The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosati, M.
Right arrow Articles by Pavlakis, G. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosati, M.
Right arrow Articles by Pavlakis, G. N.
The Journal of Immunology, 2001, 167: 1654-1662.
Copyright © 2001 by The American Association of Immunologists

CCAAT-Enhancer-Binding Protein {beta} (C/EBP{beta}) Activates CCR5 Promoter: Increased C/EBP{beta} and CCR5 in T Lymphocytes from HIV-1-Infected Individuals

Margherita Rosati, Antonio Valentin, Daniel J. Patenaude and George N. Pavlakis1

Human Retrovirus Section, Basic Research Laboratory, National Cancer Institute- Frederick, Frederick, MD 21702


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
C/EBP{beta} is a member of a family of leucine zipper transcription factors that are involved in regulating the expression of several cytokines, including IL-1, IL-6, IL-8, TNF, and macrophage-inflammatory protein-1{alpha}. We identified multiple C/EBP{beta} binding sites within the gene for CCR5, suggesting that C/EBP{beta} may be involved in its regulation. Transient transfection experiments in both myeloid and lymphoid cells showed an increase in CCR5 promoter-driven green fluorescent protein production in the presence of C/EBP{beta}. Deletion analysis identified two C/EBP{beta}-responsive regions in the CCR5 gene, one in the promoter region and one at the 3' part of the intron. We provide evidence that, in myeloid cells (U937), C/EBP{beta} independently activates CCR5 expression through sites located either in the promoter region or in the intron of the CCR5 gene. In contrast, in lymphoid cells (Jurkat) the presence of the intronic cis-regulatory regions is required for C/EBP{beta}-mediated activation. In agreement with the functional data, EMSA demonstrated that in both myeloid and lymphoid cells C/EBP{beta} binds specifically to sites present in the intron, whereas interaction with the sites located in the promoter was cell type specific and was detected only in myeloid cells. Analysis of C/EBP{beta} in primary PBMCs obtained from HIV-1-infected individuals revealed a significant increase in C/EBP{beta} expression. The enhanced C/EBP{beta} activity correlated with a higher frequency of circulating CCR5+ lymphocytes in AIDS patients and with a decline in CD4 lymphocyte numbers. Taken together, these results suggest that C/EBP{beta} is an important regulator of CCR5 expression and may play a relevant role in the pathogenesis of HIV disease.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Human CCR5, a receptor for the CC chemokines macrophage-inflammatory protein (MIP)2-1{alpha}, MIP-1{beta}, and RANTES, also serves as the coreceptor for the entry into target cells of most HIV-1 primary isolates (1, 2, 3, 4, 5). CCR5 is mainly expressed on a subset of T lymphocytes and cells of the mononuclear phagocyte lineage (6, 7).

The importance of CCR5 in HIV-1 infection and disease progression was clearly established with the finding that some HIV-1-exposed but uninfected individuals harbor a 32-bp deletion in the coding region of the CCR5 gene. This deletion leads to a frameshift and a premature termination of the protein (8, 9) resulting in lack of CCR5 cell surface expression. Individuals homozygous for the {Delta}32 mutation are resistant to infection with most HIV-1 clinical isolates (8, 10), whereas HIV-1-infected individuals heterozygous for the CCR5 mutation had a slower progression to AIDS (10, 11, 12). Additional studies established that genetic polymorphism in the promoter region of the CCR5 gene reduces gene expression and influence progression to AIDS (13, 14, 15).

The CCR5 gene consists of two exons separated by a 1.9-kb intronic sequence (16). The existence of additional transcripts from upstream promoter(s) and another intronic sequence located upstream of exon 1 has been described (17, 18). The CCR5 promoter is located immediately upstream of exon 1; this region is characterized by the presence of functional binding sites for regulators of transcription such as OCT1, OCT2, T cell-specific factor-1a, GATA-binding protein (GATA), AP1, and p65(Rel) (17, 19, 20). CCR5 expression is influenced by many different factors including {beta}-chemokines, LPS, CD3/CD28 cross-linking, and ILs such as IL-2, IL-4, and IL-10 (21, 22, 23, 24, 25). Due to the importance of CCR5 in the regulation of leukocyte trafficking and its role as the main coreceptor for HIV-1 entry, the understanding of CCR5 regulation at the molecular level is of special relevance for the prevention of HIV-1 transmission.

C/EBPs are a family of transcription factors characterized by a basic DNA-binding domain linked to a basic leucine zipper dimerization motif. The C/EBP family includes transcription activators C/EBP{alpha}, C/EBP{beta}, and C/EBP-related protein 1, and negative regulators such as C/EBP{gamma}, liver-enriched transcriptional inhibitory protein (LIP), and C/EBP-homologous protein 10 (CHOP-10) (26, 27). Due to the homology in their basic leucine zipper domains, all the members of the family can form heterodimers with each other (27). C/EBP{beta}, also called NF-IL6, NF-M, liver activator protein, IL-6-D-element binding protein/EBP, and C/EBP-related protein 2, is expressed at low levels in normal tissues, but is significantly up-regulated by inflammatory stimuli such as bacterial LPS and cytokines such as IL-6 and IL-1 (28).

C/EBP{beta} is an intronless gene producing several isoforms with either activating or inhibitory function via a leaky ribosome scanning mechanism (29). LIP, an N-terminally truncated form of C/EBP{beta}, lacks most of the transactivation domain and is a dominant negative inhibitor of C/EBP-mediated transcription of the target gene (29). C/EBP{beta} functional responsive elements have been identified in the promoter region of a large number of genes expressed in myeloid and lymphoid cells, including IL-1{beta}, IL-4, IL-6, IL-8, MIP-1{alpha}, TNF-{alpha}, and CD14 (30, 31, 32, 33, 34, 35, 36). In addition, expression of CCR2, a gene closely related to CCR5, is strongly dependent on the presence of intact C/EBP sites in the promoter of the gene (37). Cell type-specific gene regulation by C/EBP{beta} has been shown to depend on interactions with other transcription factors, such as NF-{kappa}B, PU.1, and glucocorticoid receptors (38, 39, 40). An important role for C/EBP{beta} in the regulation of immune responses has been established through the study of knockout mice. C/EBP{beta}-deficient mice display abnormalities in humoral, innate, and cellular immunity, and are highly susceptible to infection with Candida albicans, Listeria monocytogenes, and Salmonella typhi (41, 42). Low IL-12 levels and depressed delayed-type hypersensitivity, consistent with an impaired Th1 immune response, are seen in these mice. Elevated IL-6 levels in C/EBP{beta}-deficient mice coincide with splenomegaly, peripheral lymphadenopathy, plasmacytosis, and extramedullary hemopoiesis, as seen also in Castleman’s disease in humans (42).

Several studies have shown that C/EBP{beta} plays an important role in the control of HIV-1 LTR transcriptional activity (43, 44). Of particular relevance is the finding that C/EBP{beta} is required for efficient replication of HIV-1 in macrophages but not in CD4+ T cells (45).

We have identified several functional C/EBP{beta} responsive elements located in the promoter region and in the intron of CCR5, suggesting that C/EBP{beta} is involved in the regulation of CCR5 expression. Cotransfection experiments showed that C/EBP{beta} activates CCR5 expression in both myeloid and lymphoid cells. In myeloid cells, CCR5 activation by C/EBP{beta} takes place independently of the presence of the intron. In contrast, in lymphoid cells the intron is essential for the activation of CCR5 gene expression by C/EBP{beta}. We further demonstrated, by using EMSA, that C/EBP{beta} and LIP bind to the C/EBP{beta} sites located in the promoter region and in the intron of the CCR5 gene in a cell type-specific manner. Our findings suggest that the C/EBP{beta}/LIP ratio might be important in the regulation of CCR5 expression. RNA analysis demonstrated a 5-fold increase in C/EBP{beta} expression in circulating T lymphocytes from HIV-1-infected individuals compared with healthy blood donors. Similarly, analysis of CCR5 expression in PBMCs demonstrated increased numbers of CCR5+ T lymphocytes in HIV-1-infected individuals as compared with healthy blood donors. The increase in CCR5+ T lymphocytes found in all stages of the disease correlates with the decline in CD4 counts. Taken together, these results suggest that C/EBP{beta} is an important factor in the regulation of CCR5 expression and may be involved in AIDS pathogenesis.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cloning of the regulatory sequences of CCR5 and generation of green fluorescent protein (GFP) constructs

A 3-kb fragment of genomic DNA upstream of the CCR5 gene AUG initiator was isolated from human PBMCs by PCR with a High Fidelity kit (Boehringer Mannheim, Mannheim, Germany). The primers used were: forward, 5'-GGCCTCAGTAATGCATTACGAGGCCACGGCT-3' and reverse, 5'-GACTCAGTACCGCGGCTTGTTCCACCCGTGTCA-3'. The 3-kb amplified fragment was first cloned in pCRvector II using the TA cloning system (Invitrogen, San Diego, CA) to generate p3kbR5. In this paper we define as nucleotide +1 the start site of transcription identified by Guignard et al. (16). This is nucleotide 59531 in GenBank sequence gbU95626. From the starting plasmid, p3kbR5, two fragments containing the CCR5 major promoter were subcloned in an expression vector. A 3-kb SacI/SacII fragment containing the CCR5 promoter and the intron, and a 1.2-kb AfiII/NciI fragment containing the CCR5 promoter and part of the first exon. The fragments were inserted immediately upstream of the AUG initiator codon of a strong mutant of the GFP of the jellyfish Aequorea victoria to generate p(-1124)R5In and p(-1124)R5, containing the 3- and 1.2-kb fragments, respectively. These vectors express GFP under the control of the CCR5 promoter. They were generated by replacing the CMV promoter in vector pCMV-GFPsg143 (46).

Plasmids p(-424)R5In and p(-166)R5In, containing deletions in the 5' of the CCR5 promoter, and p(-1112)R5In({Delta}MxPp), p(-1112)R5In({Delta}PpxPf), and p(-1112)R5In({Delta}MxPf), with internal deletions in the intron, were generated from p(-1112)R5In by digestion with the appropriate restriction enzymes, followed by filling with T4 polymerase and blunt-end ligation. To generate p(–424)R5In and p(–166)R5In containing promoter deletions, p(–1124)R5In was digested with SnaBI/AfiII or BglII and ligated. To generate p(–1112)R5In({Delta}MxPp), p(–1124R5In({Delta}PpxPf), and p(1112)pR5In(DMxPf)intron deletion plasmids, p(–1124)R5In was digested with MunI/PpuMI, PpuMI/PfiMI, or MunI/PfiMI, respectively, and ligated.

The two intronless promoter deletion mutants, p(–424)R5 and p(–166)R5 were generated by double digestion of p(–1112)R5 with SnaBI/AfiII or BglII, respectively, and religated. To generate the promoterless GFP plasmid pPLGFP (negative control), the CMV promoter was excised from pCMV-GFPsg143 by double digestion with MunI/SacII. The expression vectors for human C/EBP{beta} and LIP were provided by G. Scala (University of Catanzaro, Catanzaro, Italy), and U. Schibler (University of Geneva, Geneva, Switzerland), respectively, and have been previously described (29, 34).

All constructs were verified by restriction enzyme digestion and DNA sequencing. A search for putative DNA binding sites for transcription factors in the CCR5 regulatory sequences was conducted using programs Transcription Element Search Software (http://dot.imgen.bcm.tmc.edu) and MatInspector (http://transfac.gbf.de/) using the TRANSFAC database (47).

Cells

The human cell lines U937 (myeloid) and Jurkat (lymphoid), were cultured in RPMI 1640 medium (Life Technologies, Grand Island, NY) supplemented with 10% FBS, 50 U/ml penicillin, and 50 mg/ml streptomycin (Life Technologies). Cells were split as needed to keep them in the logarithmic growth phase.

Blood samples from patients and healthy donors

All blood samples were obtained in anticoagulant acid citrate dextrose solution tubes, after informed consent, under protocols approved by the National Institutes of Health Office of Human Subjects Research. PBMCs were purified by centrifugation over a Ficoll gradient. All PBMC samples were immediately processed for immunostaining and/or RNA extraction.

Transient transfections

Transfections were performed by electroporation of Qiagen-purified plasmid DNA into Jurkat or U937 cells using 0.4 cm gap cuvettes (Bio-Rad, Hercules, CA). The electroporation conditions were 250 mV and 960 µF, using 107 viable cells and 50 µg of DNA. The plasmid mixture typically consisted of 45 µg of the CCR5-GFP construct, and 5 µg of C/EBP{beta} or LIP or pBSPL DNA (vector plasmid added for maintaining the same DNA concentration). In each experiment separate control samples were transfected with either a GFP-containing vector (pPLGFP) without promoter (negative control) in the presence or absence of C/EBP{beta} or a GFP expression vector under the control of the CMV promoter (pCMV-GFP, positive control and additional indicator of transfection efficiency). GFP expression was analyzed 48 h after transfection.

Flow cytometry

GFP expression in transfected cells was analyzed using a FACS (BD Biosciences, Mountain View, CA). Dead cells were excluded by propidium iodide staining. Multiparameter flow cytometric analysis was performed with 106 PBMCs stained with directly conjugated mAbs specific for human CCR5, CD3, CD4, and CD8 (PharMingen, San Diego, CA) as previously described (24). For all samples, at least 1.5 x 104 viable cells were collected. Quadrants were set according to the fluorescence of cells stained with isotype-matched control Abs. Collected data were analyzed using CellQuest software.

Preparation of nuclear extracts and EMSA

Nuclear extracts from transfected U937 and Jurkat cells were prepared according to a previously published protocol (48). The protein content in the nuclear extracts was measured by the Bio-Rad protein assay. Binding experiments were performed using the following labeled oligonucleotide probes: P1 sense, 5'-GGGGAGAGTGGAGAAAAAGGGGGCACAGGG-3' (C/EBP{beta} site 1, Fig. 1GoA); P2 sense, 5'-AGAATTTTCTTAACCTTTT-3' (C/EBP{beta} site 2); P3 sense, 5'-AGCCTTACTGTTGAAAAGC-3' (C/EBP{beta} site 3); P4 sense, 5'-AGTAATTTCTTTTACTAAAAATGTGGGCTTTTTGACTAGATGAATG-3' (C/EBP{beta} site 4); P5 sense, 5'-TGTGGCTTTGAGCAAGTTACTCACCCTCTCTG-3' (C/EBP{beta} site 5); P6 sense, 5'-GAGAGGATTGCTTGAGCCCGGGTTGATCCA-3' (C/EBP{beta} site 6 in Fig. 1Go); and P7 sense, AGATTTTATTTGGTGAGATGGTGCTTTCATGAATTCCCCCAAC (C/EBP{beta} site 7). Each oligonucleotide was annealed to its complementary strand and end labeled with {gamma}32-ATP (Amersham) using T4 polynucleotide kinase (New England Biolabs, Beverly, MA). Binding experiments were performed with 20 µg of nuclear extract and 104 cpm of each hot probe as previously described (49). The binding reactions were resolved by electrophoresis in 5% nondenaturing polyacrylamide gels. Supershift experiments were performed by adding 1 µg of an anti-C/EBP{beta} rabbit polyclonal Ab (Santa Cruz Biotechnology, Santa Cruz, CA) to the reaction mixture 20 min before addition of the hot probe. The binding reactions were incubated on ice for 20 min before electrophoresis.



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 1. Schematic representation of the CCR5 gene and CCR5 reporter plasmids. A, Structure of the CCR5 gene is shown at the top of the panel. Potential C/EBP{beta} binding sites located in the CCR5 gene are shown as open circles numbered 1–7. The C/EBP{beta} consensus sequence is based on published data (50 ). Nucleotide positions are numbered from the transcription start site (see Materials and Methods). Numbers in parentheses indicate the number of residues matching the consensus. n = G or A or T or C; K = T or G; *, antisense orientation. B, Representation of the GFP reporter plasmids containing the CCR5 regulatory sequences.

 
RNA extraction and SYBR Green RT-PCR

Total RNA was extracted from uncultured PBMCs by the RNazol procedure according to the manufacturer’s instructions. cDNAs were generated in 50-µl reactions containing, 0.5 µg of RNA, 5 mM dNTPs, 100 µg/ml random hexamers, 5x avian myeloblastosis virus buffer, 2.5 U RNase inhibitor (Promega, Madison, WI), and 2 U avian myeloblastosis virus-reverse transcriptase (Boehringer). After a 90-min incubation at 45°C, the cDNAs were used as templates to amplify C/EBP{beta} and GAPDH by PCR. The real time PCR was performed in an ABI PRISM 7700 Sequence Detector (PE Applied Biosystems, Foster City, CA) using the SYBR Green PCR core reagent kit (PE Applied Biosystems) following the manufacturer’s protocol. Amplification was for 40 cycles at 50°C for 2 min, 95°C for 15 s, and 60°C for 1 min using C/EBP{beta} primers 5'-GCGCGAGCGCAACAACA-3' and 5'-TGCTTGAACAAGTTCCGCAG-3' or GAPDH primers 5'-GTCGTATTGGGCGCCTG-3' and 5'-GTGATGGGATTTCCATTGATG-3'.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
C/EBP{beta} binding sites are present throughout the CCR5 gene

To identify putative cis-acting regulatory sequences in the CCR5 gene, we used Transcription Element Search Software or MatInspector programs and the TRANSFAC database (47). In agreement with previously published reports, analysis of the promoter region identified several cis-acting sites including GATA, Rel, AP-1, and NF-AT (16, 17, 18, 19). In addition, several C/EBP{beta} binding sites were identified in the CCR5 gene, as shown in Fig. 1GoA. All of these sites had a strong homology with the C/EBP{beta} binding site consensus motif TKNNGNAAY (50).

To analyze whether C/EBP{beta} affects the expression of CCR5, two CCR5 promoter constructs, p(-1124)R5In and p(-1124)R5, expressing a GFP mutant with enhanced fluorescing properties (46) were generated (Fig. 1GoB). p(-1124)R5In contains the entire CCR5 region from -1124 to the initiator AUG, whereas p(-1124)R5 has the intron sequence between nucleotides +40 to 1954 removed. U937 and Jurkat cells were transiently transfected with the construct p(-1124)R5In or p(-1124)R5, either in the presence or absence of the expression plasmid hC/EBP{beta}. A powerful advantage of this system is that expression of GFP reporter can be measured in live cells by flow cytometry without any additional manipulations. GFP expression per cell can be determined and expressed as mean fluorescence intensity (MFI) for the population. We found that the presence of the intron had a negative effect (3-fold reduction) on CCR5 expression in both myeloid and lymphoid cells (Fig. 2Go). Coexpression of C/EBP{beta} led to activation (3- to 4-fold) of CCR5-driven GFP expression as measured by the MFI of the GFP-positive cells (Fig. 2Go, A and B). Removal of the intron in p(-1124)R5 resulted in loss of C/EBP{beta} activation of CCR5 in Jurkat cells (Fig. 2GoB), indicating that C/EBP{beta} binding sites located in this region are essential for C/EBP{beta} transactivation in lymphoid cells. In contrast, p(-1124)R5 was fully responsive to C/EBP{beta} in U937 cells (Fig. 2GoA).



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 2. C/EBP{beta} up-regulates CCR5 gene expression in myeloid and lymphoid human cell lines. Flow cytometric analysis of U937 (A) and Jurkat cells (B) transfected with p(-1124)R5In or p(-1124)PR5 either in the absence (control) or in the presence of C/EBP{beta} expression vector as indicated at the top. Markers in the histograms were set according to the fluorescence of the negative controls. Numbers within the histograms indicate the MFI of GFP-expressing cells and the percentage of positive cells. As positive control and indicator of transfection efficiency, cells were transfected in parallel with a GFP-expressing plasmid under the control of the CMV promoter. Results from a representative experiment are shown. Similar results were obtained in three additional experiments.

 
Overexpression of LIP inhibits CCR5 expression

It has been shown that some members of the C/EBP family, such as Ig/EBP and LIP, act as negative regulators and can inhibit the stimulatory effects of other family members by the generation of heterodimers (26, 29). To investigate whether LIP, a negative isoform of C/EBP{beta} lacking the amino-terminal domain, could affect either basal CCR5 promoter activity or C/EBP{beta} stimulation of CCR5 expression, we performed cotransfection experiments in U937 or Jurkat cells using a LIP expression vector and p(-1124)R5In or p(-1124)R5. LIP was able to efficiently neutralize the positive effect of C/EBP{beta} on p(-1124)R5In expression in both cell types and on p(-1124)R5 in U937 cells (Fig. 3Go, A and B). In contrast, neither C/EBP{beta} nor LIP affected the expression of p(-1124)R5, which lacks the intronic sequence, in Jurkat cells (Fig. 3GoB). These data are consistent with the results of Fig. 2Go and support the hypothesis that activation or repression of CCR5 expression depends on binding of these factors to functional sites.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 3. Inhibition of C/EBP{beta} activation by LIP. U937 (A) and Jurkat (B) cells were transfected with p(-1112)R5In or p(-1112)R5 reporter plasmids in the absence () or presence () of C/EBP{beta} or CMV-LIP ({blacksquare}) or both C/EBP{beta} and CMV-LIP ({square}). Values represent the mean and SD of the GFP MFI from two independent experiments.

 
C/EBP{beta} and LIP binding to sites located in the promoter region and in the intron of CCR5 gene

To study whether C/EBP{beta} and LIP bind to sites in the CCR5 gene as predicted by the functional assays, we performed EMSA with 32P-labeled oligonucleotide probes containing each of the C/EBP{beta} sites shown in Fig. 1GoA. Nuclear extracts from U937 cells transfected with either C/EBP{beta} or LIP produced specific complexes with all seven probes (Fig. 4GoA). Addition of anti-C/EBP{beta} Abs to the binding mixture induced a supershift of the specific complexes, demonstrating that C/EBP{beta} or LIP was present in these complexes.



View larger version (58K):
[in this window]
[in a new window]
  		FIGURE 4. Analysis of CCR5 C/EBP{beta} binding sites by EMSA. Results of EMSA using nuclear extracts from U937 (A) or Jurkat cells (B) transfected with C/EBP{beta}, LIP, or a control plasmid are shown. Ab supershifting was performed by adding an anti-C/EBP{beta} rabbit polyclonal Ab to the binding reaction. P1 through P7 indicate the oligonucleotides containing the predicted C/EBP{beta} sites shown in Fig. 1GoA (see Materials and Methods). C/EBP{beta}- or LIP-specific complexes are indicated by solid and open arrows, respectively.

 
Binding experiments with nuclear extracts from transfected Jurkat cells (Fig. 4GoB) showed C/EBP{beta} complexes with sites 5 and 6, located at the 3' portion of the intron. In contrast to U937 extracts, no specific complexes were observed with either site 7 or any of the sites located in the promoter region (sites 1 through 4, Fig. 1GoA). Sites 5 and 6 are the only ones containing the GC motif at the core of the sequence and are predicted to have high binding affinity for C/EBP{beta} (50). Binding experiments with probes 5 or 6 and nuclear extracts from Jurkat cells produced two C/EBP{beta} complexes with different electrophoretic mobilities. Both complexes appear to be specific and were supershifted by anti-C/EBP{beta} Ab. These results are in contrast to those obtained with U937 cells and indicate that the molecular interaction between C/EBP{beta} and its DNA-binding sites is cell type specific. Previous studies of IL-4 promoter regulation in Jurkat cells by Davydov et al. (31) demonstrated the formation of two distinct C/EBP{beta} complexes with an oligonucleotide containing a single C/EBP{beta} binding site. One hypothesis explaining the presence of two complexes is that additional factors may be present in the complexes of C/EBP{beta} with oligonucleotides P5 and P6 in lymphoid cells.

The C/EBP{beta} functional elements required for activation in Jurkat cells are located at the 3' part of the intron of the CCR5 gene

To determine the specific sites required for C/EBP{beta} transactivation of CCR5, a series of constructs with deletions in the intron that do not affect the splice sites was generated (Fig. 5Go). Transient transfection experiments showed that, in the absence of C/EBP{beta}, GFP expression was similar for all three deletion mutants, indicating that the deleted regions do not contribute significantly to the baseline expression levels of CCR5 in either U937 or Jurkat cells (data not shown). Transfection experiments in the presence of C/EBP{beta} demonstrated that the sites located in the 3' portion of the intron are essential for C/EBP{beta} activation in Jurkat cells but not in U937 cells (Fig. 5Go). Elimination of either site 5 or sites 6 and 7 abrogated C/EBP{beta}-mediated activation of CCR5 in Jurkat cells. Because site 7 did not show any binding by EMSA with Jurkat cell nuclear extracts, we concluded that sites 5 and 6 are required for activation. As expected from the data in Fig. 2Go, all three intron mutants were activated by C/EBP{beta} in U937 cells. No significant difference was observed in the expression of these intron mutants in U937 cells.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 5. Analysis of the C/EBP{beta} responses of CCR5 intron deletion mutants (schematic representation of the different intron deletion mutants used in these experiments). M, Pp, and Pf indicate restriction sites for MunI, PpuMI, and PfiMI, respectively. Expression of the reporter plasmids in the absence or presence of C/EBP{beta} was analyzed in U937 and Jurkat cells. Numbers to the right of each construct show the C/EBP{beta}-mediated induction ±SD of three independent experiments.

 
Deletion analysis of the promoter region

To further characterize the CCR5 promoter sites important for transactivation by C/EBP{beta}, two series of deletion reporter plasmids based on p(-1124)R5In and p(-1124)R5 were generated (Fig. 6Go). Upon transfection in U937 or Jurkat cells, GFP expression by the different deletion mutants in the presence or absence of C/EBP{beta} was measured by flow cytometry. In U937 cells, deletion of all upstream promoter sites (1, 2, 3, 4) did not eliminate activation by C/EBP{beta}, suggesting that sites within the intron are sufficient for activation. Using the intronless constructs, we found that the region containing sites 2, 3, and 4 is sufficient for activation. Elimination of all C/EBP{beta} binding sites in p(-166)R5 resulted in loss of response to C/EBP{beta}.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 6. Deletion analysis of the C/EBP{beta} sites located in the CCR5 promoter region (schematic representation of the CCR5 reporter plasmids containing 5' promoter deletions). The names of the reporter plasmids indicate the length of the deletions. Expression of the reporter plasmids in U937 and Jurkat cells in the absence ({square}) or presence ({blacksquare}) of C/EBP{beta} is shown as MFI of GFP-expressing cells. Bars indicate the SD of three independent experiments.

 
In contrast, in Jurkat cells, removal of the intron resulted in complete loss of activation despite the presence of the upstream sites. These results are in agreement with the EMSA experiments showing that only sites 5 and 6 are functional for binding in Jurkat cells. Analysis of constructs containing the intron showed that deletion of the fragment between nucleotides -424 and -166 containing sites 2, 3, and 4 resulted in the loss of response to C/EBP{beta}, despite the presence of the functional intron sites 5 and 6. These results suggest that activation through sites 5 and 6 requires also the presence of cis-acting regions other than the C/EBP{beta} sites, located in the region -424 to -166. The requirement of additional factors acting in cooperation with C/EBP{beta} has been described previously; for example, it was shown that expression of CD11c requires the presence of Sp1 together with C/EBP{beta} (51).

Higher levels of C/EBP{beta} and CCR5 in T lymphocytes from HIV-1-infected individuals

Based on our results showing regulation of the CCR5 promoter by C/EBP{beta} and the important role of C/EBP{beta} as a regulator of immune responses and cytokine production, we studied whether C/EBP{beta} expression in vivo is affected by HIV-1 infection. Total RNA was purified from uncultured PBMCs from HIV-1-infected individuals and healthy blood donors. The RNA was reverse transcribed and amplified by PCR using primers specific for C/EBP{beta}. The PCR products were resolved by electrophoresis on agarose gels. C/EBP{beta} was consistently detected in samples from HIV-1-infected individuals. In contrast, samples from healthy donors were either negative or low for C/EBP{beta} amplification (data not shown). Next, we quantified the expression of C/EBP{beta} in total PBMCs, purified CD3+ T cells, and monocytes (CD14+ cells) from HIV-1-infected individuals and blood donors by using a real time quantitative RT-PCR protocol (see Materials and Methods). C/EBP{beta} expression was 5-fold higher in PBMC samples from HIV-1-infected individuals (Fig. 7GoA). A similar increase in C/EBP{beta} expression was found in both monocytes and CD3+ T cells from HIV-1-infected patients (data not shown).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 7. Increase of C/EBP{beta} and CCR5 in PBMCs from HIV-1-infected individuals. A, Quantification by real-time RT-PCR of C/EBP{beta} mRNA in PBMCs from HIV-1-infected individuals (n = 14) and healthy blood donors (n = 8). Bars indicate relative C/EBP{beta} mRNA copies in three independent experiments ±SD. C/EBP{beta} expression was normalized to GAPDH mRNA expression in the same sample. B, Percentage of CCR5+ lymphocytes in HIV-1-infected individuals and healthy blood donors (same individuals shown in Fig. 6GoA) as measured by immunostaining and flow cytometry. C, Percentage of CCR5+ lymphocytes in HIV-1-infected individuals with different levels of CD4 counts. A population of 181 infected individuals and 53 donors was analyzed. The groups were as follows: patients with CD4 <200 (n = 58); CD4 200–500 (n = 86); CD4 >500 (n = 37), and healthy blood donors (n = 53).

 
Expression of CCR5 in PBMCs from HIV-1-infected individuals and healthy blood donors was determined by immunostaining and flow cytometry. The clinical samples were obtained from patients at different stages of HIV disease with different levels of CD4 depletion. We found a significant increase in the percentage of circulating CCR5+ T lymphocytes in HIV-1 patients compared with healthy donors (Fig. 7GoB). Higher CCR5 expression was found in HIV-1 PBMC in all stages of the disease. The frequency of CCR5+ T lymphocytes increased with CD4+ T cell depletion and development of immunodeficiency (Fig. 7GoC). In agreement with previous observations (52), we found increased CCR5 expression in CD4+ T cells, but also in CD8+ T cells, especially in patients with low CD4 counts (data not shown).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
CCR5 is the main HIV-1 coreceptor, and the study of its regulation is critical for understanding AIDS pathogenesis. We studied the ability of the 3-kb fragment upstream of the AUG initiator of CCR5 gene to regulate transient GFP expression in myeloid (U937) and lymphoid (Jurkat) human cell lines. Analysis of the upstream sequences of the human CCR5 gene revealed two noncanonical TATA boxes and no obvious consensus sequence for a CCAAT box. Consistent with previous reports (16, 17, 18, 19), we located the major promoter region immediately upstream of exon 1. In agreement with the finding of Liu and coworkers (17), we also provide evidence that the CCR5 intron negatively regulates the expression of CCR5 in both myeloid and lymphoid cells.

The presence of multiple C/EBP{beta} binding sites throughout the CCR5 gene indicated that the transcription factor C/EBP{beta} might regulate CCR5 expression. The experimental results presented here demonstrate that C/EBP{beta} indeed stimulates expression from the CCR5 promoter. We have found that in myeloid cells the activation by C/EBP{beta} is mediated independently either through sites located upstream of the transcription initiation point or sites located in the intron. In contrast, in lymphoid cells the upstream sites appear to be nonfunctional for C/EBP{beta} binding. Activation of CCR5 in lymphoid cells requires the intron C/EBP{beta} binding sites. Although all seven binding sites shown in Fig. 1GoA bound C/EBP{beta} in U937 cells, only sites 5 and 6 in the intron did so in Jurkat cells. The difference in binding to C/EBP{beta} probes observed between nuclear extracts from U937 and Jurkat cells suggests that interaction of C/EBP{beta} with additional cell type-specific factors is required for CCR5 regulation. Furthermore, EMSA experiments showed the presence of two specific C/EBP{beta} complexes using oligonucleotides 5 and 6 with Jurkat nuclear extracts. This was not observed with U937 cell nuclear extracts, suggesting that the molecular mechanisms resulting in CCR5 regulation by C/EBP{beta} are different in myeloid and lymphoid cells. Cell-type specific regulation of gene expression by C/EBP{beta} has been previously demonstrated. It was found that C/EBP{beta} regulation of CD11c in U937 cells required the functional interplay with additional cell-type specific transcriptional factors, such as Sp1 (51). Transcriptional synergy between C/EBP{beta} and Sp1 in the regulation of rat cytochrome CYP2D5 gene expression has also been demonstrated (53); in that work, weak C/EBP{beta} binding sites were not recognized by C/EBP{beta} unless a functional Sp1 site was closely located.

We found that LIP, the transdominant negative isoform of C/EBP{beta}, was an efficient inhibitor of C/EBP{beta}-dependent gene expression. The inhibition of CCR5 promoter activity by LIP further supports the direct involvement of C/EBP{beta} in CCR5 regulation, because LIP is a specific inhibitor. These results also suggest that C/EBP regulation of the CCR5 gene is specific and tightly controlled. Two mechanisms can explain the function of LIP as a dominant negative regulator: competition with C/EBP{beta} for the binding sites on the DNA, or heterodimer formation between LIP and C/EBP{beta} resulting in impaired ability to stimulate gene expression. Both mechanisms have been previously proposed to explain C/EBP{beta} inhibition by Ig/EBP (C/EBP{gamma}), another member of the C/EBP family of transcription regulators (26). C/EBP{beta} and LIP are translated from two different AUGs in the same reading frame within a single mRNA molecule. It has been suggested that the ratio of the two isoforms is important for regulation of gene expression in vivo, and that this ratio is regulated. For example, a marked increase in the C/EBP{beta}/LIP ratio was found in newborn rats during terminal hepatic maturation (29). We propose that the balanced expression of the two C/EBP isoforms is a key regulator of CCR5 expression in leukocytes.

C/EBP binding sites have also been identified in the promoter of CCR2, a receptor closely related to CCR5 (37). Similar to CCR5, CCR2 can function as a coreceptor for HIV-1 (4, 54). Interestingly, a genetic polymorphism in CCR2 gene, substitution V64I, is associated with delayed progression to AIDS (55, 56, 57, 58). In addition, both CCR2 and CCR5 bind to monocyte chemoattractant protein-2 (59) and are coexpressed in similar lymphocyte subpopulations including intraepithelial lymphocytes in the gut-associated lymphatic tissue (60). It has been shown that lymphocyte activation increases the expression of both CCR5 and CCR2, suggesting that similar mechanisms regulate their expression and that these receptors may be functionally linked (60, 61). The finding by Yamamoto et al. (37) that mutations in the C/EBP binding sites result in strong down-regulation of the CCR2 promoter activity supports the concept that C/EBP{beta} is an important regulator of a group of chemokine receptors that includes CCR5 and CCR2.

C/EBP{beta} is involved in the regulation of T helper responses and macrophage activation. It has been shown that mice deficient in C/EBP{beta} have increased susceptibility to systemic candidiasis, impaired production of IFN-{gamma}, IL-2, and IL-12, and increased IL-4 and IL-6. This pattern of cytokine production, together with an expansion of the B cell compartment in peripheral lymphatic tissues, indicates an enhanced Th2 response in the absence of C/EBP{beta} and emphasizes the importance of C/EBP{beta} in the regulation of polarized immune responses (42). Similar defects in Th1 immune responses have been described in CCR2-knockout mice, which are characterized by impaired monocyte migration, delayed-type hypersensitivity, and a severe decrease in IFN-{gamma} production by T lymphocytes (62). We found elevated levels of C/EBP{beta} in lymphocytes from HIV-1-infected individuals. This increase correlates with a higher frequency of circulating CCR5+ lymphocytes and is compatible with the general immune activation present in HIV-1-infected patients. Our findings on the CCR5 activation by C/EBP{beta} together with increased C/EBP{beta} expression in peripheral blood from HIV-1-infected individuals provides a molecular mechanism to explain the apparently paradoxical expansion of CCR5+ lymphocytes in AIDS patients.

The role of C/EBP{beta} isoforms in HIV disease is not restricted to the regulation of immune responses and CCR5 expression; it has been shown that C/EBP{beta} is a regulator of HIV-1 expression through its interaction with the HIV LTR (43, 49). Furthermore, it has been proposed that efficient HIV-1 replication in macrophages requires the presence of C/EBP{beta} binding sites, whereas such sites are dispensable in infected T cells (45). In this context, it has also been shown that type I IFN induces in macrophages a truncated (16-kDa) inhibitory isoform of C/EBP{beta} that represses the LTR activity (63).

Roux et al. recently demonstrated that HIV-1 Vpr, a protein essential for viral propagation in vivo, stimulates the production of IL-8 through the activation of NF-{kappa}B and C/EBP{beta} (64). C/EBP{beta} induction by HIV may help the virus in two important ways: by facilitating viral transcription in resting cells, and by increasing the number of cells susceptible to infection via stimulation of CCR5 in CD4+ cells. The broad range of biological effects mediated by C/EBP{beta} suggests that its increased production in HIV-1-infected individuals may be important in the pathogenesis of AIDS.


   Acknowledgments
 
We thank R. Yarchoan for providing clinical samples; K. Noer and R. Matthai for expert flow cytometric analysis; A. von Gegerfelt, B. K. Felber, and G. Melillo for suggestions and stimulating discussions; G. Scala and U. Schibler for C/EBP{beta} and LIP expression plasmids, respectively; and T. Jones for clerical assistance.


   Footnotes
 
1 Address correspondence and reprint requests to Dr. George N. Pavlakis, Human Retrovirus Section, BRL, Building 535, Room 210, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD 21702. E-mail address: pavlakis{at}ncifcrf.gov Back

2 Abbreviations used in this paper: MIP, macrophage-inflammatory protein; GFP, green fluorescent protein; LIP, liver-enriched transcriptional inhibitory protein; MFI, mean fluorescence intensity. Back

Received for publication May 30, 2000. Accepted for publication May 25, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Alkhatib, G., C. Combadiere, C. C. Broder, Y. Feng, P. E. Kennedy, P. M. Murphy, E. A. Berger. 1996. CC CKR5: a RANTES, MIP-1{alpha}, MIP-1{beta} receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272:1955.[Abstract]
  2. Choe, H., M. Farzan, Y. Sun, N. Sullivan, B. Rollins, P. D. Ponath, L. Wu, C. R. Mackay, G. LaRosa, W. Newman, et al 1996. The {beta}-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85:1135.[Medline]
  3. Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, C. M. Hill, et al 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661.[Medline]
  4. Doranz, B. J., J. Rucker, Y. Yi, R. J. Smyth, M. Samson, S. C. Peiper, M. Parmentier, R. G. Collman, R. W. Doms. 1996. A dual-tropic primary HIV-1 isolate that uses fusin and the {beta}-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85:1149.[Medline]
  5. Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagashima, C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, W. A. Paxton. 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381:667.[Medline]
  6. Bleul, C. C., L. Wu, J. A. Hoxie, T. A. Springer, C. R. Mackay. 1997. The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes. Proc. Natl. Acad. Sci. USA 94:1925.[Abstract/Free Full Text]
  7. Lee, B., M. Sharron, L. J. Montaner, D. Weissman, R. W. Doms. 1999. Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages. Proc. Natl. Acad. Sci. USA 96:5215.[Abstract/Free Full Text]
  8. Samson, M., F. Libert, B. J. Doranz, J. Rucker, C. Liesnard, C. M. Farber, S. Saragosti, C. Lapoumeroulie, J. Cognaux, C. Forceille, et al 1996. Resistance to HIV-1 infection in Caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 382:722.[Medline]
  9. Liu, R., W. A. Paxton, S. Choe, D. Ceradini, S. R. Martin, R. Horuk, M. E. MacDonald, H. Stuhlmann, R. A. Koup, N. R. Landau. 1996. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86:367.[Medline]
  10. Dean, M., M. Carrington, C. Winkler, G. A. Huttley, M. W. Smith, R. Allikmets, J. J. Goedert, S. P. Buchbinder, E. Vittinghoff, E. Gomperts, et al 1996. Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study. Science 273:1856.[Abstract/Free Full Text]
  11. Michael, N. L., G. Chang, L. G. Louie, J. R. Mascola, D. Dondero, D. L. Birx, H. W. Sheppard. 1997. The role of viral phenotype and CCR-5 gene defects in HIV-1 transmission and disease progression. Nat. Med. 3:338.[Medline]
  12. Huang, Y., W. A. Paxton, S. M. Wolinsky, A. U. Neumann, L. Zhang, T. He, S. Kang, D. Ceradini, Z. Jin, K. Yazdanbakhsh, et al 1996. The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat. Med. 2:1240.[Medline]
  13. Martin, M. P., M. Dean, M. W. Smith, C. Winkler, B. Gerrard, N. L. Michael, B. Lee, R. W. Doms, J. Margolick, S. Buchbinder, et al 1998. Genetic acceleration of AIDS progression by a promoter variant of CCR5. Science 282:1907.[Abstract/Free Full Text]
  14. Mummidi, S., S. S. Ahuja, E. Gonzalez, S. A. Anderson, E. N. Santiago, K. T. Stephan, F. E. Craig, P. O’Connell, V. Tryon, R. A. Clark, et al 1998. Genealogy of the CCR5 locus and chemokine system gene variants associated with altered rates of HIV-1 disease progression. Nat. Med. 4:786.[Medline]
  15. McDermott, D. H., P. A. Zimmerman, F. Guignard, C. A. Kleeberger, S. F. Leitman, P. M. Murphy. 1998. CCR5 promoter polymorphism and HIV-1 disease progression. Multicenter AIDS Cohort Study (MACS). Lancet 352:866.[Medline]
  16. Guignard, F., C. Combadiere, H. L. Tiffany, P. M. Murphy. 1998. Gene organization and promoter function for CC chemokine receptor 5 (CCR5). J. Immunol. 160:985.[Abstract/Free Full Text]
  17. Liu, R., X. Zhao, T. A. Gurney, N. R. Landau. 1998. Functional analysis of the proximal CCR5 promoter. AIDS Res. Hum. Retroviruses 14:1509.[Medline]
  18. Mummidi, S., S. S. Ahuja, B. L. McDaniel, S. K. Ahuja. 1997. The human CC chemokine receptor 5 (CCR5) gene: multiple transcripts with 5'-end heterogeneity, dual promoter usage, and evidence for polymorphisms within the regulatory regions and noncoding exons. J. Biol. Chem. 272:30662.[Abstract/Free Full Text]
  19. Moriuchi, H., M. Moriuchi, A. S. Fauci. 1997. Cloning and analysis of the promoter region of CCR5, a coreceptor for HIV-1 entry. J. Immunol. 159:5441.[Abstract]
  20. Moriuchi, M., H. Moriuchi, A. S. Fauci. 1999. GATA-1 transcription factor transactivates the promoter for CCR5, a coreceptor for human immunodeficiency virus type 1 entry. Blood 93:1433.[Free Full Text]
  21. Alkhatib, G., M. Locati, P. E. Kennedy, P. M. Murphy, E. A. Berger. 1997. HIV-1 coreceptor activity of CCR5 and its inhibition by chemokines: independence from G protein signaling and importance of coreceptor downmodulation. Virology 234:340.[Medline]
  22. Carroll, R. G., J. L. Riley, B. L. Levine, Y. Feng, S. Kaushal, D. W. Ritchey, W. Bernstein, O. S. Weislow, C. R. Brown, E. A. Berger, et al 1997. Differential regulation of HIV-1 fusion cofactor expression by CD28 costimulation of CD4+ T cells. Science 276:273.[Abstract/Free Full Text]
  23. Patterson, B. K., M. Czerniewski, J. Andersson, Y. Sullivan, F. Su, D. Jiyamapa, Z. Burki, A. Landay. 1999. Regulation of CCR5 and CXCR4 expression by type 1 and type 2 cytokines: CCR5 expression is downregulated by IL-10 in CD4-positive lymphocytes. Clin. Immunol. 91:254.[Medline]
  24. Valentin, A., W. Lu, M. Rosati, R. Schneider, J. Albert, A. Karlsson, G. N. Pavlakis. 1998. Dual effect of interleukin 4 on HIV-1 expression: implications for viral phenotypic switch and disease progression. Proc. Natl. Acad. Sci. USA 95:8886.[Abstract/Free Full Text]
  25. Weissman, D., M. Dybul, M. B. Daucher, Jr R. T. Davey, R. E. Walker, J. A. Kovacs. 2000. Interleukin-2 up-regulates expression of the human immunodeficiency virus fusion coreceptor CCR5 by CD4+ lymphocytes in vivo. J. Infect. Dis. 181:933.[Medline]
  26. Cooper, C., A. Henderson, S. Artandi, N. Avitahl, K. Calame. 1995. Ig/EBP (C/EBP {gamma}) is a transdominant negative inhibitor of C/EBP family transcriptional activators. Nucleic Acids Res. 23:4371.[Abstract/Free Full Text]
  27. Johnson, P. F., S. C. Williams. 1994. CAAT/enhancer binding (C/EBP) proteins. E. F. Tronche, and M. Yaniv, eds. Liver Gene Expression 231. R.G. Landes Company, Austin, TX.
  28. Akira, S., H. Isshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T. Nakajima, T. Hirano, T. Kishimoto. 1990. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 9:1897.[Medline]
  29. Descombes, P., U. Schibler. 1991. A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67:569.[Medline]
  30. Zhang, Y., W. N. Rom. 1993. Regulation of the interleukin-1{beta} (IL-1{beta}) gene by mycobacterial components and lipopolysaccharide is mediated by two nuclear factor-IL6 motifs. Mol. Cell. Biol. 13:3831.[Abstract/Free Full Text]
  31. Davydov, I. V., P. H. Krammer, M. Li-Weber. 1995. Nuclear factor-IL6 activates the human IL-4 promoter in T cells. J. Immunol. 155:5273.[Abstract]
  32. Isshiki, H., S. Akira, O. Tanabe, T. Nakajima, T. Shimamoto, T. Hirano, T. Kishimoto. 1990. Constitutive and interleukin-1 (IL-1)-inducible factors interact with the IL-1-responsive element in the IL-6 gene. Mol. Cell. Biol. 10:2757.[Abstract/Free Full Text]
  33. Kunsch, C., R. K. Lang, C. A. Rosen, M. F. Shannon. 1994. Synergistic transcriptional activation of the IL-8 gene by NF-{kappa}B p65 (RelA) and NF-IL-6. J. Immunol. 153:153.[Abstract]
  34. Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto, S. Akira. 1993. Transcription factors NF-IL6 and NF-{kappa}B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193.[Abstract/Free Full Text]
  35. Matsumoto, M., T. Tanaka, T. Kaisho, H. Sanjo, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, S. Akira. 1999. A novel LPS-inducible C-type lectin is a transcriptional target of NF- IL6 in macrophages. J. Immunol. 163:5039.[Abstract/Free Full Text]
  36. Pope, R. M., A. Leutz, S. A. Ness. 1994. C/EBP{beta} regulation of the tumor necrosis factor {alpha} gene. J. Clin. Invest. 94:1449.
  37. Yamamoto, K., H. Takeshima, K. Hamada, M. Nakao, T. Kino, T. Nishi, M. Kochi, J. Kuratsu, T. Yoshimura, Y. Ushio. 1999. Cloning and functional characterization of the 5'-flanking region of the human monocyte chemoattractant protein-1 receptor (CCR2) gene: essential role of 5'-untranslated region in tissue-specific expression. J. Biol. Chem. 274:4646.[Abstract/Free Full Text]
  38. LeClair, K. P., M. A. Blanar, P. A. Sharp. 1992. The p50 subunit of NF-{kappa}B associates with the NF-IL6 transcription factor. Proc. Natl. Acad. Sci. USA 89:8145.[Abstract/Free Full Text]
  39. Nagulapalli, S., J. M. Pongubala, M. L. Atchison. 1995. Multiple proteins physically interact with PU.1: transcriptional synergy with NF-IL6 {beta} (C/EBP {delta}, CRP3). J. Immunol. 155:4330.[Abstract]
  40. Nishio, Y., H. Isshiki, T. Kishimoto, S. Akira. 1993. A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat {alpha} 1-acid glycoprotein gene via direct protein-protein interaction. Mol. Cell. Biol. 13:1854.[Abstract/Free Full Text]
  41. Tanaka, T., N. Yoshida, T. Kishimoto, S. Akira. 1997. Defective adipocyte differentiation in mice lacking the C/EBP{beta} and/or C/EBP{delta} gene. EMBO J. 16:7432.[Medline]
  42. et al. Screpanti, I., P. L. Romani, A. Musiani, E. Modesti, D. Fattori, C. Lazzaro, S. Sellitto, D. Scarpa, G. Bellavia, G. Lattanzio. 1995. Lymphoproliferative disorder and imbalanced T-helper response in C/EBP {beta}-deficient mice: [Published erratum appears in 1995 EMBO J. 14:3596.]. EMBO J. 14:1932.[Medline]
  43. Tesmer, V. M., A. Rajadhyaksha, J. Babin, M. Bina. 1993. NF-IL6-mediated transcriptional activation of the long terminal repeat of the human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 90:7298.[Abstract/Free Full Text]
  44. Henderson, A. J., X. Zou, K. L. Calame. 1995. C/EBP proteins activate transcription from the human immunodeficiency virus type 1 long terminal repeat in macrophages/monocytes. J. Virol. 69:5337.[Abstract]
  45. Henderson, A. J., K. L. Calame. 1997. CCAAT/enhancer binding protein (C/EBP) sites are required for HIV-1 replication in primary macrophages but not CD4+ T cells. Proc. Natl. Acad. Sci. USA 94:8714.[Abstract/Free Full Text]
  46. Stauber, R. H., K. Horie, P. Carney, E. A. Hudson, N. I. Tarasova, G. A. Gaitanaris, G. N. Pavlakis. 1998. Development and applications of enhanced green fluorescent protein mutants. BioTechniques 24:462.[Medline]
  47. Heinemeyer, T., X. Chen, H. Karas, A. E. Kel, O. V. Kel, I. Liebich, T. Meinhardt, I. Reuter, F. Schacherer, E. Wingender. 1999. Expanding the TRANSFAC database toward an expert system of regulatory molecular mechanisms. Nucleic Acids Res. 27:318.[Abstract/Free Full Text]
  48. Melillo, G., T. Musso, A. Sica, L. S. Taylor, G. W. Cox, L. Varesio. 1995. A hypoxia-responsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter. J. Exp. Med. 182:1683.[Abstract/Free Full Text]
  49. Ruocco, M. R., X. Chen, C. Ambrosino, E. Dragonetti, W. Liu, M. Mallardo, G. De Falco, C. Palmieri, G. Franzoso, I. Quinto, et al 1996. Regulation of HIV-1 long terminal repeats by interaction of C/EBP (NF-IL6) and NF-{kappa}B/Rel transcription factors. J. Biol. Chem. 271:22479.[Abstract/Free Full Text]
  50. Osada, S., H. Yamamoto, T. Nishihara, M. Imagawa. 1996. DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. J. Biol. Chem. 271:3891.[Abstract/Free Full Text]
  51. Lopez-Rodriguez, C., L. Botella, A. L. Corbi. 1997. CCAAT-enhancer-binding proteins (C/EBP) regulate the tissue specific activity of the CD11c integrin gene promoter through functional interactions with Sp1 proteins. J. Biol. Chem. 272:29120.[Abstract/Free Full Text]
  52. Ostrowski, M. A., S. J. Justement, A. Catanzaro, C. A. Hallahan, L. A. Ehler, S. B. Mizell, P. N. Kumar, J. A. Mican, T. W. Chun, A. S. Fauci. 1998. Expression of chemokine receptors CXCR4 and CCR5 in HIV-1-infected and uninfected individuals. J. Immunol. 161:3195.[Abstract/Free Full Text]
  53. Lee, Y. H., S. C. Williams, M. Baer, E. Sterneck, F. J. Gonzalez, P. F. Johnson. 1997. The ability of C/EBP {beta} but not C/EBP {alpha} to synergize with an Sp1 protein is specified by the leucine zipper and activation domain. Mol. Cell. Biol. 17:2038.[Abstract]
  54. Frade, J. M., M. Llorente, M. Mellado, J. Alcami, J. C. Gutierrez-Ramos, A. Zaballos, G. Real, A. C. Martinez. 1997. The amino-terminal domain of the CCR2 chemokine receptor acts as coreceptor for HIV-1 infection. J. Clin. Invest. 100:497.[Medline]
  55. Kostrikis, L. G., Y. Huang, J. P. Moore, S. M. Wolinsky, L. Zhang, Y. Guo, L. Deutsch, J. Phair, A. U. Neumann, D. D. Ho. 1998. A chemokine receptor CCR2 allele delays HIV-1 disease progression and is associated with a CCR5 promoter mutation. Nat. Med. 4:350.[Medline]
  56. Mariani, R., S. Wong, L. C. Mulder, D. A. Wilkinson, A. L. Reinhart, G. LaRosa, R. Nibbs, T. R. O’Brien, N. L. Michael, R. I. Connor, et al 1999. CCR2–64I polymorphism is not associated with altered CCR5 expression or coreceptor function. J. Virol. 73:2450.[Abstract/Free Full Text]
  57. Michael, N. L., L. G. Louie, A. L. Rohrbaugh, K. A. Schultz, D. E. Dayhoff, C. E. Wang, H. W. Sheppard. 1997. The role of CCR5 and CCR2 polymorphisms in HIV-1 transmission and disease progression. Nat. Med. 3:1160.[Medline]
  58. Smith, M. W., M. Dean, M. Carrington, C. Winkler, G. A. Huttley, D. A. Lomb, J. J. Goedert, T. R. O’Brien, L. P. Jacobson, R. Kaslow, et al 1997. Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression. Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study. Science 277:959.[Abstract/Free Full Text]
  59. Ruffing, N., N. Sullivan, L. Sharmeen, J. Sodroski, L. Wu. 1998. CCR5 has an expanded ligand-binding repertoire and is the primary receptor used by MCP-2 on activated T cells. Cell. Immunol. 189:160.[Medline]
  60. Agace, W. W., A. I. Roberts, L. Wu, C. Greineder, E. C. Ebert, C. M. Parker. 2000. Human intestinal lamina propria and intraepithelial lymphocytes express receptors specific for chemokines induced by inflammation. Eur. J. Immunol. 30:819.[Medline]
  61. Nieto, M., J. M. Frade, D. Sancho, M. Mellado, A. C. Martinez, F. Sanchez-Madrid. 1997. Polarization of chemokine receptors to the leading edge during lymphocyte chemotaxis. J. Exp. Med. 186:153.[Abstract/Free Full Text]
  62. Boring, L., J. Gosling, S. W. Chensue, S. L. Kunkel, Jr R. V. Farese, H. E. Broxmeyer, I. F. Charo. 1997. Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice. J. Clin. Invest. 100:2552.[Medline]
  63. Honda, Y., L. Rogers, K. Nakata, B. Y. Zhao, R. Pine, Y. Nakai, K. Kurosu, W. N. Rom, M. Weiden. 1998. Type I interferon induces inhibitory 16-kD CCAAT/enhancer binding protein (C/EBP){beta}, repressing the HIV-1 long terminal repeat in macrophages: pulmonary tuberculosis alters C/EBP expression, enhancing HIV-1 replication. J. Exp. Med. 188:1255.[Abstract/Free Full Text]
  64. Roux, P., C. Alfieri, M. Hrimech, E. A. Cohen, J. E. Tanner. 2000. Activation of transcription factors NF-{kappa}B and NF-IL-6 by human immunodeficiency virus type 1 protein R (Vpr) induces interleukin-8 expression. J. Virol. 74:4658.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
M. Mohan, P. P. Aye, J. T. Borda, X. Alvarez, and A. A. Lackner
CCAAT/Enhancer Binding Protein {beta} Is a Major Mediator of Inflammation and Viral Replication in the Gastrointestinal Tract of Simian Immunodeficiency Virus-Infected Rhesus Macaques
Am. J. Pathol., July 1, 2008; 173(1): 106 - 118.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. S. Weinberg, S. Barichievy, L. Schaffer, J. Han, and K. V. Morris
An RNA targeted to the HIV-1 LTR promoter modulates indiscriminate off-target gene activation
Nucleic Acids Res., December 18, 2007; 35(21): 7303 - 7312.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Mummidi, L. M. Adams, S. E. VanCompernolle, M. Kalkonde, J. F. Camargo, H. Kulkarni, A. S. Bellinger, G. Bonello, H. Tagoh, S. S. Ahuja, et al.
Production of Specific mRNA Transcripts, Usage of an Alternate Promoter, and Octamer-Binding Transcription Factors Influence the Surface Expression Levels of the HIV Coreceptor CCR5 on Primary T Cells
J. Immunol., May 1, 2007; 178(9): 5668 - 5681.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
R. K. Giri, V. Rajagopal, S. Shahi, B. V. Zlokovic, and V. K. Kalra
Mechanism of amyloid peptide induced CCR5 expression in monocytes and its inhibition by siRNA for Egr-1
Am J Physiol Cell Physiol, August 1, 2005; 289(2): C264 - C276.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Hu, Z. Wu, H. Jin, N. Hashimoto, T. Liu, and S. H. Phan
CCAAT/Enhancer-Binding Protein {beta} Isoforms and the Regulation of {alpha}-Smooth Muscle Actin Gene Expression by IL-1{beta}
J. Immunol., October 1, 2004; 173(7): 4661 - 4668.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. W. Georgantas III, V. Tanadve, M. Malehorn, S. Heimfeld, C. Chen, L. Carr, F. Martinez-Murillo, G. Riggins, J. Kowalski, and C. I. Civin
Microarray and Serial Analysis of Gene Expression Analyses Identify Known and Novel Transcripts Overexpressed in Hematopoietic Stem Cells
Cancer Res., July 1, 2004; 64(13): 4434 - 4441.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Moriuchi and H. Moriuchi
YY1 Transcription Factor Down-regulates Expression of CCR5, a Major Coreceptor for HIV-1
J. Biol. Chem., April 4, 2003; 278(15): 13003 - 13007.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Mo, J. Chen, Y. Han, C. Bueno-Cannizares, D. E. Misek, P. A. Lescure, S. Hanash, and R. L. Yung
T Cell Chemokine Receptor Expression in Aging
J. Immunol., January 15, 2003; 170(2): 895 - 904.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosati, M.
Right arrow Articles by Pavlakis, G. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosati, M.
Right arrow Articles by Pavlakis, G. N.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS