HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gallagher, M. Articles by Jouvin-Marche, E. Search for Related Content PubMed PubMed Citation Articles by Gallagher, M. Articles by Jouvin-Marche, E.

Both TCR and TCR Chain Diversity Are Regulated During Thymic Ontogeny¹

Institut National de la Santé et de la Recherche Médical, Unité 548, Commissariat à l’Energie Atomique de Grenoble, Université Joseph Fourier, Grenoble, France

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
TCR and TCR chains are coded by a common genetic locus using a single set of V gene segments (ADV segments). This article addresses the question of regulation of the use of the ADV segments by the TCR and TCR chains. Using both qualitative and quantitative analyses we have studied the use of 23 ADV gene families as part of TCR and TCR transcripts. A number of previously undetected rearrangement and transcription events are described, indicating that the intrathymic TCR repertoire is much more diverse than previously supposed. Repertoire analysis at several developmental time points allowed the description of regulated waves of ADV gene use, not only for TCR chains, but also for TCR chains, during thymic ontogeny. Control of these waves appears to be linked directly to the ADV segments and their local chromatin environment, which may change over the course of T cell differentiation.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
T lymphocytes express a clonotypic TCR complex on their surface. The function of the TCR complex is, first, to recognize antigenic peptides presented in the context of the MHC and, second, to signal this recognition to the cell. Separate elements mediate these two functions: an Ag recognition module made up of TCR or TCR heterodimers and a signal transduction module, or CD3 complex. The CD3 chains, , , , and , are encoded by two distinct genetic loci, one covering , , and , and the other assuring expression (1). Genes encoding the TCR chains are highly variable due to the rearrangement mechanism that precedes their successful transcription and translation. This rearrangement mechanism involves the juxtaposition of a variable (V), a diversity (D; in the case of TCR and TCR only), and a junction (J) gene segment (2). In theory, any given V segment can recombine in cis with any D and/or J segment, thereby allowing the generation of a large number of potential combinations. The junctions of these recombinations are highly heterogeneous; nucleotides can be added or deleted during recombination, thus generating further, nongenomically coded, diversity. Each chain of the TCR has its own D (only for TCR and TCR), J, and constant region element(s); however, the - and -chains are coded by a common locus (TCRAD locus) using a single set of V segments (ADV/DV segments) (3). For the BALB/c mouse the TCRAD locus comprises approximately 100 ADV segments grouped into 25 families according to their sequence homologies (4, 5). Sequences with >75% identity belong to the same family. Families can have multiple members (e.g., ADV1, ADV2, and ADV7) or be single membered (e.g., ADV12, ADV19, and DV105) (6). Previous studies have indicated that not all the ADV segments are used to form both - and -chains and that the use of different families or members thereof evolves over the course of ontogeny (6, 7, 8). However, no extensive study of this question has been conducted to date, and results from different laboratories do not always agree (6, 7, 8).

Work in the area of TCR and TCR chain expression is hindered by several factors. 1) Most peripheral T cells express a TCR; TCR⁺ cells represent <5% of this population (9). Unlike for TCR chains, an extensive range of mAbs to TCR/TCR chains is not available. For those that are available (ADV2, ADV3, ADV8, and ADV11), it is not known whether all TCRAD haplotypes are recognized or whether all family members are equally bound by particular mAbs. 2) At the DNA level, while the study of TCRD rearrangements is possible, with only two DD and two DJ segments on the TCRAD locus, progress has been hampered by the large number of ADV (100) and AJ (61) (10) segments. The number of possible combinations between the ADV and AJ segments renders an extensive study at this level difficult to envision. However, it has been noted that out-of-frame transcripts are less stable than their in-frame counterparts (11) and that the stability of TCR transcripts increases in mature thymocytes following positive selection (12). Thus, the most abundant TCR transcripts probably correspond to those encoding functional, surface-expressed TCR proteins. Therefore, using RT-PCR techniques with one ADV-specific and one constant region-specific oligonucleotide, study of the TCR repertoire is fairly straightforward. Substitution of an oligonucleotide specific for the TCR constant region permits a comparison of TCR and TCR transcripts.

In this article we describe a study of the use of 23 ADV gene families by the TCR and TCR chains using both qualitative and quantitative RT-PCR methods. Our results allow us to evaluate and compare the use of ADV gene families by the TCR and TCR chains over the course of ontogeny. We have identified a number of previously undetected rearrangement and transcription events. In addition, we provide quantitative data on the relative levels of the different transcripts expressed in fetal and young adult thymi for both TCR and TCR chains, describing an evolution that has remained poorly documented up to now.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Mice

BALB/c mice were obtained from IFFA CREDO (L’Abresles, France) at 4 wk of age. Fetal thymi were obtained from timed pregnancies, the day on which a vaginal plug was observed being considered day 1. Fetal thymic samples were dissociated enzymatically in collagenase B (0.2%; Roche, Meylan, France), DNase I (2000 U/ml; Roche), and FCS (10%; Life Technologies, Pontoise, France) in PBS before extracting total RNA. Adult thymi were treated whole for RNA extraction.

RNA and cDNA

Total RNA was extracted from adult thymi and fetal thymocytes using the RNA-Now kit (Biogentex; OZYME, Montigny-Le-Bx, France), following the manufacturer’s instructions. For adult thymi, mRNA was extracted from the pool of total RNA using the MACS mRNA isolation kit (Miltenyi Biotec, Paris, France). cDNA was synthesized using the Superscript II RNase H^- kit (Life Technologies) according to the suggested protocol. cDNA from several synthesis reactions were pooled, and the same sample used for all PCRs.

Primer design

The oligonucleotides were designed by choosing sequences of high intrafamily, but low interfamily, homology, using the published alignment (6). Sequences were between 16 and 24 bases long, and their specificity was verified using the BLAST sequence alignment program (13). For AC, DC, ADV7, ADV8, ADV12, and ADV19, oligonucleotide sequences were as previously described (8). The remainder were as follows (5'–3'): ADV1, CAGCAGAGCCCAGAATCCCTC; ADV3, TGCAGCTKCTCCTCAAGT; ADV3x, TCCACAACAGAGCTGCAGCCTT; ADV4, GCTACTTCTCATACTTGGAAGGACC; ADV5, GTACGGAAATAAACGAAGGA; ADV6, CAACCAATAGTATGGCTT; ADV10, AGACTGACATCCACYACA; ADV11, CTGTGCTGGGGATKCTGTKGGTGC; ADV13, GCCTCCAACTACTTCCCT; ADV14, CCGAATTCCCAAGTGGAGCAGAGTCCT; ADV15, GGGTCTCCACTTTGTGATAG; ADV16, GAAGTCTTTCGAAGCCTTGTCCA; ADV17, TTGGGAGCAGCCTTTGGCTCCA; ADV18, GTTGATGGTGTCACTGTGGCTGCAAC; ADV20, TGACTGGCTTCCTGAAGGCC; DV101, TCTACTGCACTGTAACAGGAGGGGAC; DV102, AATCAGTTACTCTGGTATAGGCAGGGG; RP, GGAAACAGCTATGACCATGA; SP, TTGTAAAACGACGGCCAGTG; DJ1, TGGTTCCACAGTCACTTGGGTTC; and DJ2, GGGCTCCACAAAGAGCTCTATGC. Base ambiguities: K = G/T; R = A/G; Y = C/T. All primers were from Genset (Paris, France). The amplification efficiencies of the different PCR reactions were analyzed using real time PCR (14). The yield for the 46 PCR, ADV-AC, and ADV-DC was approximately 85%, ranging from 84 to 86% for individual reactions, with the reactions involving the DC primer giving equivalent or better yields than those involving the AC primer.

Qualitative PCR analysis

PCR reactions were conducted in parallel using the following reagent mix: 1 U Taq polymerase (Roche), 1x PCR buffer, 0.2 mM dNTP (Roche), and 10 pmol each of an ADV-specific primer and a constant region primer in a final volume of 25 µl. Optimal PCR conditions were defined as 94°C for 1 min; 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min, 35 times; and 72°C for 5 min. PCR products were visualized on agarose gels, and their specificity was verified by Southern blotting, using internal constant region probes, and by sequencing.

Sequencing

All PCR products were directly sequenced using the same ADV oligonucleotide as that used for their amplification or another oligonucleotide specific for the ADV family studied. Only the following ADV-DC amplification products did not give satisfactory results by this method: ADV8, -11, -12, -14, -16, -18, and –19; these were therefore cloned before sequencing. Products were blunt-cloned into the pZERO-1 vector (Invitrogen, Leek, The Netherlands) or into the pSTBlue vector using the Perfectly Blunt cloning kit (Novagen, R&D Systems, Abingdon, U.K.), according to the protocols provided. For analysis of the ADV7-DC transcripts, cDNA from fetal and adult samples were amplified using a nested PCR approach and cloned in EcoRI/BamHI-cut M13 single-strand sequencing vector (7). For all cloning methods, colonies were analyzed for the size of their insert by PCR, using the RP/SP oligonucleotide couple. Positive clones were sequenced as described previously (7).

TCRD rearrangement analysis

Genomic DNA (200 ng) from 4-wk-old BALB/c and RAG-2^-/- thymi were amplified using the same ADV-specific primers as those used for RT-PCR in conjunction with DJ-specific primers. The reaction mixture and conditions were the same as used for the qualitative PCR analysis. Products were visualized after Southern blotting and probing with a radiolabeled internal DJ primer.

Quantitative PCR

Quantitative PCR was conducted on a LightCycler (Roche), using the following reaction mixture: 1x DNA master SYBR-Green I (Roche), 0.07 µM TaqStart Ab (Clontech, Heidelberg, Germany), and 1 µl cDNA matrix. After initial denaturation and inactivation of the Ab at 94°C for 2 min, amplification was conducted over 45 cycles of 94°C for 5 s, 60°C for 15 s, and 72°C for 15 s. Product specificity was determined by melting curve analysis as described in the LightCycler handbook, size determination of PCR products on agarose gels, and hybridization with an ADV-specific probe. The ADV8, -11, -12, -14, -16, -18, and -19-DC PCR products were revealed to be either nonhomogeneous or nonspecific in our qualitative analysis; therefore, they have been omitted from the quantitative analysis.

Each sample was analyzed in three separate experiments. Serial dilutions of the different samples to be analyzed were amplified for Thy-1. Appropriate dilutions of each sample were chosen to give equivalent levels of product for this reaction.

Nomenclature

Throughout the article we have used the World Health Organization-International Union of Immunological Societies revised nomenclature for the designation of ADV family numbers (World Health Organization-International Union of Immunological Societies Nomenclature Subcommittee on TCR Designation, 1995).

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Oligonucleotide primers were initially tested on samples from 4-wk-old BALB/c thymi. As described in Materials and Methods, primer sequences were chosen to detect all the members of a given ADV family and to give equivalent amplification rates. PCR products were sequenced to ensure their specificity in the ADV region. The results obtained from the qualitative PCR analysis (Fig. 1) indicate that all the families tested were transcribed with one or another of the constant regions. The majority (21 of 23 families) were transcribed with AC; the two remaining families, DV101 and DV105, were found only as PCR products corresponding to TCR transcripts at this time point. The 23 ADV families studied can be classed in four groups, 1) those that are consistently found in both TCR and TCR transcripts, 2) those that are found in TCR transcripts but rarely in TCR transcripts, 3) those that are never found in TCR transcripts, and 4) those that are found exclusively in TCR transcripts. The details of the different groups of ADV families are given in the following sections.

View larger version (29K): [in this window] [in a new window]   FIGURE 1. ADV genes expressed used in TCR and TCR chain transcripts. cDNA from adult BALB/c thymus was amplified using oligonucleotides specific for each of the ADV families in conjunction with either AC- or DC-specific primers. Products are shown run on 1.5% agarose gels. A similar image is obtained after Southern blotting using probes in the constant regions. The specificity of all ADV-AC products was confirmed by sequencing. For ADV-DC, sequencing revealed specificity for the following PCR products: ADV1, -2, -3, -3x, -4, -5, -6, -7, -10, -13, -15, -17, -20, -101, -102, and -105. For ADV8 and ADV11 the PCR product is heterogeneous, whereas ADV-DC PCR products for ADV12, -14, -16, and -18 do not correspond to the requisite sequences. *, Bands corresponding to nonspecific products, as determined by sequencing (see Materials and Methods). -, PCR reactions giving consistently negative results.

ADV families used as part of both TCR and TCR transcripts

The ADV1, ADV2, ADV3, ADV3x, ADV4, ADV5, ADV6, ADV7, ADV10, ADV13, ADV15, ADV17, ADV20, and DV102 families are found transcribed with the constant regions of both TCR- and TCR-chains (Fig. 1). The results for ADV2, -4, -6, -7, -10, and -17 confirmed those from our previous studies and evidence from other groups (3, 7, 8, 15, 16, 17, 18, 19, 20, 21, 22, 23). In addition, for ADV2 and ADV7 we have shown that all members of each family are rearranged and transcribed with both and constant regions (7, 8) (Table I and data not shown). For the ADV1, -3, -3x, -5, -13, -15, and -20 families, no TCR transcripts had previously been described (6). The results of sequencing analysis for ADV-AC and -DC PCR products confirmed that these families were expressed as part of both TCR and TCR transcripts. This is the first report describing such extensive use of ADV segments by the -chain, indicating that while TCR diversity is indeed reduced compared with TCR diversity at the V level, it is considerably greater than previously supposed.

View this table: [in this window] [in a new window]   Table I. Use of ADV7 family members by the TCR chain evolves during ontogeny

ADV families rarely found as part of TCR transcripts

In previous studies (8, 24) PCR products corresponding to ADV8- and ADV11-DC transcripts were not found. In this study we detected weak bands for ADV8- and ADV11-DC PCR products (Fig. 1 and data not shown). The specificity of these PCR products was determined by sequencing. While sequences for PCR products corresponding to TCR transcripts for these two families contained only the specified ADV segment, the majority of the sequences obtained for products of ADV8-DC (16 of 21) and ADV11-DC (13 of 15) did not correspond to the families sought. These observations indicate that although ADV8 and ADV11 family members can rearrange to DD/DJ segments, the frequency of these events is low.

ADV families used in TCR transcripts only

The ADV12-, ADV14-, ADV16-, and ADV18-DC PCR products were revealed upon cloning and sequencing to contain ADV families other than those sought, this was despite the fact that the ADV-AC PCR products contained only the ADV regions of interest (data not shown). ADV19-DC PCR reactions have consistently failed to give a product (Fig. 1). The results for these five ADV families are in agreement with the data found in the literature, summarized previously (6). No TCR transcripts containing ADV12, -14, -16, -18, or -19 have ever been detected.

DV101, DV102, and DV105 families

The DV101, DV102, and DV105 families are generally held to be exclusively reserved for the formation of TCR-chains (6). However, one report indicates that these segments can be rearranged with AJ segments and expressed as TCR transcripts (25), and a second indicates the possibility of alternative splicing of ADV-DD-DJ rearrangements to AC (26). In this study we could not detect DV101- or DV105-AC transcripts in samples from young adult mice, whereas we were easily able to detect DV102-AC transcripts (Fig. 1).

Direct sequence analysis of the PCR product using the same DV102 oligonucleotide as for the amplification reaction revealed a unique V segment, corresponding to the DV102 gene. To determine whether the transcripts we detected used AJ segments or corresponded to a product of alternative splicing of DV102-(DD)-DJ to the AC constant region, as described for DV104 and ADV2S8 by Livak and Schatz (26), we cloned and sequenced the DV102-AC product. Sequencing of 27 clones (10 examples are shown in Table II) revealed only true TCR chain transcripts and no alternatively spliced forms for this V gene. Analysis of the sequences indicated that DV102 can rearrange with a wide range of AJ segments. The majority of these transcripts (19 of 27) are in-frame, supporting the idea that these can be expressed as functional TCR receptors.

An absence of TCR transcripts could result from an absence or low level of transcription or, alternatively, a failure at the rearrangement level. To distinguish between these possibilities, we looked for rearrangements on genomic DNA from young adult thymus. These PCR reactions used the set of V-specific oligonucleotides designed for RT-PCR in conjunction with primers specific for DJ1 and DJ2. Rearrangements of ADV7, -17, and -20 with DJ were easily detectable, whereas bands corresponding to ADV8-, ADV12-, ADV16-, ADV18-, and ADV19-DJ were weak or undetectable, confirming the results obtained at the transcript level. ADV11- and ADV14-DJ amplification reactions gave strong nonspecific bands (data not shown). As a whole, these results indicate that a failure to detect TCR transcripts containing a given ADV family truly reflects an absence or very low level of rearrangement events. In support of these observations, a study on a large panel of TCR hybridomas also showed that the restricted use of ADV segments by the TCR chain is regulated at the V(D)J rearrangement level (29)

Comparing frequencies of ADV-AC and ADV-DC transcripts

This first set of qualitative results, presented in Fig. 1, allows us to define differences in the use of ADV families by the TCR- and TCR-chains. To complete our study we undertook a quantitative comparison of the use of the ADV segments by the two chains at different ontogenic stages.

Taken together, the preceding results indicate that some ADV families are used less frequently than others to form TCR transcripts. This observation raises the question of quantitative differences. Do AC-containing transcripts also present such quantitative differences? If so, are the same ADV segments used most frequently by both TCR and TCR transcripts, and how does this use evolve during development? To answer these questions we used quantitative PCR technology that allows on-line monitoring of the appearance of PCR products. Primer couples that did not give a 100% pure product in our qualitative analysis were not used in quantification experiments.

It has been established that DV101 and DV105 families are expressed at different levels in fetal and adult thymi (17, 30). We used this observation to validate our quantitative analysis by comparing levels of transcripts of these families in fetal and adult thymi. We found that TCR transcripts in the fetal thymus mainly contain DV101, while in the adult thymus DV105 predominates (Fig. 2). Fetal day 16 (F16)³ and fetal day 18 (F18) samples showed variation of two and three cycles between DV101 and DV105, respectively, corresponding to an approximately 5-fold difference in transcript levels. At 4 wk of age the relative quantities of transcripts were reversed, and DV105 transcripts were present in about 10-fold greater numbers than those corresponding to DV101. These results correlate to the established relative levels of expression in fetal and adult thymi (17, 30), validating our quantitative PCR method. Levels of transcription of the different ADV families as part of TCR- or TCR-chains can therefore be compared by this technique. Using the same primer couples, the end results of amplification by both qualitative and quantitative PCR methods are identical, with the exception of the ADV15-DC PCR, which did not generate a product in the conditions used for the quantitative PCR analysis. The average yield for both ADV-AC and ADV-DC reactions was approximately 85%. Thus, by quantitative PCR, the order of appearance of the different products corresponds to the relative abundance of the transcripts in a given cDNA sample, the most abundant being the first to be detected. Intersample reproducibility was confirmed on three separate 4-wk-old BALB/c thymi. For all three animals, near identical results were obtained (Figs. 2 and 3).

View larger version (15K): [in this window] [in a new window]   FIGURE 2. Relative abundance of ADV-AC and ADV-DC transcripts, as determined by quantitative PCR analysis. ADV families are indicated by their number alone, according to the cycle at which a product is first detected. Comparison of fetal and adult ADV-AC transcripts (upper part). Comparison of fetal and adult ADV-DC transcripts (lower part). Samples were normalized for Thy-1 expression. Results for adult thymus were confirmed for three individuals. Fetal samples represent a pool of thymi.

View larger version (33K): [in this window] [in a new window]   FIGURE 3. Quantification of TCR and TCR transcripts. cDNA from thymic samples was amplified using oligonucleotides specific for each of the ADV families in conjunction with either AC- or DC-specific primers. Amplification was followed in real time on a LightCycler. The results shown are representative of nine separate experiments on three individual adult thymus samples. Results for ADV1, -2, -3, -7, and -13-AC and -DC for 4-wk-old BALB/c thymus are shown. Graphs represent log of fluorescence intensity as a function of cycle number (shown on x-axis).

Relative abundance of ADV-AC transcripts

ADV-AC transcripts were undetectable on F16 by this method. They become detectable on F18, albeit at much lower levels than in 4-wk-old thymus. The sets of ADV families used as part of TCR transcripts at the fetal and adult stages are not identical, and those families that are detected in both samples are not used in similar proportions. In the F18 sample a DV101-AC product is detectable, corresponding to the most abundant transcript at this stage, whereas a product of this nature is absent from the young adult thymus (Figs. 1 and 2). In contrast, ADV1 is among the most abundantly represented families in the TCR transcript pool in the adult thymus (a result expected given that it was one of the first ADV families to be identified), while in the F18 sample ADV1-AC products are among the least abundant (75 times less represented than DV101-AC). In addition, several ADV families are undetectable as part of TCR transcripts in the F18 sample: ADV3x, -4, -7, -12, -15, -16, -18, and -19. It is interesting to note that a number of these (ADV12, -16, -18, and -19) are classed among the families that are not found as part of TCR transcripts in the adult thymus. This may indicate that these families cannot rearrange in the cells present in the fetal thymus on day 18 due to unfavorable chromatin structure, inhibition by the promoter region of the ADV segments, or regulation related to the recombination signal sequence. On day 18 the fetal thymus is mainly populated by CD4^-/CD8^- (double-negative (DN)) cells with low levels (20%) of CD4⁺/CD8⁺ (double-positive (DP)) cells. This observation could give a clue about the rules governing the use of different ADV segments by the TCR and TCR chains. The majority of TCRD rearrangements occur in DN populations, while TCRA rearrangements mainly occur in late DN stage and DP cells (31, 32). The cells entering the DP compartment in the F18 thymus may not be sufficiently mature to allow the full complement of TCRA rearrangements to occur. The results of the current study indicate an evolution of the use of gene segments on the TCRAD locus over the entire set of ADV segments. They also demonstrate that TCR-chains are produced in regulated waves during thymic development, as is the case for the TCR and TCR chains.

Relative abundance of ADV-DC transcripts

ADV-DC transcripts were detectable at all time points studied by this method. F16 samples expressed low levels of transcripts, with DV101 and DV105 corresponding to the most abundantly represented ADV families. A number of other families, ADV1, -2, -3, -3x, -5, -7, -10, -17, and -20, were detectable at 20-fold lower levels. In the F18 sample, TCR transcription is at a similar level to that found in the adult thymus, which corresponds to a global increase in TCR transcription relative to the F16 sample. DV101 is the most abundant ADV segment expressed as part of a TCR transcript on F18, closely followed by ADV2, -7, -10, and -17 (demonstrating increases of between 500- and 10,000-fold for these transcripts between F16 and F18) DV105 and DV102. ADV1, -3, -5, -6, -13, and -20 are expressed at lower levels. In the adult thymus, DV105-DC predominates in the TCR transcript pool, followed by a selection of 14 other ADV families (see Fig. 2 for details). These results contrast with those of Weber-Arden et al. (24), who describe the transcription of only three predominant families, ADV7, ADV17, and DV104, as part of TCR-chains in the young adult mouse using a different method. Taken together, the results at the three different time points reveal a number of tendencies for ADV segments used as part of TCR transcripts: families whose expression increases with age (DV105 and 102, ADV6, -3x, and -20), families whose expression levels off from F18 (ADV1, -2, -3, -5, -7, -10, -13, and -17), and DV101, whose expression increases between F16 and F18, but diminishes in the adult thymus.

It is assumed that the majority of TCRD rearrangements occur in the DN compartment in the thymus. This leads to the question of the comparability of the results obtained from the fetal and adult thymi, given that these represent such different cellular populations. In the F18 sample, which consists mainly of DN and some DP cells, levels of TCR and TCR transcripts are similar, with TCR slightly outnumbering TCR. At 4 wk of age, when all cellular populations are present (DN, DP, and single positive), the majority of cells are either DP or single positive. We detect a corresponding increase in the numbers of TCR transcripts, while global TCR transcript levels remain similar to those detected on F18, being detectable from cycle 23. This indicates that we can compare the different populations, as global levels of TCR transcripts are not influenced by the changing thymic structure beyond F18 when the necessary populations for TCR cell production are already present.

It is apparent from these results that in addition to the evolution of the use of ADV segments by the TCR chain over the course of ontogeny, the repertoire of ADV segments used in TCR transcripts in the adult thymus is very different from that in TCR transcripts. As shown in Fig. 2, with the exception of ADV2 and ADV17, the ADV families most used as part of TCR chains correspond to those least used as part of TCR chain transcripts.

Are there clear rules governing the ADV families used to form TCR and/or TCR transcripts?

We have established a detailed locus map (Fig. 4) using previously published data (4, 5, 7) and the sequences published in the GenBank database (accession no. NT_002581). Using this and the results detailed above we attempted to find a clear rule indicating the families likely to be used by one or both TCR chains.

View larger version (23K): [in this window] [in a new window]   FIGURE 4. Detailed map of the ADV region of the BALB/c TCRAD locus. The detailed map was constructed using the sequences published in the GenBank database (compiled under accession no. NT_002581) and previously published data (4 5 7 ). ADV family names are indicated above the line representing the locus; when identified, member names are shown preceded by S below the line. The transcriptional orientation of ADV segments is identical with that of the constant regions, except for those indicated by an arrow. Sequencing of the 5' end of the locus is incomplete; the shaded box contains ADV families known to be located in this region (7 ). The inset and sections of the map represented by dotted lines are not to scale. The complete region, between the start of the ADV4 segment located in 5' and the end of DV105, in 3', measures 1200 kb. For the zones not to scale: between the ADV11 member located 5' of ADV1S7 and the ADV4 member that follows measures 16 kb; from ADV2S7 to ADV5S3 measures 21 kb; and 66 kb separate the end of DV101 and the start of DV105. The families consistently transcribed with both AC and DC constant regions are underlined.

Considering the families not found as part of TCR transcripts, ADV12 and ADV19 are single-member families, situated at the far 5' end of the locus, most distal from the constant regions. While both are readily detectable as part of TCR transcripts, they are undetectable in the TCR transcript population. These results could be interpreted to indicate a role played by the position on the TCRAD locus in the choice of ADV gene families used in ADV-DD-DJ rearrangement events, as suggested by others (24). However, if we examine the positions of the three remaining families not found as part of TCR transcripts, it becomes apparent that this cannot be the sole explanation. Members of the ADV14, ADV16, and ADV18 families are found in proximity to gene segments that can be detected in ADV-DC PCR products. One member of the ADV16 family is situated a mere 20 kb from the DV102 gene segment, the two ADV14 members are each located at just 2 kb from a member of the ADV4 family, and ADV18 is a four-member family, each of the four members being located about 8 kb from other ADV gene segments (either ADV1 or ADV10), which can be used to form TCR chains. These considerations make it unlikely that the position of an ADV gene segment on the locus relative to the constant regions plays a primordial role in its use as part of a TCR or TCR chain in the adult thymus. However, regulation of the permissible rearrangements seems to be directly linked to each ADV family; this could be governed by highly localized chromatin structures, differences in promoter regions, or recombination signal sequences associated with each of the ADV segments, and not necessarily detectable by sequence comparison.

Concluding remarks

In this article we provide new insights into the ADV families expressed as part of TCR and TCR transcripts. We have used a simple and rapid method to analyze the complete repertoires on a quantitative level. We validated our approach using data from the literature (17, 30), showing an evolution in the use of the DV101 and DV105 segments by the TCR-chain in the developing thymus. We extended these results to the description of the evolution of the full TCR and TCR repertoires over the course of thymic ontogeny, using samples from fetuses on days 16 and 18 and from 4-wk-old adult animals. Our results clearly show that a large number of ADV segments can be used indifferently to form both TCR and TCR transcripts. This group of ADV families is revealed to be larger than previously supposed (6), indicating that TCR-chain diversity is potentially greater than has been assumed to date. During development, the ADV segment used by the TCR-chain gradually extends, commencing with a repertoire largely restricted to DV101 and DV105 at F16 and culminating at 4 wk of age with the expression of 16 different ADV families. How the choice of a given family to form a TCR or TCR chain is made remains unclear. Analysis of the disposition of the various ADV families on the TCRAD locus did not reveal a consensus, nor were there any obviously conserved sequence motifs in the ADV sequences and their flanking regions for the different groups. It has been demonstrated that localized chromatin configurations play an important role in the regulation of rearrangement events by permitting or blocking the rearrangement machinery from acceding to the DNA (33). This may indeed be part of the mechanism used on the TCRAD locus, as we have noted that ADV families not used as part of TCR chains are often found in close proximity to ADV families that can be used. In addition, in the F18 thymus a number of ADV families are undetectable as part of TCR transcripts, and several of these families correspond to those that are never detected as part of ADV-DC transcripts. TCRD rearrangements occur mostly in the DN compartment, in which population the chromatin may be in a configuration rendering V-(D)-J rearrangement impossible at distinct sites. On F18 only a small fraction of thymocytes have reached the DP compartment, where the majority of TCRA rearrangements take place (32). Full chromatin accessibility may not be achieved immediately upon passing from the DN to the DP population, some further maturation of the cells may be necessary before the full complement of rearrangement events can occur. The regulation of the accessibility of the ADV gene segments to the recombination machinery during T cell development probably plays an essential role in establishing the intrathymic TCR repertoire and may be regulated by factors other than chromatin structure alone. These other factors include motifs contained in the promoter regions and/or the recombination signal sequences associated with each of the ADV segments. The highly regulated nature of this type of control is demonstrated by the fact that in individual mice intrathymic repertoires are nearly identical.

	Acknowledgments

 
We thank Drs. S. Candéias and R. Ceredig for discussion and criticism of the manuscript and S. Sarda for help with ADV7 sequencing.

	Footnotes

 
¹ This work was supported by institutional grants from Institut National de la Santé et de la Recherche Médical, Commissariat à l’Energie Atomique de Grenoble, and Université Joseph Fourier. M.G. was supported by a fellowship from the Commissariat à l’Energie Atomique, France.

² Address correspondence and reprint requests to Dr. Patrice N. Marche, Departement Biologie Moleculaire et Structurale/Immunochimie, Commissariat à l’Energie Atomique de Grenoble, 17 rue des Martyrs, 38054 Grenoble Cedex 9, France. E-mail address: immuno{at}dsvsud.cea.fr

³ Abbreviations used in this paper: F16, fetal day 16; F18, fetal day 18; DN, double negative; DP, double positive.

Received for publication October 31, 2000. Accepted for publication May 16, 2001.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Letourneur, F., M. G. Mattei, B. Malissen. 1989. The mouse CD3-, -, and - genes reside within 50 kilobases on chromosome 9, whereas CD3-zeta maps to chromosome 1, band H. Immunogenetics 29:265.[Medline]
2. Lewis, S. M.. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv. Immunol. 56:27.[Medline]
3. Chien, Y. H., M. Iwashima, K. B. Kaplan, J. F. Elliott, M. M. Davis. 1987. A new T-cell receptor gene located within the locus and expressed early in T-cell differentiation. Nature 327:677.[Medline]
4. Jouvin-Marche, E., I. Hue, P. N. Marche, C. Liebe-Gris, J. P. Marolleau, B. Malissen, P. A. Cazenave, M. Malissen. 1990. Genomic organization of the mouse T cell receptor V family. EMBO J. 9:2141.[Medline]
5. Wang, K., J. L. Klotz, G. Kiser, G. Bristol, E. Hays, E. Lai, E. Gese, M. Kronenberg, L. Hood. 1994. Organization of the V gene segments in mouse T-cell antigen receptor / locus. Genomics 20:419.[Medline]
6. Arden, B., S. P. Clark, D. Kabelitz, T. W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics 42:501.[Medline]
7. Jouvin-Marche, E., C. Aude-Garcia, S. Candeias, E. Borel, S. Hachemi-Rachedi, H. Gahery-Segard, P. A. Cazenave, P. N. Marche. 1998. Differential chronology of TCRADV2 gene use by - and -chains of the mouse TCR. Eur. J. Immunol. 28:818.[Medline]
8. Gallagher, M., S. Candeias, C. Martinon, E. Borel, M. Malissen, P. N. Marche, E. Jouvin-Marche. 1998. Use of TCR ADV gene segments by the -chain is independent of their position and of CD3 expression. Eur. J. Immunol. 28:3878.[Medline]
9. Brenner, M. B., J. McLean, D. P. Dialynas, J. L. Strominger, J. A. Smith, F. L. Owen, J. G. Seidman, S. Ip, F. Rosen, M. S. Krangel. 1986. Identification of a putative second T-cell receptor. Nature 322:145.[Medline]
10. Koop, B. F., L. Rowen, K. Wang, C. L. Kuo, D. Seto, J. A. Lenstra, S. Howard, W. Shan, P. Deshpande, L. Hood. 1994. The human T-cell receptor TCRAC/TCRDC (C/C) region: organization, sequence, and evolution of 97.6 kb of DNA. Genomics 19:478.[Medline]
11. Li, S., M. F. Wilkinson. 1998. Nonsense surveillance in lymphocytes?. Immunity. 8:135.[Medline]
12. Kearse, K. P., Y. Takahama, J. A. Punt, S. O. Sharrow, A. Singer. 1995. Early molecular events induced by T cell receptor (TCR) signaling in immature CD4⁺ CD8⁺ thymocytes: increased synthesis of TCR- protein is an early response to TCR signaling that compensates for TCR- instability, improves TCR assembly, and parallels other indicators of positive selection. J. Exp. Med. 181:193.[Abstract/Free Full Text]
13. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograms. Nucleic Acids Res. 25:3389.[Abstract/Free Full Text]
14. Chelly, J., J. C. Kaplan, P. Maire, S. Gautron, A. Kahn. 1988. Transcription of the dystrophin gene in human muscle and non-muscle tissue. Nature 333:858.[Medline]
15. Happ, M. P., E. Palmer. 1989. Thymocyte development: an analysis of T cell receptor gene expression in 519 newborn thymocyte hybridomas. Eur. J. Immunol. 19:1317.[Medline]
16. Elliott, J. F., E. P. Rock, P. A. Patten, M. M. Davis, Y. Chien. 1988. The adult T-cell receptor -chain is diverse and distinct from that of fetal thymocytes. Nature 331:627.[Medline]
17. Chien, Y. H., M. Iwashima, D. A. Wettstein, K. B. Kaplan, J. F. Elliott, W. Born, M. M. Davis. 1987. T-cell receptor gene rearrangements in early thymocytes. Nature 330:722.[Medline]
18. McConnell, T. J., W. M. Yokoyama, G. E. Kikuchi, G. P. Einhorn, G. Stingl, E. M. Shevach, J. E. Coligan. 1989. -chains of dendritic epidermal T cell receptors are diverse but pair with -chains in a restricted manner. J. Immunol. 142:2924.[Abstract]
19. Takagaki, Y., N. Nakanishi, I. Ishida, O. Kanagawa, S. Tonegawa. 1989. T cell receptor- and - genes preferentially utilized by adult thymocytes for the surface expression. J. Immunol. 142:2112.[Abstract]
20. Takeshita, S., M. Toda, H. Yamagishi. 1989. Excision products of the T cell receptor gene support a progressive rearrangement model of the / locus. EMBO J. 8:3261.[Medline]
21. Arden, B., J. L. Klotz, G. Siu, L. E. Hood. 1985. Diversity and structure of genes of the family of mouse T-cell antigen receptor. Nature 316:783.[Medline]
22. Korman, A. J., S. Marusic-Galesic, D. Spencer, A. M. Kruisbeek, D. H. Raulet. 1988. Predominant variable region gene usage by / T cell receptor-bearing cells in the adult thymus. J. Exp. Med. 168:1021.[Abstract/Free Full Text]
23. Okazaki, K., H. Sakano. 1988. Thymocyte circular DNA excised from T cell receptor - gene complex. EMBO J. 7:1669.[Medline]
24. Weber-Arden, J., O. M. Wilbert, D. Kabelitz, B. Arden. 2000. V repertoire during thymic ontogeny suggests three novel waves of TCR expression. J. Immunol. 164:1002.[Abstract/Free Full Text]
25. Wang, K., C. L. Kuo, B. F. Koop, L. Hood. 1994. The expression of mouse T-cell receptor TCRDV genes in BALB/c spleen. Immunogenetics 40:271.[Medline]
26. Livak, F., D. G. Schatz. 1998. Alternative splicing of rearranged T cell receptor sequences to the constant region of the locus. Proc. Natl. Acad. Sci. USA 95:5694.[Abstract/Free Full Text]
27. Koop, B. F., R. K. Wilson, K. Wang, B. Vernooij, D. Zallwer, C. L. Kuo, D. Seto, M. Toda, L. Hood. 1992. Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C/C region. Genomics 13:1209.[Medline]
28. Chothia, C., D. R. Boswell, A. M. Lesk. 1998. The outline structure of the T-cell receptor. EMBO J. 7:3745.[Medline]
29. Pereira, P., V. Hermitte, M.-P. Lembezqt, L. Boucontet, V. Azuara, K. Grigoriadou. 2000. Developmentally regulated and lineage-specific rearrangement of T cell receptor V/ gene segments. Eur. J. Immunol. 30:1988.[Medline]
30. Ito, K., M. Bonneville, Y. Takagaki, N. Nakanishi, O. Kanagawa, E. G. Krecko, S. Tonegawa. 1989. Different T-cell receptors are expressed on thymocytes at different stages of development. Proc. Natl. Acad. Sci. USA 86:631.[Abstract/Free Full Text]
31. Mertsching, E., A. Wilson, H. R. MacDonald, R. Ceredig. 1997. T cell receptor [gene] rearrangement and transcription in adult thymic cells. Eur. J. Immunol. 27:389.[Medline]
32. Fowlkes, B. J., D. M. Pardoll. 1989. Molecular and cellular events of T cell development. Adv. Immunol. 44:207.[Medline]
33. McMurry, M. T., M. S. Krangel. 2000. A role for histone acetylation in the developmental regulation of VDJ recombination. Science 287:495.[Abstract/Free Full Text]

This article has been cited by other articles:

				A. Hawwari and M. S. Krangel Regulation of TCR {delta} and {alpha} repertoires by local and long-distance control of variable gene segment chromatin structure J. Exp. Med., August 15, 2005; 202(4): 467 - 472. [Abstract] [Full Text] [PDF]

				T.-P. Baum, N. Pasqual, F. Thuderoz, V. Hierle, D. Chaume, M.-P. Lefranc, E. Jouvin-Marche, P.-N. Marche, and J. Demongeot IMGT/GeneInfo: enhancing V(D)J recombination database accessibility Nucleic Acids Res., January 1, 2004; 32(90001): D51 - 54. [Abstract] [Full Text] [PDF]

				N. Pasqual, M. Gallagher, C. Aude-Garcia, M. Loiodice, F. Thuderoz, J. Demongeot, R. Ceredig, P. N. Marche, and E. Jouvin-Marche Quantitative and Qualitative Changes in V-J {alpha} Rearrangements During Mouse Thymocytes Differentiation: Implication For a Limited T Cell Receptor {alpha} Chain Repertoire J. Exp. Med., November 4, 2002; 196(9): 1163 - 1174. [Abstract] [Full Text] [PDF]

				A. Rizzitelli, R. Berthier, V. Collin, S. M. Candeias, and P. N. Marche T Lymphocytes Potentiate Murine Dendritic Cells to Produce IL-12 J. Immunol., October 15, 2002; 169(8): 4237 - 4245. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gallagher, M. Articles by Jouvin-Marche, E. Search for Related Content PubMed PubMed Citation Articles by Gallagher, M. Articles by Jouvin-Marche, E.