|
|
||||||||

*
Department of Pathology, Harvard Medical School, and
Department of Cancer Immunology and AIDS, Dana Farber Cancer Institute, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
and MIP-1
, and the
cytokines TNF-
and IL-6. Synthesis of KC, IL-6, and TNF-
proteins
were also demonstrated. After 4 h, autoinduction of RANTES transcripts
was observed. These responses are chemokine specific. Although DC
demonstrated weak responses to eotaxin, DC failed to respond to other
chemokines including KC, MIP-2, stromal-derived factor-1
, MIP-1
,
MIP-1
, monocyte chemoattractant protein-1, T cell activation gene 3,
or thymus-derived chemotactic agent 4. In addition, RANTES treatment
up-regulated expression of an orphan chemokine receptor termed Eo1.
Chemokine induction was also observed after treatment of splenic DC and
neonatal microglia with RANTES, but not after treatment of thymocytes
or splenocytes depleted of adherent cells. TNF-
-treated DC lose
responsiveness to RANTES. DC from mice deficient for CCR1, CCR3, and
CCR5 respond to RANTES, indicating that none of these receptors are
exclusively used to initiate the chemokine cascade. RANTES-mediated
chemokine amplification in DC may prolong inflammatory responses and
shape the microenvironment, potentially enhancing acquired and innate
immune responses. | Introduction |
|---|
|
|
|---|
Dendritic cells (DC)4 are the most potent APCs and the principal activators of naive T cells. DC form a network of phenotypically and functionally distinct populations that initiate and differentially regulate immune responses in primary and secondary immune organs (6, 7, 8). The proper function of immune surveillance requires well-coordinated mechanisms to guide lymphocytes and APCs through peripheral tissues and into secondary lymphoid organs. After capture of Ag in the periphery, DC mature and modulate their chemokine receptor profile, down-regulating CCR1 and CCR5, which recognize RANTES and other proinflammatory chemokines, and up-regulating CCR7, which directs cells into the secondary lymphoid tissues (9). After stimulation DC migrate to the secondary lymphoid organs to initiate immune responses (9). Following exposure to proinflammatory cytokines or bacterial components like LPS, DC produce high amounts of different chemokines in a time-ordered fashion dependent on the nature of the stimulus (10, 11). These and other studies exploring selective chemokine production by DC (12, 13) suggest that temporally and spatially focused production of chemokines contribute to DC function during immune responses (11). We have now tested a panel of CC and CXC chemokines for their ability to induce chemokines in murine bone marrow-derived DC. DC selectively respond following RANTES stimulation by inducing an amplification cascade that results in the synthesis of several proinflammatory chemokines and cytokines.
| Materials and Methods |
|---|
|
|
|---|
Female SJL/J or BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME). CCR1- and CCR3-deficient mice were bred on a mixed 129/BALB background (14, 15), whereas CCR2- and CCR5-deficient mice were on a mixed 129/C57BL background (16). Mice were maintained in accordance with guidelines of the Committee on Animals of the Harvard Medical School and those prepared by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources, National Research Council (Department of Health and Human Services Publication, NIH 85-23, 1985).
Reagents
Recombinant murine TNF-
, IL-1
, RANTES, KC, macrophage
inflammatory protein (MIP)-2, MIP-1
, MIP-1
, eotaxin, and
stromal-derived factor-1
were purchased from R&D Systems
(Minneapolis, MN). Monocyte chemoattractant protein (MCP)-1 and
TCA3 were purchased from BD PharMingen (San Diego, CA) and
GM-CSF from RDI Research Diagnostics (Flanders, NJ). Recombinant mouse
thymus-derived chemotactic agent 4 (TCA4) was prepared as detailed
elsewhere (17). LPS was obtained from Sigma (St. Louis,
MO). All chemokines were passed over Detoxi-Gel (Pierce, Rockford, IL)
to reduce potential endotoxin contamination.
Preparation of bone marrow-derived DC
DC were prepared by the method of Lutz et al. (18) with some modifications. Femurs and tibiae of 6- to 12-wk-old SJL/J or BALB/c mice were aseptically removed and cleared from surrounding muscle. Chemokine-deficient mice were usually 8- to 20-wk old. After the bones were cut and placed in cold medium the marrow was flushed out with a syringe. The medium used for all cultures, designated complete medium (CM), was DMEM (Life Technologies, Grand Island, NY) supplemented with 5% heat-inactivated FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 10 mM HEPES buffer, and 1x nonessential amino acids (Sigma). Bone marrow was seeded at 5 x 106 leukocytes (no selection and no lysis of red cells) in a 100-mm petri dish (catalog no. 25384-208; VWR, West Chester, PA) in 8 ml CM with 15 ng/ml recombinant mouse GM-CSF for 3 days. Cells were fed with 8 ml CM containing 15 ng/ml GM-CSF on day 6. On day 8, 8 ml of medium was collected, the cell pellet was resuspended in 8 ml of the above medium, and the cells were returned to culture. Cells were also fed on days 10 and 12 as above, but the GM-CSF dose was reduced to 5 ng/ml. Alternatively, after red cell lysis with lysis buffer (Sigma) bone marrow cells were plated at a density of 0.751 x 106 cells/well in 24-well plates in CM with 5 ng/ml GM-CSF and fed every other day. On day 10 the dose of GM-CSF was reduced to 2.5 ng/ml. Nonadherent DC were usually collected on day 12 for chemokine induction assays. From both procedures the nonadherent cells at that time were a homogeneous population of large cells with long dendrites, which stained positively with Abs for CD11b, CD11c, DEC205 (similar to reported staining data; Ref. 18), and for the empty form of class II with KL304, an Ab specific for immature DC (19). The preparations of bone marrow-derived DC were not stained with anti-CD8. Contamination with granulocytes was <5% as detected by staining with anti-Ly-6G (BD PharMingen). All chemokine induction assays were performed in CM without serum, generally 0.81 x 106 DC were plated in a 12-well plate in 500 µl of medium (800 µl for overnight) plus the indicated concentrations of recombinant chemokine, cytokine, or LPS. Incubations were for 6 h or as indicated.
Preparation of splenic DC
Splenic DC were isolated from C57BL/6 mice
12 days after s.c.
injection of 1 x 106 Flt3 ligand-producing
B16 tumor cells (20). Flt3 ligand-producing tumor
stimulates a 100-fold increase in DC recovery from the spleen. Spleens
were treated with 1 mg/ml collagenase (Sigma) mechanically disrupted
using the rough ends of two microscope slides, and plated in tissue
cultures dishes in CM. After a 2-h adherence, nonadherent cells were
discarded and the remaining cells were cultured in 5 ng/ml GM-CSF in
CM. After overnight culture nonadherent cells were highly enriched DC.
These cells have an "immature" DC phenotype staining positively
with Abs for CD11b, CD11c, DEC205, and for the empty form of class II
with KL304. The splenic DC population was heterogeneous for CD8,
50% of cells stained with anti-CD8 Ab.
Preparation of microglia
Mixed glial cell cultures were prepared as detailed previously (21). Microglia were harvested by shaking the cultures between days 20 and 26. The population stained positively for CD11b and CD45.
Preparation of thymocytes and splenocytes
Thymus and spleens of 6- to 8-wk-old SJL/J mice were removed and mechanically disrupted as detailed above but without collagenase treatment. Splenocytes and thymocytes were cleared from most macrophages by plastic adherence for 2 h and stimulated with chemokine or with Con A (2.5 µg/ml) for 6 h.
Preparation of RNA
RNA was extracted with TRIzol reagent (Life Technologies) according to the manufacturers protocol. The concentration of RNA was determined by spectroscopy at 260 nm. RNA samples were stored at -80°C.
RNase protection assay (RPA)
RPA was performed using the RiboQuant multiprobe RPA system
(PharMingen, San Diego, CA) and the manufactures protocol. The
chemokine template DNA sets consisted of lymphotactin, RANTES, eotaxin,
MIP-1
, MIP-1
, MIP-2, IP-10, MCP-1, TCA3, and two housekeeping
genes: large ribosomal subunit protein 32-3A (L32) and GAPDH. A
customized set of chemokine receptor templates detected housekeeping
genes plus CCR1, CCR5, CXC chemokine receptor (CXCR) 4, CX3CR1, and the
orphan receptor Eo1 (GenBank accession no. AF030185, AF316576).
Briefly, a 32P(UTP)-labeled antisense RNA probe
was prepared using T7 RNA polymerase. Target RNA (1.52.0 µg) was
hybridized overnight followed by digestion of unprotected RNA with
RNase. The treated RNA was extracted, and the samples were loaded onto
an acrylamide/urea sequencing gel next to labeled probes that served as
size markers. Gels were digitally scanned using a phosphoimager, and
single bands were normalized based on densitometric values to one of
the housekeeping genes using ImageQuant software with the "local
average" background correction (Molecular Dynamics, Sunnyvale,
CA).
RT-PCR
Single-stranded cDNA was synthesized from RNA using the
Superscript Preamplification System for First Strand cDNA Synthesis
(Life Technologies, Gaithersburg, MD) with the following modifications:
2 µg total RNA was treated with 2 U bovine pancreas DNase-I (Sigma)
for 20 min at 25°C in an 18 µl volume containing 1x PCR buffer and
2 mM MgCl2. Enzyme was inactivated by incubation
with 2 µl 25 mM EDTA at 65°C for 10 min. Random hexamers (3 µl)
were added and annealed to the RNA at 70°C for 10 min. The reverse
transcription reaction was performed according to the manufacturers
protocol for a single reaction. One-half the reaction mix
was moved to a different tube to serve as a no-reverse
transcriptase control. The other aliquot was incubated with 100
U of SuperScript II reverse transcriptase. PCR was performed in a 20
µl reaction mixture with 0.5 µl cDNA, 0.5 µM of each primer, and
the manufacturers Taq DNA polymerase conditions
(Qiagen, Valencia, CA). The KC specific primers were
GCGAATTCACCATGATCCCAGCCACCCG and
GCTCTAGATTACTTGGGGACACCTTTTAG; the CCR7 specific primers were
CTTCTGGAGGCCGCTGTAG and CTTCTGGAGGCCGCTGTAG; and the
-glucuronidase primers were ATCCGAGGGAAAGGCTTCGAC and
GAGCAGAGGAAGGCTCATTGG. The PCR program included preincubation at
94°C for 2 min, amplification with 30 cycles at 94°C for 45 s,
annealing at 55°C for 45 s, extension at 72° for 45 s,
and a final 72°C extension for 5 min. PCR products (6.5 µl) were
visualized on 3% agarose minigels. cDNA from peritoneal exudate cells
served as a positive control.
ELISA
DC (7 x 104) were cultured in 120
µl serum-free CM with the indicated amounts of chemokine, cytokine,
or LPS in flat-bottom 96-well plates for 48 h. The anti-KC and
anti-IL6 capture and biotinylated detection Abs were obtained from
R&D Systems. Abs for quantitation of TNF-
were purchased from BD
PharMingen. The ELISAs were performed in accordance with manufactures
directions or as detailed previously (21, 22).
| Results |
|---|
|
|
|---|
, and
IL-1
were used as positive controls inducing 29146 ng/ml KC (Fig. 1
, MIP-1
, and MCP-1) and CXC (MIP-2, stromal-derived
factor-1
) tested failed to induce KC. DC treated with GM-CSF, a
growth factor that induces DC differentiation of bone marrow
precursors, failed to induce KC synthesis. All reagents were pretreated
with Detoxi-Gel to remove any contaminating endotoxin. In addition, a
low dose of LPS (10 pg/ml) was included, as this is the highest level
of contamination reported by the suppliers of the recombinant chemokine
proteins. LPS (10 pg/ml) also failed to stimulate KC production,
thereby excluding endotoxin contamination as responsible for these
observations. The kinetics of KC induction by RANTES was investigated
on the transcriptional level (Fig. 1
|
, and MIP-1
RNA were
rapidly induced after RANTES stimulation for 1.53 h. In autocrine
fashion, RANTES message was also up-regulated after 36 h (Fig. 2
, and MIP-1
had decreased (data not
shown). This amplification of chemokine transcripts was mediated by a
heat-labile ligand as boiled RANTES (100 ng/ml) failed to stimulate
chemokine production (Fig. 2
or MIP-1
transcripts required
higher ligand concentrations (100 ng/ml) (Fig. 2
|
, MIP-1
, or TCA4.
RANTES treatment increased chemokine RNA levels for MIP-2, MIP-1
,
and MIP-1
by 3.3- to 4.7-fold (Fig. 2
, MIP-1
, or TCA4 failed to up-regulate any of the chemokines
assayed (Fig. 2
Having shown that RANTES was capable of inducing chemokine expression
in DC we next examined whether RANTES also stimulated cytokine
expression. Rapid (3 h) up-regulation of IL-6 and TNF-
transcripts
was noted (Fig. 3
A). Boiled
RANTES did not stimulate cytokine synthesis over control levels. The
expression of TGF-
1 did not significantly change after chemokine
treatment indicating the selectivity of gene regulation. RANTES
treatment also stimulated production of IL-6 and TNF-
proteins (Fig. 3
, B and C). Incubation of DC with eotaxin
stimulated synthesis of small amounts of IL-6 (150 pg/ml), but
synthesis of TNF-
protein was not detected (Fig. 3
, B and
C). Stimulation with TCA4 failed to activate synthesis of
either cytokine.
|
(n = 3, p < 0.005), a 5-fold
increase with RANTES (n = 4, p <
0.02), but no significant change in Eo1 expression following KC
treatment. RNA levels for CCR1 and CCR5 did not change significantly
after a 4-h TNF-
treatment as previously reported (11),
but were reduced after 24 h (data not shown). There was a tendency
for down-regulation of CXCR4 following RANTES and TNF-
treatment,
but the values did not reach statistical significance.
|
, and
MIP-1
transcripts were up-regulated by 3- to 6-fold (Fig. 5
, and MIP-1
(Fig. 5
|
-exposed, mature DC also respond to RANTES.
Bone marrow-derived DC were planted onto new petri dishes with the
addition of 50 ng/ml TNF-
for 3648 h. The data indicate mature DC
lost RANTES responsiveness (Fig. 6
as measured by chemokine induction
was still present following cytokine-induced DC maturation. It should
be noted that under the above conditions TNF-
-matured DC
down-regulated CCR1 and CCR5 RNA levels but message for CCR7 was
up-regulated (data not shown).
|
(positive
control), or KC (negative control). RANTES stimulated chemokine
transcripts in all chemokine receptor-deficient DC populations (Fig. 7
|
| Discussion |
|---|
|
|
|---|
As part of their role in innate immunity DC are very efficient
producers of cytokines and chemokines. LPS, TNF-
, and IL-1 are the
classical stimuli for the induction of chemokines in DC. Until now
chemokines were not considered to be a stimulus for further chemokine
or cytokine release by DC. We now report that DC respond to RANTES by
induction of chemokine and cytokine synthesis. RANTES was the only
chemokine capable of stimulating potent activity among the panel of
seven CC-chemokines and three CXC-chemokines tested. Treatment of DC
with as little as 10 ng/ml RANTES induced KC, MIP-2, MIP-1
, and
MIP-1
transcripts and KC, IL-6, and TNF-
proteins. RANTES also
acted in an autocrine fashion by inducing RANTES transcripts. Most
chemokine transcripts were induced in 13 h. The rapid induction of
these messages suggests that RANTES acts directly rather than through
the production of TNF-
or other intermediates that could initiate
chemokine synthesis. Eotaxin was a weak stimulus of chemokine mRNA and
triggered little or nondetectable levels of cytokine proteins.
This is the first report to demonstrate autocrine chemokine regulation
in DC. The autocrine production of RANTES indicates the potential
involvement of this chemokine in an amplification cascade. Evidence for
autocrine regulation of chemokines has been observed in a variety of
cell types including endothelial cells (30), monocytes
(31), mesangial cells (23), and astrocytes
(21). All of these systems describe the autocrine activity
of a CXC chemokine, KC, or homologous molecules (IL-8 and
growth-related oncogene-
). It should be noted that KC failed to
induce chemokine synthesis in mouse DC. Very few reports (32, 33) implicated CC chemokines in autocrine pathways, but the
activity of RANTES was not examined in the latter studies.
The ability of RANTES to induce a chemokine cascade appears to be cell
type-specific. Immature DC and microglia possess this capacity, whereas
thymocytes and splenic lymphocytes did not respond as monitored by
chemokine production even though many T cells also express functional
RANTES receptors. It has been reported that 100-fold higher RANTES
concentrations (
1 µM) stimulate proliferation, cytokine release,
and tyrosine kinase signaling in human T cells (34, 35),
but the physiologic significance of T cell responses to
micromolar concentrations of chemokine remains unknown.
The DC receptor(s) responsible for these responses remain
undefined. CCR1, CCR3, and CCR5 can each recognize the RANTES
ligand, and all three receptors are expressed on DC (5).
CCR2, CCR3, and CCR5 also interact with eotaxin (36).
Although MIP-1
and MIP-1
are structurally homologous to RANTES
and also bind CCR1 and CCR5 with high affinity (4), they
failed to stimulate chemokine or cytokine synthesis. Thus, the
exquisite specificity of the RANTES response by immature DC suggests
the receptor-ligand interactions are unique. DC from mice genetically
deficient for CCR1, CCR3, or CCR5 responded normally following RANTES
stimulation. Thus, the possibility of a novel RANTES receptor remains
although the combined signals of multiple redundant CCRs may also
elicit these DC responses.
DC resident in the peripheral tissues express CCR1 and CCR5; upon
cytokine-induced maturation these receptors are lost (9, 10). The loss of RANTES responsiveness in TNF-
-matured DC
(Fig. 6
) may be related to the fact that multiple RANTES receptors
including CCR1 and CCR5 were down-regulated, thereby potentially
reducing ligand binding.
As RANTES treatment did not induce CCR7 this chemokine may not be
sufficient to drive DC maturation to completion (data not shown).
Although the amounts of TNF-
produced by the RANTES amplification
pathway are insufficient to drive DC maturation, they may contribute to
the cytokine threshold required for DC maturation. This scenario offers
a self-limiting model in which RANTES facilitates DC maturation and
migration from inflammatory sites, but additional factors are needed to
push DC maturation to completion.
RANTES treatment induces numerous changes in DC including modulation of receptor transcripts. Four hours following RANTES stimulation DC acquire transcripts for a novel orphan chemokine receptor termed Eo1. Experiments to define a chemokine ligand for the Eo1 receptor are underway.
The selective response of immature DC to RANTES could have a role in the induction, perpetuation, and exacerbation of inflammatory and allergic diseases. In this respect RANTES antagonists may be promising targets for the therapy of acute and chronic disease.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Neurology, Justus-Liebig University, Am Steg 14, 35385 Giessen, Germany. ![]()
3 Address correspondence and reprint requests to Dr. Martin E. Dorf, Department of Pathology, Harvard Medical School, Armenise Building D-530, 200 Longwood Avenue, Boston, MA 02115. E-mail address: dorf{at}hms.harvard.edu ![]()
4 Abbreviations used in this paper: DC, dendritic cells; CM, complete medium; MIP, macrophage inflammatory protein; RPA, RNase protection assay; TCA3, T cell activation gene 3; TCA4, thymus-derived chemotactic agent 4; MCP, monocyte chemoattractant protein; CXCR, CXC chemokine receptor. ![]()
Received for publication January 17, 2001. Accepted for publication May 23, 2001.
| References |
|---|
|
|
|---|
, and MIP-1
as the major HIV-suppressive factors produced by CD8+ T cells. Science 270:1811.
-chemokine TARC is expressed by subsets of dendritic cells and attracts primed CD4+ T cells. Eur. J. Immunol. 29:2684.[Medline]
-chemokine receptor CCR1 protects against pancreatitis-associated lung injury. J. Clin. Invest. 100:2022.[Medline]
-chemokine, thymus-derived chemotactic agent 4, with activity on T lymphocytes and mesangial cells. J. Immunol. 159:5671.[Abstract]
This article has been cited by other articles:
![]() |
S. R. Beaty, C. E. Rose Jr., and S.-s. J. Sung Diverse and Potent Chemokine Production by Lung CD11bhigh Dendritic Cells in Homeostasis and in Allergic Lung Inflammation J. Immunol., February 1, 2007; 178(3): 1882 - 1895. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Chabot, P. Reverdiau, S. Iochmann, A. Rico, D. Senecal, C. Goupille, P.-Y. Sizaret, and L. Sensebe CCL5-enhanced human immature dendritic cell migration through the basement membrane in vitro depends on matrix metalloproteinase-9 J. Leukoc. Biol., April 1, 2006; 79(4): 767 - 778. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-X. Zhang, S. Yu, B. Gran, and A. Rostami Glucosamine Abrogates the Acute Phase of Experimental Autoimmune Encephalomyelitis by Induction of Th2 Response J. Immunol., December 1, 2005; 175(11): 7202 - 7208. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nishina, F. Zhang, L. D. Nielsen, K. Edeen, J. Wang, and R. J. Mason Expression of CINC-2{beta} Is Related to the State of Differentiation of Alveolar Epithelial Cells Am. J. Respir. Cell Mol. Biol., November 1, 2005; 33(5): 505 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Varani, G. Frascaroli, M. Homman-Loudiyi, S. Feld, M. P. Landini, and C. Soderberg-Naucler Human cytomegalovirus inhibits the migration of immature dendritic cells by down-regulating cell-surface CCR1 and CCR5 J. Leukoc. Biol., February 1, 2005; 77(2): 219 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. DePaolo, R. Lathan, and W. J. Karpus CCR5 Regulates High Dose Oral Tolerance by Modulating CC Chemokine Ligand 2 Levels in the GALT J. Immunol., July 1, 2004; 173(1): 314 - 320. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gross, C. A. Amella, L. Pompucci, G. Franchin, B. Sherry, and H. Schmidtmayerova Macrophages and lymphocytes differentially modulate the ability of RANTES to inhibit HIV-1 infection J. Leukoc. Biol., November 1, 2003; 74(5): 781 - 790. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-X. Zhang, S. Yu, B. Gran, J. Li, I. Siglienti, X. Chen, D. Calida, E. Ventura, M. Kamoun, and A. Rostami Role of IL-12 Receptor {beta}1 in Regulation of T Cell Response by APC in Experimental Autoimmune Encephalomyelitis J. Immunol., November 1, 2003; 171(9): 4485 - 4492. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Skelton, M. Cooper, M. Murphy, and A. Platt Human Immature Monocyte-Derived Dendritic Cells Express the G Protein-Coupled Receptor GPR105 (KIAA0001, P2Y14) and Increase Intracellular Calcium in Response to its Agonist, Uridine Diphosphoglucose J. Immunol., August 15, 2003; 171(4): 1941 - 1949. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Walzer, A. Marcais, F. Saltel, C. Bella, P. Jurdic, and J. Marvel Cutting Edge: Immediate RANTES Secretion by Resting Memory CD8 T Cells Following Antigenic Stimulation J. Immunol., February 15, 2003; 170(4): 1615 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Cavanaugh, Y. Deng, M. P. Birkenbach, J. S. Slater, and A. E. Campbell Vigorous Innate and Virus-Specific Cytotoxic T-Lymphocyte Responses to Murine Cytomegalovirus in the Submaxillary Salivary Gland J. Virol., February 1, 2003; 77(3): 1703 - 1717. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |