 3927. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Wheeler, A. Das, G. Liu, J. S. Yu, and K. L. Black Clinical Responsiveness of Glioblastoma Multiforme to Chemotherapy after Vaccination Clin. Cancer Res., August 15, 2004; 10(16): 5316 - 5326. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Parmiani, C. Castelli, P. Dalerba, R. Mortarini, L. Rivoltini, F. M. Marincola, and A. Anichini Cancer Immunotherapy With Peptide-Based Vaccines: What Have We Achieved? Where Are We Going? J Natl Cancer Inst, June 5, 2002; 94(11): 805 - 818. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |