The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fischer, F. R.
Right arrow Articles by Dorf, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fischer, F. R.
Right arrow Articles by Dorf, M. E.
The Journal of Immunology, 2001, 167: 1637-1643.
Copyright © 2001 by The American Association of Immunologists

RANTES-Induced Chemokine Cascade in Dendritic Cells1

Falko R. Fischer2,*, Yi Luo*, Moli Luo*, Laura Santambrogio{dagger} and Martin E. Dorf3,*

* Department of Pathology, Harvard Medical School, and {dagger} Department of Cancer Immunology and AIDS, Dana Farber Cancer Institute, Boston, MA 02115


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Dendritic cells (DC) are the most potent APCs and the principal activators of naive T cells. We now report that chemokines can serve as activating agents for immature DC. Murine bone marrow-derived DC respond to the CC chemokine RANTES (10–100 ng/ml) by production of proinflammatory mediators. RANTES induces rapid expression of transcripts for the CXC chemokines KC and macrophage inflammatory protein (MIP)-2, the CC chemokines MIP-1{beta} and MIP-1{alpha}, and the cytokines TNF-{alpha} and IL-6. Synthesis of KC, IL-6, and TNF-{alpha} proteins were also demonstrated. After 4 h, autoinduction of RANTES transcripts was observed. These responses are chemokine specific. Although DC demonstrated weak responses to eotaxin, DC failed to respond to other chemokines including KC, MIP-2, stromal-derived factor-1{alpha}, MIP-1{beta}, MIP-1{alpha}, monocyte chemoattractant protein-1, T cell activation gene 3, or thymus-derived chemotactic agent 4. In addition, RANTES treatment up-regulated expression of an orphan chemokine receptor termed Eo1. Chemokine induction was also observed after treatment of splenic DC and neonatal microglia with RANTES, but not after treatment of thymocytes or splenocytes depleted of adherent cells. TNF-{alpha}-treated DC lose responsiveness to RANTES. DC from mice deficient for CCR1, CCR3, and CCR5 respond to RANTES, indicating that none of these receptors are exclusively used to initiate the chemokine cascade. RANTES-mediated chemokine amplification in DC may prolong inflammatory responses and shape the microenvironment, potentially enhancing acquired and innate immune responses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemokines are small chemoattractant cytokines that induce leukocyte accumulation at inflammatory sites or regulate leukocyte trafficking through lymphoid tissues. Based on the spacing of two cysteines in the N-terminal regions of the molecules, chemokines are grouped into different families, most notably the CC and CXC chemokines. RANTES, also termed CCL5, is a proinflammatory CC-chemokine that has an important role in multiple chronic inflammatory conditions. RANTES is the most potent natural inhibitor of M-trophic HIV-1 infection (1). Chemokines deliver signals through seven-transmembrane-spanning receptors (2, 3, 4). RANTES displays high affinity binding and signaling through multiple independent chemokine receptors including CCR1, CCR3, and CCR5 (5).

Dendritic cells (DC)4 are the most potent APCs and the principal activators of naive T cells. DC form a network of phenotypically and functionally distinct populations that initiate and differentially regulate immune responses in primary and secondary immune organs (6, 7, 8). The proper function of immune surveillance requires well-coordinated mechanisms to guide lymphocytes and APCs through peripheral tissues and into secondary lymphoid organs. After capture of Ag in the periphery, DC mature and modulate their chemokine receptor profile, down-regulating CCR1 and CCR5, which recognize RANTES and other proinflammatory chemokines, and up-regulating CCR7, which directs cells into the secondary lymphoid tissues (9). After stimulation DC migrate to the secondary lymphoid organs to initiate immune responses (9). Following exposure to proinflammatory cytokines or bacterial components like LPS, DC produce high amounts of different chemokines in a time-ordered fashion dependent on the nature of the stimulus (10, 11). These and other studies exploring selective chemokine production by DC (12, 13) suggest that temporally and spatially focused production of chemokines contribute to DC function during immune responses (11). We have now tested a panel of CC and CXC chemokines for their ability to induce chemokines in murine bone marrow-derived DC. DC selectively respond following RANTES stimulation by inducing an amplification cascade that results in the synthesis of several proinflammatory chemokines and cytokines.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

Female SJL/J or BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME). CCR1- and CCR3-deficient mice were bred on a mixed 129/BALB background (14, 15), whereas CCR2- and CCR5-deficient mice were on a mixed 129/C57BL background (16). Mice were maintained in accordance with guidelines of the Committee on Animals of the Harvard Medical School and those prepared by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources, National Research Council (Department of Health and Human Services Publication, NIH 85-23, 1985).

Reagents

Recombinant murine TNF-{alpha}, IL-1{beta}, RANTES, KC, macrophage inflammatory protein (MIP)-2, MIP-1{alpha}, MIP-1{beta}, eotaxin, and stromal-derived factor-1{alpha} were purchased from R&D Systems (Minneapolis, MN). Monocyte chemoattractant protein (MCP)-1 and TCA3 were purchased from BD PharMingen (San Diego, CA) and GM-CSF from RDI Research Diagnostics (Flanders, NJ). Recombinant mouse thymus-derived chemotactic agent 4 (TCA4) was prepared as detailed elsewhere (17). LPS was obtained from Sigma (St. Louis, MO). All chemokines were passed over Detoxi-Gel (Pierce, Rockford, IL) to reduce potential endotoxin contamination.

Preparation of bone marrow-derived DC

DC were prepared by the method of Lutz et al. (18) with some modifications. Femurs and tibiae of 6- to 12-wk-old SJL/J or BALB/c mice were aseptically removed and cleared from surrounding muscle. Chemokine-deficient mice were usually 8- to 20-wk old. After the bones were cut and placed in cold medium the marrow was flushed out with a syringe. The medium used for all cultures, designated complete medium (CM), was DMEM (Life Technologies, Grand Island, NY) supplemented with 5% heat-inactivated FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 10 mM HEPES buffer, and 1x nonessential amino acids (Sigma). Bone marrow was seeded at 5 x 106 leukocytes (no selection and no lysis of red cells) in a 100-mm petri dish (catalog no. 25384-208; VWR, West Chester, PA) in 8 ml CM with 15 ng/ml recombinant mouse GM-CSF for 3 days. Cells were fed with 8 ml CM containing 15 ng/ml GM-CSF on day 6. On day 8, 8 ml of medium was collected, the cell pellet was resuspended in 8 ml of the above medium, and the cells were returned to culture. Cells were also fed on days 10 and 12 as above, but the GM-CSF dose was reduced to 5 ng/ml. Alternatively, after red cell lysis with lysis buffer (Sigma) bone marrow cells were plated at a density of 0.75–1 x 106 cells/well in 24-well plates in CM with 5 ng/ml GM-CSF and fed every other day. On day 10 the dose of GM-CSF was reduced to 2.5 ng/ml. Nonadherent DC were usually collected on day 12 for chemokine induction assays. From both procedures the nonadherent cells at that time were a homogeneous population of large cells with long dendrites, which stained positively with Abs for CD11b, CD11c, DEC205 (similar to reported staining data; Ref. 18), and for the empty form of class II with KL304, an Ab specific for immature DC (19). The preparations of bone marrow-derived DC were not stained with anti-CD8. Contamination with granulocytes was <5% as detected by staining with anti-Ly-6G (BD PharMingen). All chemokine induction assays were performed in CM without serum, generally 0.8–1 x 106 DC were plated in a 12-well plate in 500 µl of medium (800 µl for overnight) plus the indicated concentrations of recombinant chemokine, cytokine, or LPS. Incubations were for 6 h or as indicated.

Preparation of splenic DC

Splenic DC were isolated from C57BL/6 mice ~12 days after s.c. injection of 1 x 106 Flt3 ligand-producing B16 tumor cells (20). Flt3 ligand-producing tumor stimulates a 100-fold increase in DC recovery from the spleen. Spleens were treated with 1 mg/ml collagenase (Sigma) mechanically disrupted using the rough ends of two microscope slides, and plated in tissue cultures dishes in CM. After a 2-h adherence, nonadherent cells were discarded and the remaining cells were cultured in 5 ng/ml GM-CSF in CM. After overnight culture nonadherent cells were highly enriched DC. These cells have an "immature" DC phenotype staining positively with Abs for CD11b, CD11c, DEC205, and for the empty form of class II with KL304. The splenic DC population was heterogeneous for CD8, ~50% of cells stained with anti-CD8 Ab.

Preparation of microglia

Mixed glial cell cultures were prepared as detailed previously (21). Microglia were harvested by shaking the cultures between days 20 and 26. The population stained positively for CD11b and CD45.

Preparation of thymocytes and splenocytes

Thymus and spleens of 6- to 8-wk-old SJL/J mice were removed and mechanically disrupted as detailed above but without collagenase treatment. Splenocytes and thymocytes were cleared from most macrophages by plastic adherence for 2 h and stimulated with chemokine or with Con A (2.5 µg/ml) for 6 h.

Preparation of RNA

RNA was extracted with TRIzol reagent (Life Technologies) according to the manufacturer’s protocol. The concentration of RNA was determined by spectroscopy at 260 nm. RNA samples were stored at -80°C.

RNase protection assay (RPA)

RPA was performed using the RiboQuant multiprobe RPA system (PharMingen, San Diego, CA) and the manufacture’s protocol. The chemokine template DNA sets consisted of lymphotactin, RANTES, eotaxin, MIP-1{alpha}, MIP-1{beta}, MIP-2, IP-10, MCP-1, TCA3, and two housekeeping genes: large ribosomal subunit protein 32-3A (L32) and GAPDH. A customized set of chemokine receptor templates detected housekeeping genes plus CCR1, CCR5, CXC chemokine receptor (CXCR) 4, CX3CR1, and the orphan receptor Eo1 (GenBank accession no. AF030185, AF316576). Briefly, a 32P(UTP)-labeled antisense RNA probe was prepared using T7 RNA polymerase. Target RNA (1.5–2.0 µg) was hybridized overnight followed by digestion of unprotected RNA with RNase. The treated RNA was extracted, and the samples were loaded onto an acrylamide/urea sequencing gel next to labeled probes that served as size markers. Gels were digitally scanned using a phosphoimager, and single bands were normalized based on densitometric values to one of the housekeeping genes using ImageQuant software with the "local average" background correction (Molecular Dynamics, Sunnyvale, CA).

RT-PCR

Single-stranded cDNA was synthesized from RNA using the Superscript Preamplification System for First Strand cDNA Synthesis (Life Technologies, Gaithersburg, MD) with the following modifications: 2 µg total RNA was treated with 2 U bovine pancreas DNase-I (Sigma) for 20 min at 25°C in an 18 µl volume containing 1x PCR buffer and 2 mM MgCl2. Enzyme was inactivated by incubation with 2 µl 25 mM EDTA at 65°C for 10 min. Random hexamers (3 µl) were added and annealed to the RNA at 70°C for 10 min. The reverse transcription reaction was performed according to the manufacturer’s protocol for a single reaction. One-half the reaction mix was moved to a different tube to serve as a no-reverse transcriptase control. The other aliquot was incubated with 100 U of SuperScript II reverse transcriptase. PCR was performed in a 20 µl reaction mixture with 0.5 µl cDNA, 0.5 µM of each primer, and the manufacturer’s Taq DNA polymerase conditions (Qiagen, Valencia, CA). The KC specific primers were GCGAATTCACCATGATCCCAGCCACCCG and GCTCTAGATTACTTGGGGACACCTTTTAG; the CCR7 specific primers were CTTCTGGAGGCCGCTGTAG and CTTCTGGAGGCCGCTGTAG; and the {beta}-glucuronidase primers were ATCCGAGGGAAAGGCTTCGAC and GAGCAGAGGAAGGCTCATTGG. The PCR program included preincubation at 94°C for 2 min, amplification with 30 cycles at 94°C for 45 s, annealing at 55°C for 45 s, extension at 72° for 45 s, and a final 72°C extension for 5 min. PCR products (6.5 µl) were visualized on 3% agarose minigels. cDNA from peritoneal exudate cells served as a positive control.

ELISA

DC (7 x 104) were cultured in 120 µl serum-free CM with the indicated amounts of chemokine, cytokine, or LPS in flat-bottom 96-well plates for 48 h. The anti-KC and anti-IL6 capture and biotinylated detection Abs were obtained from R&D Systems. Abs for quantitation of TNF-{alpha} were purchased from BD PharMingen. The ELISAs were performed in accordance with manufacture’s directions or as detailed previously (21, 22).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Proinflammatory cytokines and bacterial products are known to induce chemokine synthesis in DC. However, very little is known about how chemokines regulate production of other proinflammatory mediators in DC. We addressed this point by incubating mouse bone marrow-derived DC with different CXC and CC chemokines. Production of the mouse CXC chemokine, KC, was used as a read-out because it is a sensitive indicator of chemokine protein synthesis following stimulation with proinflammatory mediators (21, 23). LPS, TNF-{alpha}, and IL-1{beta} were used as positive controls inducing 29–146 ng/ml KC (Fig. 1GoA). RANTES was the only chemokine capable of inducing significant levels of KC protein synthesis (41–84 ng/ml). The other CC chemokines (TCA3, TCA4, MIP-1{alpha}, MIP-1{beta}, and MCP-1) and CXC (MIP-2, stromal-derived factor-1{alpha}) tested failed to induce KC. DC treated with GM-CSF, a growth factor that induces DC differentiation of bone marrow precursors, failed to induce KC synthesis. All reagents were pretreated with Detoxi-Gel to remove any contaminating endotoxin. In addition, a low dose of LPS (10 pg/ml) was included, as this is the highest level of contamination reported by the suppliers of the recombinant chemokine proteins. LPS (10 pg/ml) also failed to stimulate KC production, thereby excluding endotoxin contamination as responsible for these observations. The kinetics of KC induction by RANTES was investigated on the transcriptional level (Fig. 1GoB). Stimulation of DC with 100 ng/ml RANTES for 60 min was sufficient to induce KC transcripts as detected by RT-PCR. Optimal levels of PCR product were detected after 1.5–3 h.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. RANTES stimulates RNA and protein synthesis in DC. A, Comparison of the ability of different chemokines, cytokines, and LPS to induce the chemokine, KC, in cultures of bone marrow-derived DC. KC protein was in 48-h conditioned medium by ELISA. Error bars indicate SEM from four independent preparations of DC. LPS low indicates a dose of 10 pg/ml LPS; all other stimuli were used at 100 ng/ml. B, RT-PCR for KC and the {beta}-glucuronidase housekeeping gene from RANTES (100 ng/ml) stimulated bone marrow-derived DC. RNA samples were prepared after the indicated times of stimulation (min). Lane M, Medium control after a 3-h incubation.

 
As a second step we investigated whether RANTES was capable of inducing chemokines other than KC. MIP-2, MIP-1{beta}, and MIP-1{alpha} RNA were rapidly induced after RANTES stimulation for 1.5–3 h. In autocrine fashion, RANTES message was also up-regulated after 3–6 h (Fig. 2GoA). RANTES autoinduction was sustained and more pronounced after longer incubation periods (24 h) when induction of MIP-2, MIP-1{beta}, and MIP-1{alpha} had decreased (data not shown). This amplification of chemokine transcripts was mediated by a heat-labile ligand as boiled RANTES (100 ng/ml) failed to stimulate chemokine production (Fig. 2GoA). To determine the minimal dose required for chemokine induction DC were incubated with 1, 10, or 100 ng/ml RANTES (Fig. 2GoB). RPA analysis showed that MIP-2 transcripts were readily detected after stimulation with 10 ng/ml of RANTES, whereas detection of MIP-1{beta} or MIP-1{alpha} transcripts required higher ligand concentrations (100 ng/ml) (Fig. 2GoB).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. Kinetics and dose response for chemokine induction. A, RANTES (100 ng/ml) up-regulates RANTES, MIP-1{beta}, MIP-1{alpha}, and MIP-2 transcripts in DC as detected by RPA. "Media" lane, Medium control after a 3-h incubation. DC were harvested 1.5, 3, or 6 h after stimulation. "Boiled" lane, DC treated for 3 h with 100 ng/ml RANTES that had been boiled for 30 min. B, DC were treated with the indicated concentration of RANTES for 3 h and then harvested for RNA preparation. Relative intensities of protected bands were normalized vs the housekeeping gene GAPDH. C, DC were treated with 100 ng/ml of the indicated chemokine for 3–6 h and then harvested for RNA preparation. Data pooled from three experiments were expressed as the increase in relative intensity of protected bands normalized vs the medium control.

 
The specificity of DC chemokine induction was also examined at the transcriptional level. RPA was performed with RNA samples from DC stimulated with 100 ng/ml RANTES, eotaxin, MIP-1{alpha}, MIP-1{beta}, or TCA4. RANTES treatment increased chemokine RNA levels for MIP-2, MIP-1{alpha}, and MIP-1{beta} by 3.3- to 4.7-fold (Fig. 2GoC). Eotaxin also enhanced transcription (1.7- to 2.6-fold), but chemokine induction was consistently less potent than with RANTES. Incubation with MIP-1{alpha}, MIP-1{beta}, or TCA4 failed to up-regulate any of the chemokines assayed (Fig. 2GoC). In separate experiments, treatments with KC, MIP-2, and MCP-1 also failed to increase the levels of chemokine transcripts (data not shown).

Having shown that RANTES was capable of inducing chemokine expression in DC we next examined whether RANTES also stimulated cytokine expression. Rapid (3 h) up-regulation of IL-6 and TNF-{alpha} transcripts was noted (Fig. 3GoA). Boiled RANTES did not stimulate cytokine synthesis over control levels. The expression of TGF-{beta}1 did not significantly change after chemokine treatment indicating the selectivity of gene regulation. RANTES treatment also stimulated production of IL-6 and TNF-{alpha} proteins (Fig. 3Go, B and C). Incubation of DC with eotaxin stimulated synthesis of small amounts of IL-6 (150 pg/ml), but synthesis of TNF-{alpha} protein was not detected (Fig. 3Go, B and C). Stimulation with TCA4 failed to activate synthesis of either cytokine.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 3. RANTES induces cytokines. A, DC were treated with RANTES (100 ng/ml for 3 h) and then harvested for RNA preparation. Samples were tested by RPA. One group was treated with boiled RANTES as a control. Relative intensities of protected bands normalized vs the housekeeping gene GAPDH are presented. B, Comparisons of the ability of 100 ng/ml RANTES ({circ}), eotaxin (•), and TCA4 ({triangleup}) to release TNF-{alpha} protein in 48-h conditioned medium by ELISA. Data represent averages from two independent preparations of DC. C, Comparisons of the ability of 100 ng/ml RANTES ({circ}), eotaxin (•), and TCA4 ({blacktriangleup}) to release IL-6 protein in 48-h conditioned medium by ELISA. Data represent averages from 2–3 independent preparations of DC.

 
Changes in chemokine receptor expression during DC maturation promote the trafficking of DC from peripheral tissues to secondary lymphatic organs. We investigated whether RANTES was able to modulate chemokine receptor expression. Treatment of DC with 100 ng/ml RANTES for 4 h up-regulated transcription of Eo1 (Fig. 4Go). Eo1 (GenBank accession no. AF030185 and AF316576) is a polymorphic orphan chemokine receptor with 44–46% amino acid homology to the RANTES receptors CCR1, CCR3, and CCR5. Eo1 message was described as an inducible marker of an LPS-stimulated macrophage cell line (24). Normalized RPA data revealed a 7-fold up-regulation of Eo1 in DC following treatment with TNF-{alpha} (n = 3, p < 0.005), a 5-fold increase with RANTES (n = 4, p < 0.02), but no significant change in Eo1 expression following KC treatment. RNA levels for CCR1 and CCR5 did not change significantly after a 4-h TNF-{alpha} treatment as previously reported (11), but were reduced after 24 h (data not shown). There was a tendency for down-regulation of CXCR4 following RANTES and TNF-{alpha} treatment, but the values did not reach statistical significance.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 4. RANTES up-regulates the orphan receptor Eo1. Bone marrow-derived DC were stimulated with 100 ng/ml of the indicated stimulus for 4 h, then RNA was analyzed by RPA. A customized chemokine receptor template set was used (CCR1, CX3CR1, CXCR4, CCR5, and Eo1). One representative experiment of four is presented.

 
We next investigated whether RANTES-induced chemokine production could be observed in other cell types. Splenic DC were obtained from mice injected with a Flt3 ligand-producing melanoma. DC generated by this procedure express empty MHC class II molecules, a characteristic of immature DC (19). RNA from these splenic cells also exhibit very high background RANTES expression; however, after incubation with 100 ng/ml RANTES for 6 h MIP-2, MIP-1{beta}, and MIP-1{alpha} transcripts were up-regulated by 3- to 6-fold (Fig. 5Go). We also tested neonatal microglia because these APCs of the CNS exhibit some morphological and functional similarities with DC (25, 26, 27). Bone marrow-derived DC and microglia responded similarly following RANTES treatment, displaying 2- to 19-fold increases in chemokine transcripts (Fig. 5Go). In contrast, nonadherent thymocytes and splenocytes failed to respond to 100 ng/ml RANTES as measured by chemokine amplification. The same cells responded to treatment with Con A stimulation by induction of transcripts for lymphotactin, MIP-1{beta}, and MIP-1{alpha} (Fig. 5Go and data not shown), indicating that lymphocytes coordinate chemokine expression to other stimuli but not to these concentrations of RANTES.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 5. Tissue specificity. RNA samples from RANTES (100 ng/ml for 6 h)-treated splenic DC derived from C57BL/6 mice injected with a Flt3 ligand-producing B16 tumor line, neonatal SJL/J microglia cells, and SJL/J thymocytes were compared by RPA. One group of thymocytes was treated for 6 h with 2.5 µg/ml Con A.

 
Because the phenotype of the bone marrow-derived DC used for the above experiments was immature (GM-CSF derived) we next addressed the question whether TNF-{alpha}-exposed, mature DC also respond to RANTES. Bone marrow-derived DC were planted onto new petri dishes with the addition of 50 ng/ml TNF-{alpha} for 36–48 h. The data indicate mature DC lost RANTES responsiveness (Fig. 6Go). In contrast, responsiveness to TNF-{alpha} as measured by chemokine induction was still present following cytokine-induced DC maturation. It should be noted that under the above conditions TNF-{alpha}-matured DC down-regulated CCR1 and CCR5 RNA levels but message for CCR7 was up-regulated (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 6. Comparison of DC at different stages of maturation. Bone marrow-derived DC were plated in petri dishes containing 50 ng/ml TNF-{alpha} (mature) or 5 ng/ml GM-CSF (immature) for 2 days. DC were then incubated with 100 ng/ml TNF-{alpha}, RANTES, or the control chemokine KC for 6 or 24 h. DC were then harvested for RNA preparation and analyzed by RPA. The relative intensities of specific chemokine bands were calculated as a ratio of relative intensities to the medium controls.

 
To date, three distinct chemokine receptors have been clearly associated with RANTES binding: CCR1, CCR3, and CCR5 (28). Transcripts for all three receptors are expressed on mouse DC (Ref. 29 and Fig. 4Go). To determine whether one of these receptors was used exclusively for RANTES-induced chemokine amplification, DC from CCR1-, CCR3-, and CCR5-deficient mice were stimulated for 4 h with 100 ng/ml RANTES, TNF-{alpha} (positive control), or KC (negative control). RANTES stimulated chemokine transcripts in all chemokine receptor-deficient DC populations (Fig. 7GoA). Similarly, RANTES induced KC protein production in DC from CCR1-, CCR2-, CCR3-, and CCR5-deficient mice (Fig. 7Go, B and C). The combined data indicate that RANTES does not use a single chemokine receptor (CCR1, CCR3, or CCR5) to signal. But DC may signal through multiple independent receptors or may use an alternative receptor for induction of chemokine transcripts.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 7. RANTES stimulates DC from CCR1-, CCR3-, or CCR5-deficient mice. A, Bone marrow-derived DC from chemokine receptor-deficient mice were stimulated with medium or 100 ng/ml of TNF-{alpha}, RANTES, or KC for 4 h. Relative intensities of MIP-1{alpha} and MIP-2 vs the GAPDH housekeeping control are presented. B, DC derived from knockout mice were cultured 48 h with 100 ng/ml RANTES. The conditioned media were harvested and assayed for KC protein production by ELISA. C, Same as B, but DC from CCR2-deficient mice were included in this experiment.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DC are the sentinels of the immune system. DC located in peripheral tissues play a central role in immune surveillance. The majority of DC from the periphery share common characteristics, in particular the capacity to initiate innate immune responses (11). Functional DC activity requires the combination of phagocytic activity and the presence of non-Ag-specific recognition molecules, such as Toll-like receptors, complement receptors, or chemokine receptors. The synergism among all these molecules allows DC to phagocytize foreign Ags, recognize danger signals, and migrate to lymph nodes where they activate naive T cells. The full maturation of DC to competent APC is achieved during such migration. Chemokines and chemokine receptors play an important role in DC maturation (7, 11).

As part of their role in innate immunity DC are very efficient producers of cytokines and chemokines. LPS, TNF-{alpha}, and IL-1 are the classical stimuli for the induction of chemokines in DC. Until now chemokines were not considered to be a stimulus for further chemokine or cytokine release by DC. We now report that DC respond to RANTES by induction of chemokine and cytokine synthesis. RANTES was the only chemokine capable of stimulating potent activity among the panel of seven CC-chemokines and three CXC-chemokines tested. Treatment of DC with as little as 10 ng/ml RANTES induced KC, MIP-2, MIP-1{beta}, and MIP-1{alpha} transcripts and KC, IL-6, and TNF-{alpha} proteins. RANTES also acted in an autocrine fashion by inducing RANTES transcripts. Most chemokine transcripts were induced in 1–3 h. The rapid induction of these messages suggests that RANTES acts directly rather than through the production of TNF-{alpha} or other intermediates that could initiate chemokine synthesis. Eotaxin was a weak stimulus of chemokine mRNA and triggered little or nondetectable levels of cytokine proteins.

This is the first report to demonstrate autocrine chemokine regulation in DC. The autocrine production of RANTES indicates the potential involvement of this chemokine in an amplification cascade. Evidence for autocrine regulation of chemokines has been observed in a variety of cell types including endothelial cells (30), monocytes (31), mesangial cells (23), and astrocytes (21). All of these systems describe the autocrine activity of a CXC chemokine, KC, or homologous molecules (IL-8 and growth-related oncogene-{alpha}). It should be noted that KC failed to induce chemokine synthesis in mouse DC. Very few reports (32, 33) implicated CC chemokines in autocrine pathways, but the activity of RANTES was not examined in the latter studies.

The ability of RANTES to induce a chemokine cascade appears to be cell type-specific. Immature DC and microglia possess this capacity, whereas thymocytes and splenic lymphocytes did not respond as monitored by chemokine production even though many T cells also express functional RANTES receptors. It has been reported that 100-fold higher RANTES concentrations (>=1 µM) stimulate proliferation, cytokine release, and tyrosine kinase signaling in human T cells (34, 35), but the physiologic significance of T cell responses to micromolar concentrations of chemokine remains unknown.

The DC receptor(s) responsible for these responses remain undefined. CCR1, CCR3, and CCR5 can each recognize the RANTES ligand, and all three receptors are expressed on DC (5). CCR2, CCR3, and CCR5 also interact with eotaxin (36). Although MIP-1{alpha} and MIP-1{beta} are structurally homologous to RANTES and also bind CCR1 and CCR5 with high affinity (4), they failed to stimulate chemokine or cytokine synthesis. Thus, the exquisite specificity of the RANTES response by immature DC suggests the receptor-ligand interactions are unique. DC from mice genetically deficient for CCR1, CCR3, or CCR5 responded normally following RANTES stimulation. Thus, the possibility of a novel RANTES receptor remains although the combined signals of multiple redundant CCRs may also elicit these DC responses.

DC resident in the peripheral tissues express CCR1 and CCR5; upon cytokine-induced maturation these receptors are lost (9, 10). The loss of RANTES responsiveness in TNF-{alpha}-matured DC (Fig. 6Go) may be related to the fact that multiple RANTES receptors including CCR1 and CCR5 were down-regulated, thereby potentially reducing ligand binding.

As RANTES treatment did not induce CCR7 this chemokine may not be sufficient to drive DC maturation to completion (data not shown). Although the amounts of TNF-{alpha} produced by the RANTES amplification pathway are insufficient to drive DC maturation, they may contribute to the cytokine threshold required for DC maturation. This scenario offers a self-limiting model in which RANTES facilitates DC maturation and migration from inflammatory sites, but additional factors are needed to push DC maturation to completion.

RANTES treatment induces numerous changes in DC including modulation of receptor transcripts. Four hours following RANTES stimulation DC acquire transcripts for a novel orphan chemokine receptor termed Eo1. Experiments to define a chemokine ligand for the Eo1 receptor are underway.

The selective response of immature DC to RANTES could have a role in the induction, perpetuation, and exacerbation of inflammatory and allergic diseases. In this respect RANTES antagonists may be promising targets for the therapy of acute and chronic disease.


    Acknowledgments
 
We thank Dr. Glenn Dranoff (Dana-Farber Cancer Institute, Boston, MA) for kindly providing the Flt3 ligand-transfected B16 tumor lines, and Dr. Craig Gerard (Children’s Hospital, Boston, MA) and Dr. William Kuziel (University of Texas, Austin, TX) for kindly providing the chemokine receptor-deficient mice.


    Footnotes
 
1 This study was supported in part by National Institutes of Health Grants NS37284 and CA67416 and the Harvard-Hoechst Marion Roussel Program. Back

2 Current address: Department of Neurology, Justus-Liebig University, Am Steg 14, 35385 Giessen, Germany. Back

3 Address correspondence and reprint requests to Dr. Martin E. Dorf, Department of Pathology, Harvard Medical School, Armenise Building D-530, 200 Longwood Avenue, Boston, MA 02115. E-mail address: dorf{at}hms.harvard.edu Back

4 Abbreviations used in this paper: DC, dendritic cells; CM, complete medium; MIP, macrophage inflammatory protein; RPA, RNase protection assay; TCA3, T cell activation gene 3; TCA4, thymus-derived chemotactic agent 4; MCP, monocyte chemoattractant protein; CXCR, CXC chemokine receptor. Back

Received for publication January 17, 2001. Accepted for publication May 23, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo, P. Lusso. 1995. Identification of RANTES, MIP-1{alpha}, and MIP-1{beta} as the major HIV-suppressive factors produced by CD8+ T cells. Science 270:1811.[Abstract/Free Full Text]
  2. Baggiolini, M.. 1998. Chemokines and leukocyte traffic. Nature 392:565.[Medline]
  3. Luster, A. D.. 1998. Chemokines: chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338:436.[Free Full Text]
  4. Zlotnik, A., O. Yoshie. 2000. Chemokines: a new classification system and their role in immunity. Immunity 12:121.[Medline]
  5. Ayehunie, S., E. A. Garcia-Zepeda, J. A. Hoxie, R. Horuk, T. S. Kupper, A. D. Luster, R. M. Ruprecht. 1997. Human immunodeficiency virus-1 entry into purified blood dendritic cells through CC and CXC chemokine coreceptors. Blood 90:1379.[Abstract/Free Full Text]
  6. Peters, J. H., R. Gieseler, B. Thiele, F. Steinbach. 1996. Dendritic cells: from ontogenetic orphans to myelomonocytic descendants. Immunol. Today 17:273.[Medline]
  7. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  8. Reid, S. D., G. Penna, L. Adorini. 2000. The control of T cell responses by dendritic cell subsets. Curr. Opin. Immunol. 12:114.[Medline]
  9. Sallusto, F., P. Schaerli, P. Loetscher, C. Schaniel, D. Lenig, C. R. Mackay, S. Qin, A. Lanzavecchia. 1998. Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur. J. Immunol. 28:2760.[Medline]
  10. Sallusto, F., B. Palermo, D. Lenig, M. Miettinen, S. Matikainen, I. Julkunen, R. Forster, R. Burgstahler, M. Lipp, A. Lanzavecchia. 1999. Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur. J. Immunol. 29:1617.[Medline]
  11. Sallusto, F., C. R. Mackay, A. Lanzavecchia. 2000. The role of chemokine receptors in primary, effector, and memory immune responses. Annu. Rev. Immunol. 18:593.[Medline]
  12. Adema, G. J., F. Hartgers, R. Verstraten, E. de Vries, G. Marland, S. Menon, J. Foster, Y. Xu, P. Nooyen, T. McClanahan, et al 1997. A dendritic-cell-derived C-C chemokine that preferentially attracts naive T cells. Nature 387:713.[Medline]
  13. Lieberam, I., I. Forster. 1999. The murine {beta}-chemokine TARC is expressed by subsets of dendritic cells and attracts primed CD4+ T cells. Eur. J. Immunol. 29:2684.[Medline]
  14. Shi, H. Z., A. Humbles, C. Gerard, Z. Jin, P. F. Weller. 2000. Lymph node trafficking and antigen presentation by endobronchial eosinophils. J. Clin. Invest. 105:945.[Medline]
  15. Gerard, C., J. L. Frossard, M. Bhatia, A. Saluja, N. P. Gerard, B. Lu, M. Steer. 1997. Targeted disruption of the {beta}-chemokine receptor CCR1 protects against pancreatitis-associated lung injury. J. Clin. Invest. 100:2022.[Medline]
  16. Sato, N., S. K. Ahuja, M. Quinones, V. Kostecki, R. L. Reddick, P. C. Melby, W. A. Kuziel, S. S. Ahuja. 2000. CC chemokine receptor (CCR)2 is required for Langerhans cell migration and localization of T helper cell type 1 (Th1)-inducing dendritic cells: absence of CCR2 shifts the Leishmania major-resistant phenotype to a susceptible state dominated by Th2 cytokines, B cell outgrowth, and sustained neutrophilic inflammation. J. Exp. Med. 192:205.[Abstract/Free Full Text]
  17. Tanabe, S., Z. Lu, Y. Luo, E. J. Quackenbush, M. A. Berman, L. A. Collins-Racie, S. Mi, C. Reilly, D. Lo, K. A. Jacobs, M. E. Dorf. 1997. Identification of a new mouse {beta}-chemokine, thymus-derived chemotactic agent 4, with activity on T lymphocytes and mesangial cells. J. Immunol. 159:5671.[Abstract]
  18. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223:77.[Medline]
  19. Santambrogio, L., A. K. Sato, F. R. Fischer, M. E. Dorf, L. J. Stern. 1999. Abundant empty class II MHC molecules on the surface of immature dendritic cells. Proc. Natl. Acad. Sci. USA 96:15050.[Abstract/Free Full Text]
  20. Mach, N., S. Gillessen, S. B. Wilson, C. Sheehan, M. Mihm, G. Dranoff. 2000. Differences in dendritic cells stimulated in vivo by tumors engineered to secrete granulocyte-macrophage colony-stimulating factor or Flt3-ligand. Cancer Res. 60:3239.[Abstract/Free Full Text]
  21. Luo, Y., F. R. Fischer, W. W. Hancock, M. E. Dorf. 2000. Macrophage inflammatory protein-2 and KC induce chemokine production by mouse astrocytes. J. Immunol. 165:4015.[Abstract/Free Full Text]
  22. Abromson-Leeman, S., E. Maverakis, R. Bronson, M. E. Dorf. 2001. CD40-mediated activation of T cells accelerates, but is not required for, encephalitogenic potential of myelin basic protein-recognizing T cells in a model of progressive experimental autoimmune encephalomyelitis. Eur. J. Immunol. 31:527.[Medline]
  23. Luo, Y., C. Lloyd, J. C. Gutierrez-Ramos, M. E. Dorf. 1999. Chemokine amplification in mesangial cells. J. Immunol. 163:3985.[Abstract/Free Full Text]
  24. Shimada, T., M. Matsumoto, Y. Tatsumi, A. Kanamaru, S. Akira. 1998. A novel lipopolysaccharide inducible C-C chemokine receptor related gene in murine macrophages. FEBS Lett. 425:490.[Medline]
  25. Ulvestad, E., K. Williams, R. Bjerkvig, K. Tiekotter, J. Antel, R. Matre. 1994. Human microglial cells have phenotypic and functional characteristics in common with both macrophages and dendritic antigen-presenting cells. J. Leukocyte Biol. 56:732.[Abstract]
  26. Carson, M. J., C. R. Reilly, J. G. Sutcliffe, D. Lo. 1998. Mature microglia resemble immature antigen-presenting cells. Glia 22:72.[Medline]
  27. Fischer, H. G., A. K. Bielinsky. 1999. Antigen presentation function of brain-derived dendriform cells depends on astrocyte help. Int. Immunol. 11:1265.[Abstract/Free Full Text]
  28. Zlotnik, A., J. Morales, J. A. Hedrick. 1999. Recent advances in chemokines and chemokine receptors. Crit. Rev. Immunol. 19:1.[Medline]
  29. Foti, M., F. Granucci, D. Aggujaro, E. Liboi, W. Luini, S. Minardi, A. Mantovani, S. Sozzani, P. Ricciardi-Castagnoli. 1999. Upon dendritic cell (DC) activation chemokines and chemokine receptor expression are rapidly regulated for recruitment and maintenance of DC at the inflammatory site. Int. Immunol. 11:979.[Abstract/Free Full Text]
  30. Wen, D. Z., A. Rowland, R. Derynck. 1989. Expression and secretion of GRO/MGSA by stimulated human endothelial cells. EMBO J. 8:1761.[Medline]
  31. Browning, D. D., W. C. Diehl, M. H. Hsu, I. U. Schraufstatter, R. D. Ye. 2000. Autocrine regulation of interleukin-8 production in human monocytes. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1129.[Abstract/Free Full Text]
  32. McManus, C. M., K. Weidenheim, S. E. Woodman, J. Nunez, J. Hesselgesser, A. Nath, J. W. Berman. 2000. Chemokine and chemokine-receptor expression in human glial elements: induction by the HIV protein, Tat, and chemokine autoregulation. Am. J. Pathol. 156:1441.[Abstract/Free Full Text]
  33. Saito, H., H. Shimizu, K. Akiyama. 2000. Autocrine regulation of eotaxin in normal human bronchial epithelial cells. Int. Arch. Allergy Immunol. 122:(Suppl. 1):50.
  34. Bacon, K. B., B. A. Premack, P. Gardner, T. J. Schall. 1995. Activation of dual T cell signaling pathways by the chemokine RANTES. Science 269:1727.[Abstract/Free Full Text]
  35. Appay, V., P. R. Dunbar, V. Cerundolo, A. McMichael, L. Czaplewski, S. Rowland-Jones. 2000. RANTES activates antigen-specific cytotoxic T lymphocytes in a mitogen-like manner through cell surface aggregation. Int. Immunol. 12:1173.[Abstract/Free Full Text]
  36. Ogilvie, P., G. Bardi, I. Clark-Lewis, M. Baggiolini, M. Uguccioni. 2001. Eotaxin is a natural antagonist for CCR2 and an agonist for CCR5. Blood 97:1920.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. R. Beaty, C. E. Rose Jr., and S.-s. J. Sung
Diverse and Potent Chemokine Production by Lung CD11bhigh Dendritic Cells in Homeostasis and in Allergic Lung Inflammation
J. Immunol., February 1, 2007; 178(3): 1882 - 1895.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Chabot, P. Reverdiau, S. Iochmann, A. Rico, D. Senecal, C. Goupille, P.-Y. Sizaret, and L. Sensebe
CCL5-enhanced human immature dendritic cell migration through the basement membrane in vitro depends on matrix metalloproteinase-9
J. Leukoc. Biol., April 1, 2006; 79(4): 767 - 778.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G.-X. Zhang, S. Yu, B. Gran, and A. Rostami
Glucosamine Abrogates the Acute Phase of Experimental Autoimmune Encephalomyelitis by Induction of Th2 Response
J. Immunol., December 1, 2005; 175(11): 7202 - 7208.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. Nishina, F. Zhang, L. D. Nielsen, K. Edeen, J. Wang, and R. J. Mason
Expression of CINC-2{beta} Is Related to the State of Differentiation of Alveolar Epithelial Cells
Am. J. Respir. Cell Mol. Biol., November 1, 2005; 33(5): 505 - 512.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Varani, G. Frascaroli, M. Homman-Loudiyi, S. Feld, M. P. Landini, and C. Soderberg-Naucler
Human cytomegalovirus inhibits the migration of immature dendritic cells by down-regulating cell-surface CCR1 and CCR5
J. Leukoc. Biol., February 1, 2005; 77(2): 219 - 228.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. W. DePaolo, R. Lathan, and W. J. Karpus
CCR5 Regulates High Dose Oral Tolerance by Modulating CC Chemokine Ligand 2 Levels in the GALT
J. Immunol., July 1, 2004; 173(1): 314 - 320.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. Gross, C. A. Amella, L. Pompucci, G. Franchin, B. Sherry, and H. Schmidtmayerova
Macrophages and lymphocytes differentially modulate the ability of RANTES to inhibit HIV-1 infection
J. Leukoc. Biol., November 1, 2003; 74(5): 781 - 790.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G.-X. Zhang, S. Yu, B. Gran, J. Li, I. Siglienti, X. Chen, D. Calida, E. Ventura, M. Kamoun, and A. Rostami
Role of IL-12 Receptor {beta}1 in Regulation of T Cell Response by APC in Experimental Autoimmune Encephalomyelitis
J. Immunol., November 1, 2003; 171(9): 4485 - 4492.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Skelton, M. Cooper, M. Murphy, and A. Platt
Human Immature Monocyte-Derived Dendritic Cells Express the G Protein-Coupled Receptor GPR105 (KIAA0001, P2Y14) and Increase Intracellular Calcium in Response to its Agonist, Uridine Diphosphoglucose
J. Immunol., August 15, 2003; 171(4): 1941 - 1949.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Walzer, A. Marcais, F. Saltel, C. Bella, P. Jurdic, and J. Marvel
Cutting Edge: Immediate RANTES Secretion by Resting Memory CD8 T Cells Following Antigenic Stimulation
J. Immunol., February 15, 2003; 170(4): 1615 - 1619.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
V. J. Cavanaugh, Y. Deng, M. P. Birkenbach, J. S. Slater, and A. E. Campbell
Vigorous Innate and Virus-Specific Cytotoxic T-Lymphocyte Responses to Murine Cytomegalovirus in the Submaxillary Salivary Gland
J. Virol., February 1, 2003; 77(3): 1703 - 1717.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fischer, F. R.
Right arrow Articles by Dorf, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fischer, F. R.
Right arrow Articles by Dorf, M. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS