| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Inflammatory Bowel Disease Center, Division of Gastroenterology, Department of Medicine, and
Division of Pediatric Infectious Diseases, Department of Pediatrics, Steven Spielberg Pediatric Research Center, Burns and Allen Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B reporter gene in
response to purified, protein-free LPS. No IEC line responded to LPS,
whereas human dermal microvessel endothelial cells (HMEC) did respond
to LPS. IEC responded vigorously to IL-1
in this assay,
demonstrating that the IL-1 receptor signaling pathway shared by TLRs
was intact. To determine the reason for LPS hyporesponsiveness in IEC,
we examined the expression of TLR4 and MD-2, a critical coreceptor for
TLR4 signaling. IEC expressed low levels of TLR4 compared with HMEC and
none expressed MD-2. To determine whether the low level of TLR4
expression or absent MD-2 was responsible for the LPS signaling defect
in IEC, the TLR4 or MD-2 gene was transiently expressed in IEC lines.
Transient transfection of either gene individually was not sufficient
to restore LPS signaling, but cotransfection of TLR4 and MD-2 in IEC
led to synergistic activation of NF-B and IL-8 reporter genes in
response to LPS. We conclude that IEC limit dysregulated LPS signaling
by down-regulating expression of MD-2 and TLR4. The remainder of the
intracellular LPS signaling pathway is functionally
intact. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Idiopathic inflammatory bowel disease is characterized by chronic intestinal inflammation in the absence of a recognized bacterial pathogen. Recent studies in animal models of inflammatory bowel disease have demonstrated that the presence of bacteria is required for the initiation of chronic inflammation (5, 6, 7, 8). The bacteria required for the initiation of intestinal inflammation in these animal models are nonpathogenic, commensal organisms, suggesting that human inflammatory bowel disease may be the result of a perturbed host response to the microbial environment. For these reasons, several clinical studies have addressed the role of probiotic therapy, in which viable microorganisms are introduced to repopulate the intestine, as well as antimicrobial therapy, to treat patients with inflammatory bowel disease (9, 10, 11, 12, 13, 14). A better understanding of intestinal innate immune responses and the molecular interactions between bacteria and the intestinal epithelium may lead to improved manipulation of host-microbial interactions.
In the past several years, much has been elucidated about the signal transduction pathways used by the innate immune system to fight invading microbial agents (15, 16). Vertebrates and invertebrates have evolved pattern-recognition receptors that sense the presence of pathogen-associated molecular patterns (PAMPs; Refs. 16 and 17). Examples of these PAMPs include mannans, peptidoglycans, bacterial DNA, and LPS. The outer cell wall of Gram-negative bacteria is characterized by LPS, and release of LPS results in septic shock. In mammalian cells, LPS and other bacterial products are recognized by a class of pattern-recognition receptors known as Toll-like receptors (TLRs) (17). A total of ten TLRs have been cloned and are characterized by a leucine-rich extracellular domain and a cytoplasmic domain that is similar to the IL-1 receptor (TIR domain; Refs. 18, 19, 20). Only three TLRs, TLR2, TLR4, and TLR9, have been functionally characterized with respect to ligand recognition (16, 17, 21).
LPS-mediated activation of TLR4 culminates in NF-B transcriptional
activity and inflammatory cytokine production (17, 22, 23). LPS-dependent TLR4 signaling requires the presence of
LPS-binding protein, which acts as an opsonin, and membrane or soluble
CD14, which acts as an opsonic receptor (15, 16, 24, 25, 26).
Another critical component of the TLR4 signaling complex is MD-2, a
novel secreted protein (27), which binds to the
extracellular domain of TLR4 where it facilitates LPS-mediated NF-B
activation and is required for LPS-dependent MAP kinase activation
(28, 29). Whereas TLR4 is the sole sensor for LPS
(17, 30), TLR2 is involved in recognition of
peptidoglycans and lipoproteins present on Gram-positive bacteria and
mycobacterial Ags (31, 32, 33). TLR expression is tissue
specific, with abundant expression of TLR4 on macrophages, dendritic
cells, and endothelial cells, but the expression and function of these
receptors in other tissues is less clear (34, 35).
In the current study, we investigated the molecular mechanisms
regulating the responses of IEC to purified LPS. Specifically, we
investigated the mechanisms by which IEC are protected against
continuous immune activation by commensal Gram-negative bacteria and
LPS. Prior studies in well-characterized IEC lines have given variable
results with respect to their ability to activate signal transduction
pathways in response to LPS. For example, several studies have
demonstrated that neither T84 cells nor Caco-2 cells respond to LPS
stimulation with respect to proinflammatory cytokine expression or
activation of the transcription factor NF-B (36, 37, 38, 39, 40, 41),
whereas others have found modest activation of MAP kinase signaling
pathways and NF-B binding activity in response to LPS in T84 cells
(42). By contrast, LPS resulted in secretion of IL-8 in
HT-29 cells (36, 37, 41, 43). However, bacterial invasion
reproducibly elicits a proinflammatory response by IEC characterized by
activation of NF-B and secretion of IL-8 (37, 40, 44, 45). Most of these studies predate the elucidation and
characterization of the TLR family of molecules, the primary sensors of
the innate immune response, and the MD-2 molecule. Furthermore, all of
these studies used commercially available LPS preparations, which are
frequently contaminated with lipoproteins (46). Because
lipoproteins are recognized by and signal through TLR2 and not TLR4
(31, 32, 33), it is not clear whether these prior studies have
measured TLR4- or TLR2-mediated signaling. Indeed, contaminating
lipoprotein in commercial LPS preparations, and not purified
protein-free LPS, was clearly shown to signal via TLR2 and explained
the initial reports suggesting that LPS could signal through TLR2
(46).
We investigated the LPS responsiveness, expression pattern, and
function of the TLR4/MD-2 signaling complex in various IEC lines. Here
we report that IEC express no MD-2 and very weak TLR4 and are
unresponsive to purified, protein-free LPS. We also demonstrate that
transient expression of MD-2 and TLR4 restores the ability of IEC to
respond to LPS, as measured by NF-B and IL-8 reporter gene activity.
These findings suggest that down-regulating the expression of the LPS
signaling receptor TLR4 and the accessory molecule MD-2 may be a
mechanism by which IEC protect against dysregulated immune signaling in
response to Gram-negative commensal bacteria and their products. A
better understanding of innate immunity in the gastrointestinal mucosa
may improve our current knowledge of the pathogenesis of inflammatory
bowel diseases.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IEC lines Caco-2, HT-29, and T84 were obtained from the American Type Culture Collection (Manassas, VA). Subconfluent monolayers of these cell lines were kept in a humidified incubator at 37°C with 5% CO2. T84 were cultured on 12-mm Transwell, polycarbonate membranes (Costar 3401; Costar, Cambridge, MA) and maintained in DMEM/F12 (Life Technologies, Rockville, MD) with 5% Pen/Strep, 5% L-glutamine, supplemented with 5% FBS as described previously (47). T84 cells were used between passage number 16 and 35 (48). Caco-2 were maintained in MEM (Life Technologies) supplemented with 10% FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, and 5%Pen/Strep. HT-29 were maintained in McCoy’s 5A medium supplemented with 10% FBS and 5% Pen/Strep. The immortalized human dermal microvessel endothelial cells (HMEC; Ref. 49 ; a generous gift of Dr. Candal of the Center for Disease Control and Prevention, Atlanta, GA) were cultured in MCDB-131 medium supplemented with 10% heat-inactivated FBS, 2 mM of glutamine, and 100 µg/ml of penicillin and streptomycin in 24-well plates, and used between passages 10–14, as described earlier (24, 34, 49).
Highly purified, phenol-water-extracted Escherichia coli
K235 LPS (< 0.008% protein), which was prepared according to the
method of McIntire et al. (50), was obtained from S.
N. Vogel (Uniformed Services University of the Health Sciences,
Bethesda, MD; Refs. 46, 51). The purity of this LPS
preparation has been demonstrated previously (50, 52, 53),
and this preparation of E. coli LPS is active on
TLR4-transfected HEK 293 cells and not on TLR2 transfectants (S.
N. Vogel, unpublished observations). Human IL-1 and TNF-
was purchased from R&D Systems (Minneapolis, MN).
Expression vectors and cDNA constructs
Endothelial leukocyte adhesion molecule (ELAM)-NF-B
luciferase (34) and pCMV-EGFP (Clontech
Laboratories, Palo Alto, CA; Ref. 54) were used
as described previously. Human IL-8 promoter-luciferase construct was
kindly provided by Dr. N. Mukaida (Kanazawa University, Kanazawa,
Japan) (55). A flag-tagged human TLR4 construct was
obtained from Tularik (San Francisco, CA). MD-2 cDNA construct was
kindly provided by Dr. K. Miyake of Saga Medical School, Saga, Japan
(27). The plasmids were prepared with endotoxin-free
plasmid maxi-prep kit (Qiagen, Valencia, CA).
Transient gene expression assays
Caco-2 cells or T84 cells were plated at a density of 150,000
cells/well in 12-well plates 24 h before transfection. HMEC were
plated at a concentration of 50,000 cells/well in 24-well plates. Cells
were transfected the following day with Fugene 6 transfection reagent
(Roche Biomedical Laboratories, Burlington, NC) as per
manufacturer’s instructions and as described earlier (24, 34). HT-29 cells were electroporated with an Electro Square
Porator ECM 830 (BTX, San Diego, CA) set to the following parameters:
voltage 600V, pulse length 500 µs, 9 pulses and a pulse interval of
100 ms. Reporter genes pCMV--galactosidase, pCMV-EGFP (0.1 µg),
ELAM-NF-B-luciferase (0.4 µg), or IL-8 luciferase (0.4 µg), and
pCDNA3 empty vector (0.3–0.6 µg), Flag-tagged wild-type human TLR4
(0.3 µg) or human MD-2 cDNA (0.3 µg) constructs were cotransfected
as indicated in the figure legends. After overnight
transfection, cells were stimulated for 5 h with LPS (50 ng/ml),
human IL-1 (10ng/ml), or TNF- (20 ng/ml; R&D Systems). Cells then
were lysed in 200 µl of reporter lysis buffer (Promega, Madison, WI),
and luciferase activity was measured with a Promega firefly luciferase
kit with a Wallac 1450 Microbeta liquid scintillation counter
(PerkinElmer, Foster City, CA). Data shown are mean ± SD of three
or more independent experiments, and are reported as fold-induction in
relative luciferase activity over cells transfected with a control
vector. Transfection efficiency was determined by counting green
fluorescent protein (GFP)-positive cells with an Olympus (New
Hyde Park, NY) BH2 RFCA microscope (54) or assaying for
-galactosidase activity with a colorimetric method (Promega) as
previously described (34).
RT-PCR analysis
Total RNA was isolated from T84, Caco-2, HT-29, and HMEC with a Qiagen kit following manufacturer’s instruction and treated with RNase free DNase I. For RT reaction, the MMLV Preamplification system (Life Technologies) was used. PCR amplification was performed with Taq polymerase (Perkin-Elmer) for 38 cycles at 95°C for 45 s, 54°C for 45 s, and 72°C for 1 min (for TLR2 and TLR4) as described earlier (24), and for 38 cycles at 94°C for 45 s, 55°C for 45 s, and 72°C for 45 s. (for MD-2). The TLR2 and TLR4 oligonucleotide primers used for RT-PCR were described earlier (24). The oligonucleotide primers for MD-2 were as follows: forward, GAAGCTCAGAAGCAGTATTGGGTC; reverse, GGTTGGTGTAGGATGACAAACTCC (sequence kindly provided by Dr. J. C. Chow, Esai Research Institute, Wilmington, MA). GAPDH primers were obtained from Clontech and used as per manufacturer’s instructions. The TLR2, TLR4, and MD-2 RT-PCR fragments were purified and sequenced to confirm the identity of the fragments.
ELISA and immunocytochemistry
For TLR4 immunocytochemistry, HMEC or T84 cells were grown on polycarbonate membranes. Cells were fixed in 4% paraformaldehyde and blocked in PBS-1% BSA, followed by incubation with 10 µg/ml of HTA125, a monoclonal Ab against TLR4, (a generous gift of Dr. K. Miyake, Saga Medical School; Ref. 27) or irrelevant isotype-matched Ab followed by incubation with FITC-conjugated anti-mouse Ab at 1/100 dilution (Vector Laboratories, Burlingame, CA). Cells were counterstained with 1 µg/ml propidium iodide after treatment with RNase A as described previously (47). Immunofluorescence was visualized with a Leica (Deerfield, IL) TCS SP laser scanning inverted confocal microscope and analyzed with the Leica TCS NT program.
For IL-8 ELISA, 10,000 cells were plated per well in 96-well plates.
Cells were treated with LPS (50 ng/ml), IL-1 (10 ng/ml), or TNF-
(20 ng/ml) for 18 h and supernatants harvested for measurement of
IL-8. IL-8 ELISA (BD PharMingen, San Diego, CA) were performed as per
the manufacturer’s instructions.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The lumenal aspect of IEC is continuously exposed to bacteria and
bacterial products such as LPS. Previous studies have demonstrated a
variable response to LPS in vitro as measured by the ability of IEC
lines to transcribe proinflammatory genes (36), activate
NF-B-dependent reporter genes (40), or activate NF-B
binding to its consensus DNA sequence (42). Whereas HT-29
(36, 43) and T84 cells (42) are reported to
be LPS responsive, Caco-2 cells are LPS unresponsive (36).
Based on these published studies, we chose to characterize IEC lines
that have been found to be responsive to LPS (T84 and HT-29) and one
that is not (Caco-2). All of the published studies that have explored
the response of IEC to LPS have used commercial LPS preparations, which
are frequently contaminated with lipoproteins (46).
Because lipoproteins signal through TLR2 whereas LPS signals through
TLR4, we wished to determine whether IEC lines were responsive to
purified, protein-free LPS, which has been shown to signal via TLR4 and
not TLR2 (46). To answer this question, we used a
functional assay measuring NF-B-dependent gene transcription with an
NF-B-luciferase reporter gene construct derived from the ELAM
promoter as well as transcriptional activation of the IL-8 gene with an
IL-8 promoter-luciferase construct (24, 34, 55). We found
that none of the three cell lines responded to LPS as measured by
NF-B reporter gene activity (Fig. 1
A) or IL-8 gene activation
(data shown in Fig. 2B). We have shown that
HMEC respond vigorously to protein-free LPS through TLR4 as assessed by
NF-B transactivation (Fig. 1A and Refs. 24
and 34). IEC had robust responses to IL-1 and TNF-
(T84 cells) as assessed by NF-B luciferase activity (Fig. 1A; Ref. 36). To confirm the findings of these
transcriptional studies, we measured IEC production of IL-8 in response
to LPS. Mucosal IL-8 levels correlate with the degree of inflammation
in inflammatory bowel disease. IEC lines did not secrete
significant IL-8 in response to LPS but were responsive to TNF- and
IL-1 (Fig. 1B). We and others also have shown that the
LPS-TLR4 signaling pathway shares the IL-1 receptor signaling
molecules, including MyD88, IL-1R-activated kinase (IRAK), IRAK2, and
TRAF-6 to mediate NF-B activation (34, 56). Because IEC
responded to IL-1 as measured by NF-B transcriptional activation
and IL-8 production, these data suggest the presence of an intact
intracellular signaling pathway leading from the IL-1 receptor to
NF-B. The results of our studies suggest that IEC are unresponsive
to purified protein-free LPS as measured by NF-B transcriptional
activation despite an intact IL-1 receptor signaling pathway.
|
|
For IEC to respond to LPS, the TLR4/MD-2 signaling complex must be
expressed and functional. We hypothesized that IEC lines fail to
respond to LPS because they do not express critical components of the
TLR4/MD-2 signaling complex (57). We investigated the mRNA
expression profile of TLR4 and MD-2 by RT-PCR in these representative
intestinal cell lines and used HMEC, an LPS-responsive cell line
(24) as a control. All three IEC expressed very low levels
of TLR4 mRNA by RT-PCR when compared with LPS-responsive HMEC (Fig. 3A). All three cell lines
tested express TLR2 (Fig. 2
A, second panel). Of
interest, none of the three IEC lines tested expressed detectable MD-2,
whereas the LPS-responsive HMEC strongly expressed MD-2 (Fig. 2A, third panel). The housekeeping gene GAPDH was
expressed equally in all cell lines tested (Fig. 2A,
bottom panel).
|
B). HMEC
demonstrate specific plasma membrane and cytoplasmic staining for TLR4,
whereas T84 cells have weak TLR4 staining, which was similar to that
seen with secondary Ab alone (Fig. 2B, as indicated).
Transient transfection of T84 cells with a TLR4-expressing plasmid
resulted in TLR4-positive T84 cells with immunofluorescence that was of
similar intensity to that observed in LPS-responsive HMEC cells. These
data suggest that the LPS unresponsiveness of these IEC lines may be
attributable to the absence of MD-2 expression and/or the low levels of
TLR4 expression. Expression of both TLR4 and MD-2 confers LPS responsiveness to IEC
Our data above demonstrate that IEC lines fail to respond to LPS
and that these cells express low levels of endogenous TLR4 and MD-2. In
macrophages, the level of TLR4 expression correlates with the degree of
LPS responsiveness (58). We hypothesized that transgenic
expression of TLR4 could restore LPS responsiveness in IEC if the
reason for LPS hyporesponsiveness is the relatively low expression of
TLR4. To test this hypothesis, we transiently transfected IEC with cDNA
for human TLR4 and stimulated transfected cells with LPS. An
example of TLR4 transfection of T84 cells is seen in Fig. 2B. Despite TLR4 expression in transfected cells, IEC did
not become responsive to LPS as measured by transcriptional activation
of an NF-B reporter gene (Fig. 3A) or an IL-8 reporter
gene (Caco-2; Fig. 3B). Expression of TLR4 alone led to a
small degree of NF-B and IL-8 activation in Caco-2 cells in the
presence of LPS but not in the other cell lines (Fig. 3A).
We conclude from these experiments that increased expression of TLR4 in
IEC is not sufficient to restore LPS responsiveness, suggesting that
another critical signaling molecule in the receptor complex may be
missing.
In addition to the requirement for TLR4 to mediate LPS-dependent
signaling (16, 17), MD-2 is required for activation of
NF-B and MAP kinases in cellular responses to LPS (29, 57). Because IEC express low levels of TLR4, we hypothesized
that expression of MD-2 could restore LPS responsiveness in IEC if the
reason for LPS hyporesponsiveness is the absence of MD-2 expression. To
test this hypothesis, we transiently transfected IEC with cDNA for MD-2
and stimulated transfected cells with LPS. Despite low levels of TLR4
expression in IEC, expression of MD-2 was not sufficient to restore
LPS-dependent signaling as measured by transcriptional activation of an
NF-B reporter gene (Fig. 3A) or IL-8 reporter gene
(Caco-2; Fig. 3B). We conclude from these experiments that
restoration of MD-2 expression alone also is not sufficient to permit
LPS-dependent signaling in IEC.
The data above demonstrate that neither expression of TLR4 nor MD-2
individually was sufficient to confer LPS responsiveness in IEC. We
hypothesized that LPS unresponsiveness in IEC was attributable to both
the low levels of TLR4 and the absence of MD-2. To test this
hypothesis, we cotransfected MD-2 and TLR4 in IEC and measured their
response to LPS. Cotransfection of TLR4 and MD-2 in IEC led to
synergistic activation of NF-B (T84, 82-fold; HT-29, 13-fold;
Caco-2, 168-fold) and IL-8 (Caco-2, 12-fold) reporter genes in response
to LPS when compared with cells transfected with the empty-vector
control or cells transfected with TLR4 and MD-2 but not stimulated with
LPS (Fig. 3, A and B). Expression of MD-2 and
TLR4 in the absence of LPS led to moderate transcriptional activation
of the reporter gene over basal levels in T84 (NF-B, 26-fold) and
Caco-2 (NF-B, 29-fold; IL-8, 3.8-fold) consistent with prior reports
in other in vitro systems (29). However, LPS stimulation
in MD-2- and TLR4-transfected cells showed significantly increased
response over that observed in cells transfected with TLR4 and MD-2 in
the absence of LPS. Furthermore preincubation with polymixin B
inhibited LPS-mediated reporter gene activation, supporting the
specificity of LPS-induced responses (Fig. 3, A and
B). These results demonstrate that the absence of MD-2 and
low levels of TLR4 expression in IEC lines are responsible for the
unresponsiveness of these cells to protein-free LPS. The data further
support the presence of an intact intracellular signal transduction
pathway leading to NF-B activation in IEC.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although the signaling pathways leading from LPS to TLR4 and NF-B
activation have been described previously, relatively little is known
about mechanisms to limit ubiquitous activation of these pathways in
the presence of LPS. The closest in vitro model to explore these
mechanisms is successive exposure of cells to LPS which results in a
state of LPS tolerance. In monocytic cells and peritoneal macrophages,
previous challenge with LPS results in diminished expression of
proinflammatory cytokines in response to LPS. The molecular mechanisms
for this hyporesponsiveness include down-regulation of IRAK and
diminished recruitment of the MyD88 adapter molecule in monocytes
(65) and down-regulation of the TLR4 receptor in
peritoneal macrophages, suggesting that different cell types have
evolved distinct strategies to limit LPS responsiveness
(28). In addition to intracellular pathways that are
altered in LPS-tolerized cells, polymorphisms in the extracellular
domain of the TLR4 are associated with hyporesponsiveness to inhaled
LPS in humans (66). The mutation in TLR4 present in the
C3H/HeJ mouse acts as a dominant negative mutation and inhibits the
function of wild-type TLR4 (30, 67). Recent studies have
identified viral products that can interfere with TLR signaling
and may represent a mechanism by which viruses inhibit the immune
response and predispose to subsequent bacterial infection
(68).
In this study, we have begun to characterize the response of IEC to LPS in vitro and found that IEC lines do not respond to purified protein-free LPS. Our data demonstrate that the IEC lines tested express low levels of TLR4 mRNA and do not constitutively express the coreceptor molecule MD-2 mRNA. We chose these IEC lines because they are well-characterized and their response to LPS has been studied previously. Although we used IEC lines derived from colon cancers, it is unlikely that all three cell lines derived from distinct sources would contain a deletion in the region of chromosome 8 containing the MD-2 gene. A recent study corroborates our TLR4 findings in primary human IEC and found very low levels of TLR4 expression in healthy intestine but increased expression in inflammatory bowel disease by immunohistochemistry (69). This study did not address the functional aspect of increased TLR4 expression in inflamed mucosa. Our findings suggest that both TLR4 and MD-2 are required by IEC to activate proinflammatory cytokine genes in response to LPS; therefore, increased TLR4 expression by itself would not result in LPS reactivity without concomitant MD-2 expression. Thus, an additional mechanism by which cells that are normally chronically exposed to LPS may down-regulate their response to LPS is to down-regulate the expression of TLR4 and MD-2. Recently, a CHO cell subline has been described that fails to respond to LPS and expresses TLR4 but no MD-2 (57). Expression of MD-2 restores LPS responsiveness in these CHO cells, supporting the concept that MD-2 is required for LPS signaling. The recent findings by Cario and Podolsky (69) of increased TLR4 expression in the mucosa of patients with inflammatory bowel disease suggests that aberrant TLR expression may play an important role in the loss of tolerance to enteric bacteria. Preliminary studies in our laboratory with laser-capture microscopy to dissect IEC and lamina propria mononuclear cells from intestinal biopsies reveal that IEC do not express MD-2, whereas lamina propria cells do express MD-2 (unpublished observations). Further studies will address the expression of MD-2 in normal mucosa and in the mucosa of patients with inflammatory bowel disease once Abs specific for human MD-2 become available.
LPS is only one of many PAMPs found in the gastrointestinal lumen. To maintain tolerance to Gram-positive and Gram-negative commensal bacteria, the normal intestinal epithelium should be unresponsiveness or hyporesponsive to diverse bacterial products. We have tested IEC responses to various TLR2 ligands and found that, despite TLR2 and TLR6 mRNA expression, these cells are unresponsive to these ligands (unpublished observations). These data suggest that other mechanisms may contribute to IEC unresponsiveness to PAMPs.
In this study, we used NF-B reporter gene activity and IL-8 promoter
activity as functional measures of the IEC response to LPS. NF-B is
a central regulator of the mucosal immune response and modulates
proinflammatory cytokine secretion and antiapoptotic mechanisms in IEC
(70). Unlike previously published studies, we did not find
significant NF-B or IL-8 transcriptional activation in response to
LPS in IEC lines (36, 37, 41, 42). One reason for this
discrepancy may be the amount and source of LPS used in our study. LPS
is active at concentrations as low as 1 ng/ml. We used LPS at a
concentration of 50 ng/ml for our studies compared with concentrations
ranging from 5–100 µg/ml in other studies (40, 42, 43).
Additionally, we used purified, lipoprotein-free LPS rather than
commercially available LPS, which frequently contains contaminants
including lipoproteins (46). These lipoprotein
contaminants stimulate TLR2 receptors, especially at concentrations
above 1 µg/ml. Indeed, we found that these IEC lines express TLR2,
which is required for responses to lipoprotein (Fig. 3A;
Refs. 16, 31 , and 71, 72, 73). Future studies
will address the role of TLR2-mediated responses in IEC. Another reason
for the discrepancy could be the relative sensitivity of the assays
used in other studies. We did not find significant NF-B or IL-8
transcriptional activation in IEC stimulated with LPS alone, whereas
IEC expressing both TLR4 and MD-2 are highly responsive to LPS (Fig. 2A). Thus, the responses measured in other systems in
response to LPS such as NF-B DNA binding activity or IL-8 secretion
may be measurable but relatively small when compared with cells
expressing TLR4 and MD-2. HT-29 cells have been found to be responsive
to E. Coli O26:B6 LPS (36, 42). In addition to
the possibility of lipoprotein contamination, the response to LPS as
measured by IL-8 secretion is 
10-fold less when compared with the
same concentration of IL-1 (36), suggesting that the
ability of these cells to respond to LPS is reduced when compared with
IL-1, which uses the same signaling machinery. In this context, our
results are similar to that in the literature when comparing the
relative response to LPS vs IL-1 in IEC.
Based on our model, IEC would be expected to have a muted response to LPS normally present in the intestinal lumen. The presence of an intact IL-1R/TLR intracellular signaling pathway suggests that a pathogenic stimulus may lead to a specific increase in TLR4 and MD-2 expression and thus provide a rapid mechanism of response while avoiding chronic activation. In idiopathic inflammatory bowel disease, Cario and Podolsky (69) have demonstrated increased TLR4 expression by IEC. Increased TLR4 expression as a primary defect or secondary to the inflammatory milieu might initiate or perpetuate chronic inflammation in the presence of commensal bacteria. We suggest that MD-2 expression may be another critical point of regulation in the intestinal innate immune response to commensal organisms. Absent or low MD-2 expression may protect against dysregulated innate immune responses, whereas increased expression of MD-2 in idiopathic inflammatory bowel disease may contribute to the inflammatory cascade. Thus, careful regulation of both TLR4 and MD-2 is necessary to maintain homeostasis in an organ that is continuously exposed to high concentrations of bacteria. An understanding of the mechanisms used in health to limit deleterious activation of TLR pathways in the presence of bacteria may help in understanding the pathogenesis of inflammatory bowel disease and guiding therapy.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Maria T. Abreu, Inflammatory Bowel Disease Center, Cedars-Sinai Medical Center, 8631 West 3rd Street, Suite 245E, Los Angeles, CA 90048. E-mail address: Maria.Abreu{at}cshs.org
3 Abbreviations used in this paper: IEC, intestinal epithelial cells; PAMP, pathogen-associated molecular pattern; TLR, Toll-like receptor; HMEC, human dermal microvessel endothelial cells; ELAM, endothelial leukocyte adhesion molecule; IRAK, IL-1R-activated kinase.
Received for publication February 13, 2001. Accepted for publication May 22, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells: differential expression of TLR-4 and TLR-2 in endothelial cells. J. Biol. Chem. 275:11058.B through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J. Biol. Chem. 274:7611.B in intestinal epithelial cells by enteropathogenic Escherichia coli. Am. J. Physiol. 273:C1160.
-mediated NF-B activation and IL-8 gene expression in intestinal epithelial cells. J. Biol. Chem. 275:12207.B is a central regulator of the intestinal epithelial cell innate immune response induced by infection with enteroinvasive bacteria. J. Immunol. 163:1457.
-primed, C3H/HeJ macrophages to a fully tumoricidal state. J. Immunol. 139:3697.[Abstract]
B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193.B signal transduction. J. Urol. 162:1812.[Medline]
B/NF-B system: a key determinant of mucosalinflammation and protection. Am. J. Physiol. Cell Physiol. 278:C451.This article has been cited by other articles:
|
|
 |
|
  K. Takahashi, Y. Sugi, A. Hosono, and S. Kaminogawa Epigenetic Regulation of TLR4 Gene Expression in Intestinal Epithelial Cells for the Maintenance of Intestinal Homeostasis J. Immunol., November 15, 2009; 183(10): 6522 - 6529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mendoza, N. Matheus, R. Iceta, J. E. Mesonero, and A. I. Alcalde Lipopolysaccharide induces alteration of serotonin transporter in human intestinal epithelial cells Innate Immunity, August 1, 2009; 15(4): 243 - 250. [Abstract] [PDF]
|
|
|
|
|
|
J. Wang, Y. Ouyang, Y. Guner, H. R. Ford, and A. V. Grishin Ubiquitin-Editing Enzyme A20 Promotes Tolerance to Lipopolysaccharide in Enterocytes J. Immunol., July 15, 2009; 183(2): 1384 - 1392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Regueiro, D. Moranta, M. A. Campos, J. Margareto, J. Garmendia, and J. A. Bengoechea Klebsiella pneumoniae Increases the Levels of Toll-Like Receptors 2 and 4 in Human Airway Epithelial Cells Infect. Immun., February 1, 2009; 77(2): 714 - 724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Calcaterra, L. Sfondrini, A. Rossini, M. Sommariva, C. Rumio, S. Menard, and A. Balsari Critical Role of TLR9 in Acute Graft-versus-Host Disease J. Immunol., November 1, 2008; 181(9): 6132 - 6139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zheng, J. Meng, S. Zhao, R. Singh, and W. Song Campylobacter-Induced Interleukin-8 Secretion in Polarized Human Intestinal Epithelial Cells Requires Campylobacter-Secreted Cytolethal Distending Toxin- and Toll-Like Receptor-Mediated Activation of NF-{kappa}B Infect. Immun., October 1, 2008; 76(10): 4498 - 4508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Liu, L. Nguyen, R. F. Chun, V. Lagishetty, S. Ren, S. Wu, B. Hollis, H. F. DeLuca, J. S. Adams, and M. Hewison Altered Endocrine and Autocrine Metabolism of Vitamin D in a Mouse Model of Gastrointestinal Inflammation Endocrinology, October 1, 2008; 149(10): 4799 - 4808. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Sanders, D. A. Moore III, I. R. Williams, and A. T. Gewirtz Both Radioresistant and Hemopoietic Cells Promote Innate and Adaptive Immune Responses to Flagellin J. Immunol., June 1, 2008; 180(11): 7184 - 7192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bhattacharyya, R. Gill, M. L. Chen, F. Zhang, R. J. Linhardt, P. K. Dudeja, and J. K. Tobacman Toll-like Receptor 4 Mediates Induction of the Bcl10-NF{kappa}B-Interleukin-8 Inflammatory Pathway by Carrageenan in Human Intestinal Epithelial Cells J. Biol. Chem., April 18, 2008; 283(16): 10550 - 10558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J. Albert and J. S. Marshall Aging in the absence of TLR2 is associated with reduced IFN-{gamma} responses in the large intestine and increased severity of induced colitis J. Leukoc. Biol., April 1, 2008; 83(4): 833 - 842. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Handfield, H.V. Baker, and R.J. Lamont Beyond Good and Evil in the Oral Cavity: Insights into Host-Microbe Relationships Derived from Transcriptional Profiling of Gingival Cells Journal of Dental Research, March 1, 2008; 87(3): 203 - 223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Gribar, R. J. Anand, C. P. Sodhi, and D. J. Hackam The role of epithelial Toll-like receptor signaling in the pathogenesis of intestinal inflammation J. Leukoc. Biol., March 1, 2008; 83(3): 493 - 498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K Kojima, M Ueta, J Hamuro, Y Hozono, S Kawasaki, N Yokoi, and S Kinoshita Human conjunctival epithelial cells express functional Toll-like receptor 5 Br J Ophthalmol, March 1, 2008; 92(3): 411 - 416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Johnson, X. Li, and E. Pearlman MyD88 Functions as a Negative Regulator of TLR3/TRIF-induced Corneal Inflammation by Inhibiting Activation of c-Jun N-terminal Kinase J. Biol. Chem., February 15, 2008; 283(7): 3988 - 3996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Mizutani, T. Sakurai, T. Shibata, K. Uchida, J. Fujita, R. Kawashima, Y. I. Kawamura, N. Toyama-Sorimachi, T. Imai, and T. Dohi Dose-Dependent Differential Regulation of Cytokine Secretion from Macrophages by Fractalkine J. Immunol., December 1, 2007; 179(11): 7478 - 7487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Andreani, G. Gatti, L. Simonella, V. Rivero, and M. Maccioni Activation of Toll-like Receptor 4 on Tumor Cells In vitro Inhibits Subsequent Tumor Growth In vivo Cancer Res., November 1, 2007; 67(21): 10519 - 10527. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Leaphart, J. Cavallo, S. C. Gribar, S. Cetin, J. Li, M. F. Branca, T. D. Dubowski, C. P. Sodhi, and D. J. Hackam A Critical Role for TLR4 in the Pathogenesis of Necrotizing Enterocolitis by Modulating Intestinal Injury and Repair J. Immunol., October 1, 2007; 179(7): 4808 - 4820. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Voltan, I. Castagliuolo, M. Elli, S. Longo, P. Brun, R. D'Inca, A. Porzionato, V. Macchi, G. Palu, G. C. Sturniolo, et al. Aggregating Phenotype in Lactobacillus crispatus Determines Intestinal Colonization and TLR2 and TLR4 Modulation in Murine Colonic Mucosa Clin. Vaccine Immunol., September 1, 2007; 14(9): 1138 - 1148. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Tulic, R. J. Hurrelbrink, C. M. Prele, I. A. Laing, J. W. Upham, P. Le Souef, P. D. Sly, and P. G. Holt TLR4 Polymorphisms Mediate Impaired Responses to Respiratory Syncytial Virus and Lipopolysaccharide J. Immunol., July 1, 2007; 179(1): 132 - 140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bogunovic, S. H. Dave, J. S. Tilstra, D. T. W. Chang, N. Harpaz, H. Xiong, L. F. Mayer, and S. E. Plevy Enteroendocrine cells express functional Toll-like receptors Am J Physiol Gastrointest Liver Physiol, June 1, 2007; 292(6): G1770 - G1783. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Karrasch, J.-S. Kim, M. Muhlbauer, S. T. Magness, and C. Jobin Gnotobiotic IL-10-/-;NF-{kappa}BEGFP Mice Reveal the Critical Role of TLR/NF-{kappa}B Signaling in Commensal Bacteria-Induced Colitis J. Immunol., May 15, 2007; 178(10): 6522 - 6532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hasegawa, J. J. Mans, S. Mao, M. C. Lopez, H. V. Baker, M. Handfield, and R. J. Lamont Gingival Epithelial Cell Transcriptional Responses to Commensal and Opportunistic Oral Microbial Species Infect. Immun., May 1, 2007; 75(5): 2540 - 2547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Zhou, H. Wei, R. Sun, and Z. Tian Recognition of Double-Stranded RNA by TLR3 Induces Severe Small Intestinal Injury in Mice J. Immunol., April 1, 2007; 178(7): 4548 - 4556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Mayer, M. Muehmer, J. Mages, K. Gueinzius, C. Hess, K. Heeg, R. Bals, R. Lang, and A. H. Dalpke Differential Recognition of TLR-Dependent Microbial Ligands in Human Bronchial Epithelial Cells J. Immunol., March 1, 2007; 178(5): 3134 - 3142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sun, P. E. Fegan, A. S. Desai, J. L. Madara, and M. E. Hobert Flagellin-induced tolerance of the Toll-like receptor 5 signaling pathway in polarized intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, March 1, 2007; 292(3): G767 - G778. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Chen, Z. Ge, J. G. Fox, and D. B. Schauer Disruption of Tight Junctions and Induction of Proinflammatory Cytokine Responses in Colonic Epithelial Cells by Campylobacter jejuni Infect. Immun., December 1, 2006; 74(12): 6581 - 6589. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Vijay-Kumar, H. Wu, R. Jones, G. Grant, B. Babbin, T. P. King, D. Kelly, A. T. Gewirtz, and A. S. Neish Flagellin Suppresses Epithelial Apoptosis and Limits Disease during Enteric Infection Am. J. Pathol., November 1, 2006; 169(5): 1686 - 1700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Jilling, D. Simon, J. Lu, F. J. Meng, D. Li, R. Schy, R. B. Thomson, A. Soliman, M. Arditi, and M. S. Caplan The Roles of Bacteria and TLR4 in Rat and Murine Models of Necrotizing Enterocolitis. J. Immunol., September 1, 2006; 177(5): 3273 - 3282. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Romics Jr, G. Szabo, J. C. Coffey, J. H. Wang, and H. P. Redmond The Emerging Role of Toll-Like Receptor Pathways in Surgical Diseases Arch Surg, June 1, 2006; 141(6): 595 - 601. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Mueller, T. Terada, I. M. Rosenberg, O. Shibolet, and D. K. Podolsky Th2 Cytokines Down-Regulate TLR Expression and Function in Human Intestinal Epithelial Cells J. Immunol., May 15, 2006; 176(10): 5805 - 5814. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Gatti, V. Rivero, R. D. Motrich, and M. Maccioni Prostate epithelial cells can act as early sensors of infection by up-regulating TLR4 expression and proinflammatory mediators upon LPS stimulation J. Leukoc. Biol., May 1, 2006; 79(5): 989 - 998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lotz, D. Gutle, S. Walther, S. Menard, C. Bogdan, and M. W. Hornef Postnatal acquisition of endotoxin tolerance in intestinal epithelial cells J. Exp. Med., April 17, 2006; 203(4): 973 - 984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F.-S. X. Yu and L. D. Hazlett Toll-like Receptors and the Eye. Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1255 - 1263. [Full Text] [PDF]
|
|
|
|
|
|
E. Cario, D. T. Golenbock, A. Visintin, M. Runzi, G. Gerken, and D. K. Podolsky Trypsin-Sensitive Modulation of Intestinal Epithelial MD-2 as Mechanism of Lipopolysaccharide Tolerance J. Immunol., April 1, 2006; 176(7): 4258 - 4266. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chabot, J. S. Wagner, S. Farrant, and M. R. Neutra TLRs Regulate the Gatekeeping Functions of the Intestinal Follicle-Associated Epithelium J. Immunol., April 1, 2006; 176(7): 4275 - 4283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Sharma, S. Tesfay, F. L. Tomson, R. P. Kanteti, V. K. Viswanathan, and G. Hecht Balance of bacterial pro- and anti-inflammatory mediators dictates net effect of enteropathogenic Escherichia coli on intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G685 - G694. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Liu, D. B. Stolz, P. L. Sappington, C. A. Macias, M. E. Killeen, J. J. Tenhunen, R. L. Delude, and M. P. Fink HMGB1 is secreted by immunostimulated enterocytes and contributes to cytomix-induced hyperpermeability of Caco-2 monolayers Am J Physiol Cell Physiol, April 1, 2006; 290(4): C990 - C999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. LeBouder, J. E. Rey-Nores, A.-C. Raby, M. Affolter, K. Vidal, C. A. Thornton, and M. O. Labeta Modulation of Neonatal Microbial Recognition: TLR-Mediated Innate Immune Responses Are Specifically and Differentially Modulated by Human Milk J. Immunol., March 15, 2006; 176(6): 3742 - 3752. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Schreiber Slipping the barrier: how variants in CARD15 could alter permeability of the intestinal wall and population health Gut, March 1, 2006; 55(3): 308 - 309. [Full Text] [PDF]
|
|
|
|
|
|
M. D. Neal, C. Leaphart, R. Levy, J. Prince, T. R. Billiar, S. Watkins, J. Li, S. Cetin, H. Ford, A. Schreiber, et al. Enterocyte TLR4 Mediates Phagocytosis and Translocation of Bacteria Across the Intestinal Barrier. J. Immunol., March 1, 2006; 176(5): 3070 - 3079. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K Harada, K Isse, and Y Nakanuma Interferon {gamma} accelerates NF-{kappa}B activation of biliary epithelial cells induced by Toll-like receptor and ligand interaction J. Clin. Pathol., February 1, 2006; 59(2): 184 - 190. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Tyrer, A. R. Foxwell, A. W. Cripps, M. A. Apicella, and J. M. Kyd Microbial Pattern Recognition Receptors Mediate M-Cell Uptake of a Gram-Negative Bacterium Infect. Immun., January 1, 2006; 74(1): 625 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J H Chang, P J McCluskey, and D Wakefield Toll-like receptors in ocular immunity and the immunopathogenesis of inflammatory eye disease Br J Ophthalmol, January 1, 2006; 90(1): 103 - 108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Divanovic, A. Trompette, S. F. Atabani, R. Madan, D. T. Golenbock, A. Visintin, R. W. Finberg, A. Tarakhovsky, S. N. Vogel, Y. Belkaid, et al. Inhibition of TLR-4/MD-2 signaling by RP105/MD-1 Innate Immunity, December 1, 2005; 11(6): 363 - 368. [Abstract] [PDF]
|
|
|
|
|
|
J. E. Butler, D. H. Francis, J. Freeling, P. Weber, and A. M. Krieg Antibody Repertoire Development in Fetal and Neonatal Piglets. IX. Three Pathogen-Associated Molecular Patterns Act Synergistically to Allow Germfree Piglets to Respond to Type 2 Thymus-Independent and Thymus-Dependent Antigens J. Immunol., November 15, 2005; 175(10): 6772 - 6785. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Ohnuma, T. Yamochi, M. Uchiyama, K. Nishibashi, S. Iwata, O. Hosono, H. Kawasaki, H. Tanaka, N. H. Dang, and C. Morimoto CD26 Mediates Dissociation of Tollip and IRAK-1 from Caveolin-1 and Induces Upregulation of CD86 on Antigen-Presenting Cells Mol. Cell. Biol., September 1, 2005; 25(17): 7743 - 7757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E Cario BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL-LIKE RECEPTORS AND NOD2 Gut, August 1, 2005; 54(8): 1182 - 1193. [Full Text] [PDF]
|
|
|
|
|
|
K. Tsuchiya, I. Kawamura, A. Takahashi, T. Nomura, C. Kohda, and M. Mitsuyama Listeriolysin O-Induced Membrane Permeation Mediates Persistent Interleukin-6 Production in Caco-2 Cells during Listeria monocytogenes Infection In Vitro Infect. Immun., July 1, 2005; 73(7): 3869 - 3877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Methe, J.-O. Kim, S. Kofler, M. Nabauer, and M. Weis Statins Decrease Toll-Like Receptor 4 Expression and Downstream Signaling in Human CD14+ Monocytes Arterioscler Thromb Vasc Biol, July 1, 2005; 25(7): 1439 - 1445. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Methe, J.-O. Kim, S. Kofler, M. Weis, M. Nabauer, and J. Koglin Expansion of Circulating Toll-Like Receptor 4-Positive Monocytes in Patients With Acute Coronary Syndrome Circulation, May 24, 2005; 111(20): 2654 - 2661. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Miller, O. E. Sorensen, P. T. Liu, H. R. Jalian, D. Eshtiaghpour, B. E. Behmanesh, W. Chung, T. D. Starner, J. Kim, P. A. Sieling, et al. TGF-{alpha} Regulates TLR Expression and Function on Epidermal Keratinocytes J. Immunol., May 15, 2005; 174(10): 6137 - 6143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Vijay-Kumar, J. R. Gentsch, W. J. Kaiser, N. Borregaard, M. K. Offermann, A. S. Neish, and A. T. Gewirtz Protein Kinase R Mediates Intestinal Epithelial Gene Remodeling in Response to Double-Stranded RNA and Live Rotavirus J. Immunol., May 15, 2005; 174(10): 6322 - 6331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Fort, A. Mozaffarian, A. G. Stover, J. d. S. Correia, D. A. Johnson, R. T. Crane, R. J. Ulevitch, D. H. Persing, H. Bielefeldt-Ohmann, P. Probst, et al. A Synthetic TLR4 Antagonist Has Anti-Inflammatory Effects in Two Murine Models of Inflammatory Bowel Disease J. Immunol., May 15, 2005; 174(10): 6416 - 6423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Mumy and B. A. McCormick Events at the Host-Microbial Interface of the Gastrointestinal Tract II. Role of the intestinal epithelium in pathogen-induced inflammation Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G854 - G859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fukata, K. S. Michelsen, R. Eri, L. S. Thomas, B. Hu, K. Lukasek, C. C. Nast, J. Lechago, R. Xu, Y. Naiki, et al. Toll-like receptor-4 is required for intestinal response to epithelial injury and limiting bacterial translocation in a murine model of acute colitis Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G1055 - G1065. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Fazeli, C. Bruce, and D.O. Anumba Characterization of Toll-like receptors in the female reproductive tract in humans Hum. Reprod., May 1, 2005; 20(5): 1372 - 1378. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Abreu, M. Fukata, and M. Arditi TLR Signaling in the Gut in Health and Disease J. Immunol., April 15, 2005; 174(8): 4453 - 4460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Preciado, E. Caicedo, R. Jhanjee, R. Silver, G. Harris, S. K. Juhn, D. I. Choo, and F. Ondrey Pseudomonas aeruginosa Lipopolysaccharide Induction of Keratinocyte Proliferation, NF-{kappa}B, and Cyclin D1 Is Inhibited by Indomethacin J. Immunol., March 1, 2005; 174(5): 2964 - 2973. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. I. Singh, S. M. Cruickshank, D. J. Newton, L. Wakenshaw, A. Graham, J. Lan, J. P. A. Lodge, P. J. Felsburg, and S. R. Carding Toll-like receptor-mediated responses of primary intestinal epithelial cells during the development of colitis Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G514 - G524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. De Creus, M. Abe, A. H. Lau, H. Hackstein, G. Raimondi, and A. W. Thomson Low TLR4 Expression by Liver Dendritic Cells Correlates with Reduced Capacity to Activate Allogeneic T Cells in Response to Endotoxin J. Immunol., February 15, 2005; 174(4): 2037 - 2045. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Muthukuru, R. Jotwani, and C. W. Cutler Oral Mucosal Endotoxin Tolerance Induction in Chronic Periodontitis Infect. Immun., February 1, 2005; 73(2): 687 - 694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kumagai, K. Fukuda, Y. Fujitsu, Y. Lu, N. Chikamoto, and T. Nishida Lipopolysaccharide-Induced Expression of Intercellular Adhesion Molecule-1 and Chemokines in Cultured Human Corneal Fibroblasts Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 114 - 120. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Pugin, S. Stern-Voeffray, B. Daubeuf, M. A. Matthay, G. Elson, and I. Dunn-Siegrist Soluble MD-2 activity in plasma from patients with severe sepsis and septic shock Blood, December 15, 2004; 104(13): 4071 - 4079. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. VanderMeer, Q. Sha, A. P. Lane, and R. P. Schleimer Innate Immunity of the Sinonasal Cavity: Expression of Messenger RNA for Complement Cascade Components and Toll-like Receptors Arch Otolaryngol Head Neck Surg, December 1, 2004; 130(12): 1374 - 1380. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Schleimer Glucocorticoids Suppress Inflammation but Spare Innate Immune Responses in Airway Epithelium Proceedings of the ATS, November 1, 2004; 1(3): 222 - 230. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Vora, A. Youdim, L. S. Thomas, M. Fukata, S. Y. Tesfay, K. Lukasek, K. S. Michelsen, A. Wada, T. Hirayama, M. Arditi, et al. {beta}-Defensin-2 Expression Is Regulated by TLR Signaling in Intestinal Epithelial Cells J. Immunol., November 1, 2004; 173(9): 5398 - 5405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-C. Bambou, A. Giraud, S. Menard, B. Begue, S. Rakotobe, M. Heyman, F. Taddei, N. Cerf-Bensussan, and V. Gaboriau-Routhiau In Vitro and ex Vivo Activation of the TLR5 Signaling Pathway in Intestinal Epithelial Cells by a Commensal Escherichia coli Strain J. Biol. Chem., October 8, 2004; 279(41): 42984 - 42992. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Sha, A. Q. Truong-Tran, J. R. Plitt, L. A. Beck, and R. P. Schleimer Activation of Airway Epithelial Cells by Toll-Like Receptor Agonists Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 358 - 364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ueta, T. Nochi, M.-H. Jang, E. J. Park, O. Igarashi, A. Hino, S. Kawasaki, T. Shikina, T. Hiroi, S. Kinoshita, et al. Intracellularly Expressed TLR2s and TLR4s Contribution to an Immunosilent Environment at the Ocular Mucosal Epithelium J. Immunol., September 1, 2004; 173(5): 3337 - 3347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Armstrong, A. R. L. Medford, K. M. Uppington, J. Robertson, I. R. Witherden, T. D. Tetley, and A. B. Millar Expression of Functional Toll-Like Receptor-2 and -4 on Alveolar Epithelial Cells Am. J. Respir. Cell Mol. Biol., August 1, 2004; 31(2): 241 - 245. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. P. Jia, J. N. Kline, A. Penisten, M. A. Apicella, T. L. Gioannini, J. Weiss, and P. B. McCray Jr. Endotoxin responsiveness of human airway epithelia is limited by low expression of MD-2 Am J Physiol Lung Cell Mol Physiol, August 1, 2004; 287(2): L428 - L437. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ishihara, M. A. K. Rumi, Y. Kadowaki, C. F. Ortega-Cava, T. Yuki, N. Yoshino, Y. Miyaoka, H. Kazumori, N. Ishimura, Y. Amano, et al. Essential Role of MD-2 in TLR4-Dependent Signaling during Helicobacter pylori-Associated Gastritis J. Immunol., July 15, 2004; 173(2): 1406 - 1416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D Franchimont, S Vermeire, H El Housni, M Pierik, K Van Steen, T Gustot, E Quertinmont, M Abramowicz, A Van Gossum, J Deviere, et al. Deficient host-bacteria interactions in inflammatory bowel disease? The toll-like receptor (TLR)-4 Asp299gly polymorphism is associated with Crohn's disease and ulcerative colitis Gut, July 1, 2004; 53(7): 987 - 992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cetin, H. R. Ford, L. R. Sysko, C. Agarwal, J. Wang, M. D. Neal, C. Baty, G. Apodaca, and D. J. Hackam Endotoxin Inhibits Intestinal Epithelial Restitution through Activation of Rho-GTPase and Increased Focal Adhesions J. Biol. Chem., June 4, 2004; 279(23): 24592 - 24600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Guthrie, S. Y. C. Wong, B. Liang, L. Hyland, S. Hou, E. A. Hoiby, and S. R. Andersen Local and Systemic Antibody Responses in Mice Immunized Intranasally with Native and Detergent-Extracted Outer Membrane Vesicles from Neisseria meningitidis Infect. Immun., May 1, 2004; 72(5): 2528 - 2537. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kojima, M. W. Musch, M. J. Ropeleski, D. L. Boone, A. Ma, and E. B. Chang Escherichia coli LPS induces heat shock protein 25 in intestinal epithelial cells through MAP kinase activation Am J Physiol Gastrointest Liver Physiol, April 1, 2004; 286(4): G645 - G652. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Kim, S. J. Lee, and M. F. Kagnoff Nod1 Is an Essential Signal Transducer in Intestinal Epithelial Cells Infected with Bacteria That Avoid Recognition by Toll-Like Receptors Infect. Immun., March 1, 2004; 72(3): 1487 - 1495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kawahara, Y. Kuwano, S. Teshima-Kondo, R. Takeya, H. Sumimoto, K. Kishi, S. Tsunawaki, T. Hirayama, and K. Rokutan Role of Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in Oxidative Burst Response to Toll-Like Receptor 5 Signaling in Large Intestinal Epithelial Cells J. Immunol., March 1, 2004; 172(5): 3051 - 3058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Monick, T. O. Yarovinsky, L. S. Powers, N. S. Butler, A. B. Carter, G. Gudmundsson, and G. W. Hunninghake Respiratory Syncytial Virus Up-regulates TLR4 and Sensitizes Airway Epithelial Cells to Endotoxin J. Biol. Chem., December 26, 2003; 278(52): 53035 - 53044. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Hornef, B. H. Normark, A. Vandewalle, and S. Normark Intracellular Recognition of Lipopolysaccharide by Toll-like Receptor 4 in Intestinal Epithelial Cells J. Exp. Med., October 20, 2003; 198(8): 1225 - 1235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Peters, R. E. Unger, J. Brunner, and C.J. Kirkpatrick Molecular basis of endothelial dysfunction in sepsis Cardiovasc Res, October 15, 2003; 60(1): 49 - 57. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Abreu, L. S. Thomas, E. T. Arnold, K. Lukasek, K. S. Michelsen, and M. Arditi TLR signaling at the intestinal epithelial interface Innate Immunity, October 1, 2003; 9(5): 322 - 330. [Abstract] [PDF]
|
|
|
|
|
|
T. Pedron, C. Thibault, and P. J. Sansonetti The Invasive Phenotype of Shigella flexneri Directs a Distinct Gene Expression Pattern in the Human Intestinal Epithelial Cell Line Caco-2 J. Biol. Chem., September 5, 2003; 278(36): 33878 - 33886. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Suzuki, T. Hisamatsu, and D. K. Podolsky Gamma Interferon Augments the Intracellular Pathway for Lipopolysaccharide (LPS) Recognition in Human Intestinal Epithelial Cells through Coordinated Up-Regulation of LPS Uptake and Expression of the Intracellular Toll-Like Receptor 4-MD-2 Complex Infect. Immun., June 1, 2003; 71(6): 3503 - 3511. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tsutsumi-Ishii and I. Nagaoka Modulation of Human {beta}-Defensin-2 Transcription in Pulmonary Epithelial Cells by Lipopolysaccharide-Stimulated Mononuclear Phagocytes Via Proinflammatory Cytokine Production J. Immunol., April 15, 2003; 170(8): 4226 - 4236. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Wheeler and R. G. Thurman Up-regulation of CD14 in Liver Caused by Acute Ethanol Involves Oxidant-dependent AP-1 Pathway J. Biol. Chem., February 28, 2003; 278(10): 8435 - 8441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Melmed, L. S. Thomas, N. Lee, S. Y. Tesfay, K. Lukasek, K. S. Michelsen, Y. Zhou, B. Hu, M. Arditi, and M. T. Abreu Human Intestinal Epithelial Cells Are Broadly Unresponsive to Toll-Like Receptor 2-Dependent Bacterial Ligands: Implications for Host-Microbial Interactions in the Gut J. Immunol., February 1, 2003; 170(3): 1406 - 1415. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, A. A. Roberts, and T. Ganz By IL-1 Signaling, Monocyte-Derived Cells Dramatically Enhance the Epidermal Antimicrobial Response to Lipopolysaccharide J. Immunol., January 1, 2003; 170(1): 575 - 580. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F M Ruemmele, J F Beaulieu, S Dionne, E Levy, E G Seidman, N Cerf-Bensussan, and M J Lentze Lipopolysaccharide modulation of normal enterocyte turnover by toll-like receptors is mediated by endogenously produced tumour necrosis factor {alpha} Gut, December 1, 2002; 51(6): 842 - 848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Haller, M. P. Russo, R. B. Sartor, and C. Jobin IKKbeta and Phosphatidylinositol 3-Kinase/Akt Participate in Non-pathogenic Gram-negative Enteric Bacteria-induced RelA Phosphorylation and NF-kappa B Activation in Both Primary and Intestinal Epithelial Cell Lines J. Biol. Chem., October 4, 2002; 277(41): 38168 - 38178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Hershberg The Epithelial Cell Cytoskeleton and Intracellular Trafficking: V. Polarized compartmentalization of antigen processing and Toll-like receptor signaling in intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, October 1, 2002; 283(4): G833 - G839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Henneke, O. Takeuchi, R. Malley, E. Lien, R. R. Ingalls, M. W. Freeman, T. Mayadas, V. Nizet, S. Akira, D. L. Kasper, et al. Cellular Activation, Phagocytosis, and Bactericidal Activity Against Group B Streptococcus Involve Parallel Myeloid Differentiation Factor 88-Dependent and Independent Signaling Pathways J. Immunol., October 1, 2002; 169(7): 3970 - 3977. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. H. Nemeth, E. A. Deitch, C. Szabo, and G. Hasko Hyperosmotic Stress Induces Nuclear Factor-{kappa}B Activation and Interleukin-8 Production in Human Intestinal Epithelial Cells Am. J. Pathol., September 1, 2002; 161(3): 987 - 996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Fierer, M. A. Swancutt, D. Heumann, and D. Golenbock The Role of Lipopolysaccharide Binding Protein in Resistance to Salmonella Infections in Mice J. Immunol., June 15, 2002; 168(12): 6396 - 6403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Abreu, E. T. Arnold, L. S. Thomas, R. Gonsky, Y. Zhou, B. Hu, and M. Arditi TLR4 and MD-2 Expression Is Regulated by Immune-mediated Signals in Human Intestinal Epithelial Cells J. Biol. Chem., May 31, 2002; 277(23): 20431 - 20437. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. H. Nemeth, E. A. Deitch, C. Szabo, Z. Fekete, C. J. Hauser, and G. Hasko Lithium Induces NF-kappa B Activation and Interleukin-8 Production in Human Intestinal Epithelial Cells J. Biol. Chem., March 1, 2002; 277(10): 7713 - 7719. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. N. Fichorova, A. O. Cronin, E. Lien, D. J. Anderson, and R. R. Ingalls Response to Neisseria gonorrhoeae by Cervicovaginal Epithelial Cells Occurs in the Absence of Toll-Like Receptor 4-Mediated Signaling J. Immunol., March 1, 2002; 168(5): 2424 - 2432. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Hornef, T. Frisan, A. Vandewalle, S. Normark, and A. Richter-Dahlfors Toll-like Receptor 4 Resides in the Golgi Apparatus and Colocalizes with Internalized Lipopolysaccharide in Intestinal Epithelial Cells J. Exp. Med., February 25, 2002; 195(5): 559 - 570. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Li, Y. Wang, L. Gao, J. Zhang, J. Shao, S. Wang, W. Feng, X. Wang, M. Li, and Z. Chang Expression of Toll-like Receptors 2 and 4 and CD14 during Differentiation of HL-60 Cells Induced by Phorbol 12-Myristate 13-Acetate and 1{alpha}, 25-Dihydroxy-Vitamin D3 Cell Growth Differ., January 1, 2002; 13(1): 27 - 38. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
