The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kunisawa, J.
Right arrow Articles by Mayumi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kunisawa, J.
Right arrow Articles by Mayumi, T.
The Journal of Immunology, 2001, 167: 1406-1412.
Copyright © 2001 by The American Association of Immunologists

Sendai Virus Fusion Protein-Mediates Simultaneous Induction of MHC Class I/II-Dependent Mucosal and Systemic Immune Responses Via the Nasopharyngeal-Associated Lymphoreticular Tissue Immune System1

Jun Kunisawa*,{dagger}, Tsuyoshi Nakanishi*, Ichiro Takahashi{dagger}, Akiko Okudaira*,{dagger}, Yasuo Tsutsumi*, Kazufumi Katayama*,{dagger}, Shinsaku Nakagawa*, Hiroshi Kiyono{dagger} and Tadanori Mayumi2,*

* Department of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, and {dagger} Department of Mucosal Immunology, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nasal administration of Ags using a novel hybrid Ag delivery vehicle composed of envelope glycoproteins of Sendai virus on the surface of liposome membranes (fusogenic liposome) efficiently delivered Ags to Ag-sampling M cells in nasopharyngeal-associated lymphoreticular tissue. Additionally, fusogenic liposomes also effectively delivered the Ags into epithelial cells and macrophages in nasopharyngeal-associated lymphoreticular tissue and nasal passages. In vitro Ag presentation assays clearly showed that fusogenic liposomes effectively presented encapsulated Ags via the MHC class II-dependent pathway of epithelial cells as well as macrophages. Fusogenic liposomes also have an adjuvant activity against mucosal epithelial cells to enhance MHC class II expression. According to these high delivery and adjuvant activities of fusogenic liposomes, nasal immunization with OVA-encapsulated fusogenic liposomes induced high levels of OVA-specific CD4+ Th1 and Th2 cell responses. Furthermore, Ag-specific CTL responses and Ab productions were also elicited at both mucosal and systemic sites by nasal immunization with Ag-encapsulated fusogenic liposomes. These results indicate that fusogenic liposome is a versatile and effective system for the stimulation of Ag-specific immune responses at both mucosal and systemic compartments.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The mucosal surfaces are primary sites that many virus and bacteria invade to establish infection. To prevent such microorganism transmission across the mucosal epithelium and dissemination to the regional lymph nodes or target organ, much effort has been focused on the development of a mucosal vaccine because oral or nasal immunization elicits both mucosal and systemic immune responses (1, 2, 3). Such responses include secretory IgA and IgG Abs that are reported to mediate microorganism neutralization and prevent adhesion to the epithelium. In addition, induction of CTL responses may be essential for virus clearance from mucosal tissue to prevent virus dissemination if the mucosal barrier is destroyed (4, 5).

It has been shown that mucosal delivery of soluble Ag alone is insufficient for the induction of sufficient levels of Ag-specific immune responses. In this respect, various attempts have aimed to improve the efficacy of mucosal vaccines using mucosal adjuvant (6, 7, 8) or Ag delivery systems (9, 10). We have developed fusogenic liposomes, consisting of liposomes fused with Sendai virus, attached and fused cells, and delivered their encapsulated protein and plasmid DNA into the cytoplasm of the attached cells (11, 12, 13). We also reported that s.c. immunization with Ag-encapsulated fusogenic liposomes induced Ag-specific CTL responses at systemic lymphoid tissues in a MHC class I-dependent manner (14) in addition to Ag-specific Ab production in sera (15). Because Sendai virus naturally infects via the mucosal epithelium (16, 17), fusogenic liposomes may effectively deliver the Ag to the mucosal immune system and induce Ag-specific mucosal and systemic immune responses.

The present study demonstrates the effectiveness of fusogenic liposomes as a new and novel nasal vaccine vehicle with which to generate optimal nasopharyngeal-associated lymphoreticular tissue (NALT)3-mediated mucosal as well as systemic immune responses.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice and cell lines

Female C57BL/6 and BALB/c mice (7–10 wk old) were purchased from Charles River Breeding Laboratories (Yokohama, Japan). The CD4+ T cell hybridoma, 3A9, specific for peptide 46–61 of hen egg white lysozyme (HEL) in the context of I-Ak, was provided by Dr. P. Allen (Washington University, St. Louis, MO) (18). MODE-K, an intestinal epithelial cell line, was provided by Dr. D. Kaiserlian (Institute Pasteur, Lyon, France) (19). IL-2-dependent CTLL-2 cell was a kind gift from Dr. T. Hamaoka (Osaka University, Osaka, Japan). EL4, a C57BL/6 mice-derived T lymphoma, was obtained from Tohoku University (Sendai, Japan). EG7, which is a chicken egg OVA gene-transfected clone of EL4 and which presents OVA with MHC class I molecules, was obtained from the American Type Culture Collection (Manassas, VA) (20).

Preparation of fusogenic liposomes

Fusogenic liposomes were prepared as described previously (14, 15, 21, 22). Briefly, lipid mixture (L-{alpha}-dimyristoyl phosphatidic acid/phosphatidylcholine/cholesterol in a molar ratio of 1:4:5) was dissolved in chloroform (Sigma, St. Louis, MO). The solvent was subsequently evaporated to obtain a thin lipid film. Conventional liposomes were prepared by dispersing the thin lipid film with a given amount of FITC-labeled dextran (50 mg/ml), OVA (100 mg/ml), or HEL (50 mg/ml) solution using a vortex and freeze-thaw method, and sized by extrusion through a 400-nm polycarbonate membrane. Sized liposomes were mixed with UV-inactivated Sendai virus and incubated at 37°C for 2 h with shaking. Fusogenic liposomes were finally purified by sucrose step centrifugation (24,000 rpm, 2 h, 4°C).

In vitro uptake analysis using confocal microscopy

MODE-K cells were cultured overnight. After removing the supernatant, various FITC-dextrans (100 µg/ml) were added, and the cells were cultured for 1 h at 37°C, washed, and observed using a confocal microscope (Bio-Rad, Hercules, CA).

Ag presentation assay

Ag presentation was assayed as described (19). Briefly, macrophages isolated from peritoneal exude cells or IFN-{gamma}-treated (50 U/ml for 3 days) MODE-K cells were cultured with 50 µg/ml mitomycin C at 37°C for 45 min. The cells were washed and incubated for 2 h at 37°C (5 x 104 cells/well). Various concentrations of HEL (0.1, 1, 10, 100 µg/ml) or OVA (100 µg/ml) in fusogenic liposomes were added and cocultured for an additional 5 h. After incubation, the cells were washed, and HEL-specific T-T hybridomas (3A9 cells) were added (5 x 104 cells/well). After 24 h of culture, the supernatants were collected, and IL-2 production in the supernatants was quantified using an IL-2-dependent CTLL-2 cell line.

Analysis of MHC class II expression on epithelial cells

To determine whether fusogenic liposomes enhance MHC class II expression of epithelial cells, MODE-K cells were cultured with the same lipid concentration of fusogenic liposomes, conventional liposomes, or Sendai virus for 48 h. Following three washings, cells were incubated with anti-CD16/32 (Fc block; BD PharMingen, San Diego, CA) for 15 min at room temperature and then stained with PE-labeled anti-I-Ak Ab (BD PharMingen) for 30 min at 4°C. These cells were washed three times and analyzed by flow cytometry analysis using a FACScan flow cytometer (Becton Dickinson, Mansfield, MA).

Isolation of mononuclear cells

Mononuclear cells from the nasal passages, NALT, mesenteric lymph nodes (MLN), intestinal lamina propria, cervical lymph nodes (CLN), and spleen were isolated as previously described (7, 8, 23). In brief, mononuclear cells from NALT and nasal passages were prepared as follows. Pear-shaped NALT was removed from the palate. After the removal of NALT, the nasal passages were also isolated from the nasal cavity. Mononuclear cells from the CLN, MLN, and spleen were also isolated using mechanical dissociation. Intestinal lamina propria mononuclear cells were isolated by an enzymatic dissociation procedure with collagenase type IV (Sigma).

In vivo Ag distribution assay

Mice were nasally administered with various formed FITC-dextrans (5 mg/ml; Sigma). After 1 h, mononuclear cells were isolated from NALT and nasal passages as described above, then epithelial cells were purified by discontinuous Percoll gradient centrifugation (25 and 40%) according to the method described previously (24). Mac-1+ cells were detected using a PE-labeled anti-Mac-1 Ab (Caltag, Burlingame, CA). Fluorescence-positive cells were measured using a FACScan flow cytometer.

Immunohistological analysis using confocal microscopy

M cells were detected using whole-mount staining with the M cell-specific lectin, ulex europaeus agglutinin-1 (UEA-1; Vector Laboratories, Burlingame, CA) (25, 26). One hour after nasal administration with fusogenic liposomes containing FITC-dextrans, palates were dissected and fixed with 4% paraformaldehyde at 4°C for 4 h. The specimens were then blocked with diluted (2x) Block Ace (Dai-Nippon Pharmaceutical, Osaka, Japan) for 1 h at room temperature and then stained with PBS containing rhodamine-labeled UEA-1 (20 µg/ml) for 2 h at room temperature. The specimens were finally washed and examined by a confocal microscope.

Immunization

Mice were nasally immunized with 10-µl aliquots of fusogenic liposomes or conventional liposomes containing 50 µg of OVA on days 0, 7, and 14. Another group of mice was nasally immunized with OVA alone.

Proliferative responses of Ag-specific CD4+ T cells

Seven days after the final immunization, lymphocytes were obtained from spleen, CLN, NALT, nasal passages, and MLN. CD4+ T cells were then purified by using anti-mouse CD4 (L3T4)-coupled microbeads and MACS column (Miltenyi Biotec, Sunnyvale, CA) (8). Purified CD4+ T cells were cultured at a density of 2 x 106 cells/ml with 1 mg/ml OVA in the presence of irradiated (3000 rad) splenic feeder cells (2 x 106 cells/ml) at 37°C for 96 h. To measure cell proliferation, 1 µCi of [3H]thymidine was added to individual culture wells 8 h before termination, and the uptake of [3H]thymidine by dividing cells was determined by scintillation counting.

Cytokine analysis by ELISA

Cytokine levels in culture supernatants of Ag-stimulated CD4+ T cells were determined by a cytokine-specific ELISA (7, 8). Briefly, CD4+ T cells obtained from spleen, CLN, NALT, nasal passages, and MLN of the immunized mice were cultured with 1 mg/ml OVA in the presence of irradiated (3000 rad) splenic feeder cells. Culture supernatants were harvested 96 h after incubation, and the levels of Th1 (IFN-{gamma})- and Th2 (IL-4, IL-5, and IL-6)-type cytokines were determined by cytokine-specific ELISA kit (Amersham Pharmacia Biotech, Piscataway, NJ). The concentration of cytokines was calculated by the standard curves obtained according to the instruction provided by the manufacturer.

Detection of OVA-specific Ab production by ELISA

A standard isotype and Ag-specific ELISA was used in this study (6, 7, 8, 9). ELISA plates were coated with 10 µg/ml OVA in 50 mM bicarbonate buffer. Wells were blocked with 2-fold diluted Block Ace (Dai-Nippon Pharmaceutical) for 1 h at room temperature. After washing four times with PBS containing 0.05% Tween 20 (PBS-T), each diluted serum, nasal washes and fecal extracts were added in duplicate (50 µl/well). Serum and fecal extracts from nonimmunized mice were included as controls. Biotin-labeled anti-mouse IgG, IgG1, IgG2a, IgG2b, IgG3, IgM, or IgA (Southern Biotechnology Associates, Birmingham, AL) were used as the detection Ab. Following 8 h incubation at room temperature, plates were washed, and HRP-conjugated strepavidin (Life Technologies, Gaithersburg, MD) was added. The reaction was developed by 3,3',5,5'-tetramethylbenzidine (Moss, Pasadena, CA), and color development was terminated after a 15-min incubation by addition of 0.5 N HCl. Endpoint titers were expressed as the reciprocal log2 of the last dilution, which gave an OD at 450 nm of 0.1 greater than nonimmunized mice.

Detection of OVA-specific Ab-forming cells (AFCs)

Seven days after the final immunization, mononuclear cells were obtained from spleen, nasal passages, and intestinal lamina propria. To assess the numbers of OVA-specific AFCs, an ELISPOT assay was used (6, 7, 8). Briefly, 96-well nitrocellulose plates (Millititer; Millipore, Bedford, MA) were coated with OVA (1 mg/ml in PBS) and blocked with RPMI 1640 containing 10% FCS. The blocking solution was discarded, and 100 µl of cells in complete RPMI 1640 at various dilutions was added. Following 5 h incubation at 37°C, plates were washed three times with PBS and PBS-T. The detection Ab for IgM, IgG, and IgA isotypes conjugated with HRP (Southern Biotechnology Associates) in PBS-T was then added. Following overnight incubation, plates were washed four times with PBS and developed by the addition of 100 µl of 3-amino-9-ethylcarbazole dissolved in 0.1 M sodium acetate buffer containing 0.015% H2O2 (Moss) to each well. Plates were incubated at room temperature for 20–30 min and washed with water, and AFCs were determined by direct counting of spots with the aid of a stereomicroscope.

OVA-specific CTL assay

Seven days after the final immunization, a standard CTL assay was performed (14, 27, 28). Briefly, in vivo-primed single cells usually were cultured with mitomycin C-treated (50 µg/ml) EG7 for 5 days to expand Ag-specific CTLs and were used as effector cells. EL4 and EG7 were labeled with 51Cr for 60 min and added to serially diluted effector cells in 96-well microplates. After a 4-h incubation, 51Cr levels in the supernatants were determined using a gamma counter. The specific lysis of target cells was determined as follows: (experimental cpm - spontaneous cpm)/(maximum cpm - spontaneous cpm) x 100.

RT-PCR

Seven days after the final immunization, total RNA was isolated from nasal passage lymphocytes (8). Complementary DNA was synthesized using the standard method and amplified by PCR (8). After 30 cycles of amplification using specific primers (sense for perforin, GGAATTCAGATCGGAGGATTTTAAA; antisense for perforin, GACTACTGTGCCTGCAGCATC) (29), the amplified products were separated by electrophoresis in 1.8% agarose gel and visualized with ethidium bromide.

Statistics

The results were compared using Student’s t test and Welch’s t test. The values were considered statistically significant when p < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Fusogenic liposomes effectively deliver the Ag to NALT

To demonstrate the effectiveness of fusogenic liposomes as a mucosal Ag delivery vehicle, mice were nasally administered with FITC-dextran encapsulated in either fusogenic liposomes (FITC-fusogenic liposomes), conventional liposomes (FITC-liposomes), or with FITC alone. One hour later, the fluorescent intensity of epithelial and mononuclear cells isolated from NALT and nasal passages were examined using a FACScan flow cytometer. Both epithelial and Mac-1+ cells isolated from NALT or nasal passages emitted intense fluorescence following nasal administration with FITC-fusogenic liposomes. In contrast, no cells were fluorescent in either the NALT or nasal passages of mice nasally administered with FITC alone or with FITC-liposomes (Fig. 1Go, A–D). This finding was also supported by an in vitro study showing intense fluorescence in a mucosal epithelial cell line (MODE-K cells) cocultured with FITC-fusogenic liposomes but not with FITC-liposomes or with FITC alone (Fig. 1Go, E–H).



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 1. In vivo Ag distribution following nasal administration with fusogenic liposomes (A–D). One hour after nasal administration with FITC-fusogenic liposomes (red), FITC-liposomes (green), FITC alone (blue), or none (black), epithelial cells (A) and Mac-1+ cells (B) of NALT, and epithelial cells (C) and Mac-1+ cells (D) of nasal passages were isolated. Fluorescent intensity was detected using a FACScan flow cytometer. Analysis of in vitro Ag uptake by epithelial cells (E–H). MODE-K cells were cultured with FITC alone (E), FITC-liposomes (F), or FITC-fusogenic liposomes (G). After 1 h, cells were washed and observed by confocal microscopy. The same sample was observed by transmission microscopy (H, white bar indicates 50 µm). The results were confirmed by three independent experiments.

 
It has been reported that M cells can be recognized by {alpha}-L-fucose-specific lectin (UEA-1) in the epithelial layer of NALT (25, 26). These cells are morphologically different from neighboring epithelial cells and specialized for the uptake and transcellular transport of Ags to NALT dendritic cells and macrophages (30, 31, 32). In this regard, we examined whether or not fusogenic liposomes have the ability to fuse with M cells for efficient delivery of Ag into NALT. Confocal microscopic analysis using rhodamine-labeled UEA-1 revealed that fusogenic liposomes delivered their contents (FITC-dextran) to M cells as well as to neighboring epithelial cells (Fig. 2Go).



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 2. Whole mount staining of NALT from mice nasally administered with FITC-fusogenic liposomes using rhodamine-labeled UEA-1. NALT was stained with rhodamine-labeled UEA-1 (B). Following nasal administration with FITC-fusogenic liposomes, NALT was then counter stained with rhodamine-labeled UEA-1 (C). Yellow and green colors indicate M cells and epithelial cells taken up by Ag, respectively. Findings from three independent experiments were similar.

 
Fusogenic liposomes can induce MHC class II-restricted Ag presentation and MHC class II expression

Because fusogenic liposomes effectively delivered Ags to mucosal epithelial and Mac-1+ cells, we examined whether the contents of fusogenic liposomes are presented with MHC molecules. MODE-K cells and freshly isolated macrophages were exposed to fusogenic liposomes containing HEL in vitro. The MHC class II-restricted Ag presentations were briskly noted in macrophages cultured with fusogenic liposomes containing HEL (Fig. 3GoA). Furthermore, the Ag presentation ability of IFN-{gamma}-pretreated MODE-K cells cocultured with fusogenic liposomes containing HEL was also similar (Fig. 3GoB). In contrast, macrophages and MODE-K cells treated with fusogenic liposomes containing irrelevant OVA did not stimulate HEL-specific T cell hybridoma to synthesize IL-2.



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 3. Fusogenic liposomes induced MHC class II-mediated Ag presentation of HEL. Macrophages (A) or IFN-{gamma} pretreated MODE-K cells (B) were cultured with fusogenic liposomes containing HEL ({blacksquare}) or OVA (100 µg/ml, ) for 5 h, then Ag presentation was analyzed as described in Materials and Methods. Values are expressed as means ± SD of triplicate cultures. Fusogenic liposomes activated expression of MHC class II molecules on epithelial cells (C). MODE-K cells were cultured with conventional liposomes (pink), fusogenic liposomes (red), or Sendai virus (light blue). Cells were stained with anti-I-Ak Ab 48 h later. Expression was determined using a FACScan flow cytometer. Data are representative of three separate experiments.

 
It was also shown that several viruses stimulated the expression of MHC molecules and the production of cytokines and chemokines by infected epithelial cells (33, 34). In this respect, we found that fusogenic liposomes as well as Sendai virus activated infected epithelial cells to express MHC class II molecules (Fig. 3GoC). However, conventional liposomes did not affect the MHC class II expression on epithelial cells (Fig. 3GoC).

Fusogenic liposomes induce both Th1- and Th2-type responses

Nasal immunization of Ag with a mucosal adjuvant (e.g., cholera toxin and heat-labile toxin) usually evokes Ag-specific immune responses including Th1- and Th2-type CD4+ T cells in both mucosal and systemic compartments (6, 7, 8). In this context, we examined the proliferative response of CD4+ T cells from the NALT, nasal passages, spleen, CLN, and MLN of mice nasally immunized with OVA incorporated into fusogenic liposomes (OVA-fusogenic liposomes) against soluble OVA. As shown in Fig. 4Go, high levels of OVA-specific proliferative responses were detected in CD4+ T cells isolated from both mucosal (NALT, nasal passages, CLN, MLN) and systemic (spleen) compartments of mice nasally immunized with OVA-fusogenic liposomes. However, OVA-specific proliferative responses were virtually undetectable in mice nasally immunized with OVA using conventional liposomes (OVA-liposomes) or OVA alone (Fig. 4Go). This finding demonstrated that nasally administered fusogenic liposomes delivered Ag to and stimulated NALT and associated immune compartments.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 4. Nasally administered OVA-fusogenic liposomes induced Ag-specific proliferative responses of CD4+ T cell. Seven days after the final nasal immunization with various forms of OVA ({square}, OVA alone; , OVA-liposomes; {blacksquare}, OVA-fusogenic liposomes), CD4+ T cells from spleen, CLN, NALT, nasal passages (NP), and MLN were isolated and cultured with 1 mg/ml OVA. Proliferative responses were determined by [3H]thymidine. Error bars indicate means ± SE for four mice analyzed separately in triplicate assays. *, p < 0.01 vs OVA-liposomes.

 
To characterize Ag-specific CD4+ T cells in the mucosal and systemic tissues of mice nasally immunized with OVA-fusogenic liposomes, Th1 (IFN-{gamma})- and Th2 (IL-4, IL-5, and IL-6)-specific cytokines production was examined. A large amount of Th1- and Th2-type cytokines were noted in the NALT, nasal passages, CLN, MLN, and spleen of mice immunized with OVA-fusogenic liposomes (Fig. 5Go). These findings suggest that fusogenic liposomes can induce both mucosal and systemic Th1- and Th2-type CD4+ T cells without a coadministered mucosal adjuvant (e.g., cholera toxin and heat-labile toxin).



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 5. Characterization of Th1 (IFN-{gamma})- and Th2 (IL-4, IL-5, and IL-6)-type cytokine productions by OVA-specific CD4+ T cells. Seven days after the final nasal immunization, CD4+ T cells from spleen, CLN, NALT, nasal passages (NP), and MLN were isolated and cultured with 1 mg/ml OVA for 96 h. Cytokine productions in the culture supernatants were determined by the appropriate cytokine-specific ELISA ({square}, OVA alone; , OVA-liposomes; {blacksquare}, OVA-fusogenic liposomes). Error bars indicate means ± SE for four mice analyzed separately in triplicate assays. * and **, p < 0.01 and p < 0.05, respectively (vs OVA-liposomes).

 
Fusogenic liposomes induce Ag-specific humoral immune responses

We next investigated Ag-specific humoral responses at both mucosal and systemic sites. The OVA-specific IgG responses in the serum of mice nasally immunized with OVA-fusogenic liposomes were significantly higher than those of sera from mice immunized with OVA alone or OVA-liposomes (Fig. 6GoA). Consistent with the outcome of the cytokine profile (e.g., IL-4 and IFN-{gamma}) of OVA-specific CD4+ T cells (Fig. 5Go), high titers of OVA-specific IgG1, IgG2a, and IgG2b were produced in sera (Fig. 6GoB). OVA-specific IgA responses were higher in nasal washes from mice nasally immunized with OVA-fusogenic liposomes than from those immunized with OVA alone or OVA-liposomes (Fig. 6GoC). Fusogenic liposomes also induced OVA-specific IgA responses in fecal extracts (Fig. 6GoD). Results obtained from analyzing Ag-specific AFCs supported the finding of OVA-specific Ab responses in mucosal secretions and serum. Thus, the numbers of OVA-specific IgA and IgG AFCs were increased in the nasal passages, intestinal lamina propria, and spleen of mice nasally immunized with OVA-fusogenic liposomes (Fig. 7Go). These findings further emphasize the value of fusogenic liposomes as a novel mucosal Ag delivery vehicle.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 6. OVA-specific Ab responses after nasal immunization with OVA-fusogenic liposomes. Serum IgG, IgA, and IgM responses (A), serum IgG subclass responses (B), IgG, IgA, and IgM responses in nasal washes (C), and in fecal extracts (D) were determined by ELISA ({square}, OVA alone; , OVA-liposomes; {blacksquare}, OVA-fusogenic liposomes). Findings are expressed as means ± SE of four mice analyzed separately in triplicate assays. *, p < 0.05 vs OVA-liposomes.

 


View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 7. Induction of Ag-specific AFCs in mucosal and systemic compartments of mice nasally immunized with OVA-fusogenic liposomes. OVA-specific IgM, IgG, and IgA AFCs in spleen (A), nasal passages (B), and intestinal lamina propria (C) were determined by ELISPOT assay ({square}, OVA alone; , OVA-liposomes; {blacksquare}, OVA-fusogenic liposomes). Findings are expressed as means ± SE of four mice analyzed separately in triplicate assays. *, p < 0.05 vs OVA-liposomes.

 
Induction of OVA-specific CTL responses

Ag-specific Th1-type responses in addition to Th2-type responses were induced by nasal immunization with OVA-fusogenic liposomes (Fig. 5Go). Thus, we examined whether or not fusogenic liposomes can induce MHC class I-mediated OVA-specific CTL responses. CTL activity against EG7 was detected in the spleens of mice immunized with OVA-fusogenic liposomes following in vitro restimulation with Ag (Fig. 8GoC). In contrast, spleens isolated from mice immunized nasally with OVA alone or OVA-liposomes did not show OVA-specific CTL activity (Fig. 8Go, A and B). In addition, mononuclear cells from CLN and MLN of mice nasally immunized with OVA-fusogenic liposomes also showed OVA-specific CTL activity after in vitro restimulation with Ag (Fig. 8GoC). Furthermore, high levels of the mRNA for perforin that is a major cytotoxic molecule of CTL were expressed in the nasal passages of mice nasally immunized with OVA-fusogenic liposomes but not with OVA-liposomes or OVA alone (Fig. 8GoD). These findings suggested that nasally administered OVA-fusogenic liposomes induced Ag-specific CTL responses.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 8. Nasal immunization with OVA-fusogenic liposomes induced OVA-specific CTL responses. Seven days after the final nasal immunization, mononuclear cells from the spleen, CLN, and MLN of mice nasally immunized with OVA alone (A), OVA-liposomes (B), or OVA-fusogenic liposomes (C) were isolated and restimulated with MMC-treated EG7 for 5 days to enhance the frequency of Ag-specific CTLs. CTL activity against EG7 (•) or EL4 ({circ}) were measured by 51Cr release assay. Messenger RNA expression of perforin in nasal passages was determined (D) as described in Materials and Methods (lane 1, OVA alone; lane 2, OVA-liposomes; lane 3, OVA-fusogenic liposomes). Each analysis was performed at least three times.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
It is important to develop novel strategies to induce Ag-specific immune responses at both mucosal and systemic compartments for the prevention of infectious diseases localized at or introduced by mucosal surface (1, 2, 3). In this study, we demonstrated the potential of fusogenic liposomes as a nasal vaccine vehicle. We previously reported that fusogenic liposomes were composed of conventional liposomes and Sendai virus and attached to the cell membrane using envelope glycoproteins of Sendai virus (11, 13, 14, 15). In addition, it is well known that Sendai virus naturally infects via mucosal epithelia (16, 17). In this context, in vivo Ag distribution assay showed that fusogenic liposomes also attached to the nasal epithelia and delivered the encapsulated Ag (Fig. 1Go, A and C), according to the high Ag-delivery activity to mucosal epithelial cells in vitro (Fig. 1GoG). In contrast, conventional liposomes as well as Ag alone could not deliver the Ag into the nasal immune systems. It has been reported that the conventional liposome is a good candidate as an Ag delivery vehicle, especially for s.c. immunization (27, 35, 36). However, in the case of mucosal vaccine, the conventional liposome is not effective because mucosal barriers prevent the incursion of the conventional liposome into the nasal immune system.

It has been reported that M cells are morphologically different from neighboring epithelial cells and are specialized for the uptake and transcellular transport of particle Ags and microorganisms from the lumen to the lymphoid follicles (30, 31, 32). Thus, it seems that M cell is a target cell for the efficient delivery of vaccine Ag into NALT. In this regard, we examined whether or not fusogenic liposomes fused and delivered the Ag to M cells. Confocal microscopic analysis using M cell-specific lectin revealed that fusogenic liposomes delivered the Ag to M cells as well as to neighboring epithelial cells (Fig. 2Go). These findings demonstrated that fusogenic liposomes constitute an effective Ag delivery system for M cells, epithelial cells, and Mac-1+ cells in nasal immune compartments.

In this study, it was also demonstrated that Ag delivered by fusogenic liposomes were presented with MHC class II molecules of epithelial cells as well as macrophages (Fig. 3Go, A and B). Several studies concerning the Ag presentation ability of mucosal epithelial cells have been reported (37, 38, 39). These studies showed that epithelial cells had the potential to present Ags via both MHC class I and II molecules and to activate T cells with costimulatory molecules. It has been also shown that several viruses stimulated the expression of MHC molecules on infected epithelial cells (33, 40). In this respect, we found that fusogenic liposomes are also capable of inducing epithelial cells to express MHC class II molecules (Fig. 3GoC). These data suggest that fusogenic liposomes had an adjuvant activity against epithelial cells to enhance the MHC class II-mediated Ag presentation.

As shown in Figs. 4Go and 5Go, fusogenic liposomes induced high levels of Th1 and Th2 responses. It is interesting to note that two distinct patterns of Th2-type cytokines were induced between inductive (NALT) and effective (nasal passage) sites of the nasal immune system. In the NALT of mice immunized with OVA-fusogenic liposomes, high levels of IL-4 produced by Ag-specific CD4+ Th2 cells may provide a molecular environment for the preferential induction of Ig class switching from µ to {alpha} H chains. IL-4 supports TGF-{beta}-induced IgA-specific class switching in NALT (41, 42, 43). Additionally, another group of Th2-type cytokines including IL-5 and IL-6 induces the differentiation of IgA-committed B cells to plasma cells in the mucosal effector site (41, 42, 43). Thus, high production of IL-5 and IL-6 was observed in CD4+ T cells isolated from the nasal passages of mice nasally immunized with OVA-fusogenic liposomes. Furthermore, the induction of Th1-type cytokines such as IFN-{gamma} indicates the simultaneous generation of cell-mediated immunity including CTL. In addition, the production of IFN-{gamma}, especially by nasal passage CD4+ T cells, may create an optimal molecular environment for the efficient production of Ag-specific secretory IgA synthesis, because the induction of the secretory component (or poly-Ig receptor) is up-regulated by IFN-{gamma} (44).

As expected based on the cytokine profile of Ag-specific Th1 and Th2 cells, it was shown that fusogenic liposomes induced high levels of OVA-specific mucosal and systemic Ab responses (Figs. 6Go and 7Go). According to previous studies, the coadministration of mucosal adjuvant was essential to generate Ag-specific mucosal and systemic immune responses via the respiratory and gastrointestinal immune system (6, 8). A separate study showed that nasal vaccination with Streptococcus pneumonia pneumococcal surface protein A and the nontoxic mutant cholera toxin S61F induced protective immunity through Ag-specific mucosal IgA and systemic IgG Ab responses (7). However, nasal vaccine containing pneumococcal surface protein A alone did not cause the generation of Ag-specific Th and B cell responses. In contrast, fusogenic liposomes can effectively induce Ag-specific Th1 and Th2 cells in addition to the associated IgG and IgA Ab responses in both mucosal and systemic sites without mucosal adjuvant. Additionally, OVA-specific CTL responses were induced following nasal immunization with OVA-fusogenic liposomes (Fig. 8Go). Direct intracellular delivery of Ag via the fusion process may guide an encapsulated Ag to the MHC class I pathway. In support of this, we have already shown that fusogenic liposomes can deliver encapsulated Ags into the MHC class I-dependent pathway (14). These data strongly suggest that the fusogenic liposome is an effective nasal Ag delivery vehicle, especially against to virus infection due to their activities to induce Ag-specific CTL responses as well as Ab productions.

A similar vehicle (known as proteoliposome) was previously developed by the other groups (45, 46, 47). This proteoliposome has been prepared by reconstituting biologically active Sendai virus glycoprotein into conventional liposomes using a dialysis method (45, 46, 47). It was shown that rhesus monkeys develop Ag-specific CTL responses at the systemic compartments following systemic immunization with proteoliposomes containing SIV Ag (45). However, the application of the proteoliposome as a vaccine was somehow targeted only the induction of systemic immune response. Therefore, the present study is the first to demonstrate the feasibility of fusogenic liposomes as an effective mucosal Ag delivery system for the induction of mucosal as well as systemic immune responses.

In summary, this study demonstrated that novel hybrid fusogenic liposomes constitute a powerful mucosal vaccine delivery system that can elicit Ag-specific CTL, Th1/Th2, and IgG and IgA Ab responses in mucosal and systemic sites.


   Footnotes
 
1 This research was supported, in part, by grants-in-aid for Scientific Research from the Ministry of Education, Science, Sports, and Culture of Japan, the Ministry of Health and Welfare of Japan, and the Organization for Pharmaceutical Safety and Research of Japan. J.K. is a Research Fellow of the Japan Society for the Promotion of Science. Back

2 Address correspondence and reprint requests to Dr. Tadanori Mayumi, Department of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871, Japan. E-mail address: mayumi{at}phs.osaka-u.ac.jp Back

3 Abbreviations used in this paper: NALT, nasopharyngeal-associated lymphoreticular tissue; HEL, hen egg white lysozyme; UEA-1, ulex europaeus agglutinin-1; CLN, cervical lymph nodes; MLN, mesenteric lymph nodes; PBS-T, PBS containing 0.05% Tween 20; AFC, Ab-forming cell. Back

Received for publication March 19, 2001. Accepted for publication May 22, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. McGee, J. R., H. Kiyono. 1999. The mucosal immune system. W. E. Paul, ed. In Fundamental Immunology Vol. 4:909. Lippincott-Raven, Philadelphia.
  2. Boyaka, P. N., M. Marinaro, J. L. Vancott, I. Takahashi, K. Fujihashi, M. Yamamoto, F. W. van Ginkel, R. J. Jackson, H. Kiyono, J. R. McGhee. 1999. Strategies for mucosal vaccine development. Am. J. Trop. Med. Hyg. 60:35.[Abstract]
  3. Cardenas-Freytag, L., E. Cheng, A. Mirza. 1999. New approaches to mucosal immunization. Adv. Exp. Med. Biol. 473:319.[Medline]
  4. Stevceva, L., A. G. Abimiku, G. Franchini. 2000. Targeting the mucosa: genetically engineered vaccines and mucosal immune responses. Genes Immun. 1:308.[Medline]
  5. FitzGerald, D., R. J. Mrsny. 2000. New approaches to antigen delivery. Crit. Rev. Ther. Drug Carrier Syst. 17:165.[Medline]
  6. Yamamoto, S., H. Kiyono, M. Yamamoto, K. Imaoka, K. Fujihashi, F. W. Van Ginkel, M. Noda, Y. Takeda, J. R. McGhee. 1997. A nontoxic mutant of cholera toxin elicits Th2-type responses for enhanced mucosal immunity. Proc. Natl. Acad. Sci. USA 94:5267.[Abstract/Free Full Text]
  7. Yamamoto, M., D. E. Briles, S. Yamamoto, M. Ohmura, H. Kiyono, J. R. McGhee. 1998. A nontoxic adjuvant for mucosal immunity to pneumococcal surface protein A. J. Immunol. 161:4115.[Abstract/Free Full Text]
  8. Yanagita, M., T. Hiroi, N. Kitagaki, S. Hamada, H. O. Ito, H. Shimauchi, S. Murakami, H. Okada, H. Kiyono. 1999. Nasopharyngeal-associated lymphoreticular tissue (NALT) immunity: fimbriae-specific Th1 and Th2 cell-regulated IgA responses for the inhibition of bacterial attachment to epithelial cells and subsequent inflammatory cytokine production. J. Immunol. 162:3559.[Abstract/Free Full Text]
  9. Kunisawa, J., A. Okudaira, Y. Tsutsumi, I. Takahashi, T. Nakanishi, H. Kiyono, T. Mayumi. 2000. Characterization of mucoadhesive microspheres for the induction of mucosal and systemic immune responses. Vaccine 19:589.[Medline]
  10. Singh, M., D. O’Hagan. 1999. Advances in vaccine adjuvants. Nat. Biotechnol. 17:1075.[Medline]
  11. Mizuguchi, H., T. Nakagawa, S. Toyosawa, M. Nakanishi, S. Imazu, T. Nakanishi, Y. Tsutsumi, S. Nakagawa, T. Hayakawa, N. Ijuhin, T. Mayumi. 1998. Tumor necrosis factor {alpha}-mediated tumor regression by the in vivo transfer of genes into the artery that leads to tumors. Cancer Res. 58:5725.[Abstract/Free Full Text]
  12. Nakanishi, M., H. Mizuguchi, K. Ashihara, T. Senda, T. Akuta, J. Okabe, E. Nagoshi, A. Masago, A. Eguchi, Y. Suzuki, et al 1998. Gene transfer vectors based on Sendai virus. J. Controlled Release 54:61.[Medline]
  13. Nakanishi, M., H. Mizuguchi, K. Ashihara, T. Senda, A. Eguchi, A. Watabe, T. Nakanishi, M. Kondo, T. Nakagawa, A. Masago, et al 1999. Gene delivery systems using the Sendai virus. Mol. Membr. Biol. 16:123.[Medline]
  14. Nakanishi, T., A. Hayashi, J. Kunisawa, Y. Tsutsumi, K. Tanaka, Y. Yashiro-Ohtani, M. Nakanishi, H. Fujiwara, T. Hamaoka, T. Mayumi. 2000. Fusogenic liposomes efficiently deliver exogenous antigen through the cytoplasm into the MHC class I processing pathway. Eur. J. Immunol. 30:1740.[Medline]
  15. Hayashi, A., T. Nakanishi, J. Kunisawa, M. Kondoh, S. Imazu, Y. Tsutsumi, K. Tanaka, H. Fujiwara, T. Hamaoka, T. Mayumi. 1999. A novel vaccine delivery system using immunopotentiating fusogenic liposomes. Biochem. Biophys. Acta 261:824.
  16. Tashiro, M., N. L. McQueen, J. T. Seto. 1999. Determinants of organ tropism of Sendai virus. Front. Biosci. 4:D642.[Medline]
  17. Yonemitsu, Y., C. Kitson, S. Ferrari, R. Farley, U. Griesenbach, D. Judd, R. Steel, P. Scheid, J. Zhu, P. K. Jeffery, et al 2000. Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nat. Biotechnol. 18:970.[Medline]
  18. Allen, P. M., E. R. Unanue. 1984. Processing and presentation of hen egg-white lysozyme by macrophages. Immunobiology 168:182.[Medline]
  19. Vidal, K., I. Grosjean, J. P. Evillard, C. Gespach, D. Kaiserlian. 1993. Immortalization of mouse intestinal epithelial cells by the SV40-large T gene: phenotypic and immune characterization of the MODE-K cell line. J. Immunol. Methods 166:63.[Medline]
  20. Moore, M. W., F. R. Carbone, M. J. Bevan. 1988. Introduction of soluble protein into the class I pathway of antigen processing and presentation. Cell 54:777.[Medline]
  21. Mizuguchi, H., M. Nakanishi, T. Nakanishi, T. Nakagawa, S. Nakagawa, T. Mayumi. 1996. Application of fusogenic liposomes containing fragment A of diphtheria toxin to cancer therapy. Br. J. Cancer 73:472.[Medline]
  22. Watabe, A., T. Yamaguchi, T. Kawanishi, E. Uchida, A. Eguchi, H. Mizuguchi, T. Mayumi, M. Nakanishi, T. Hayakawa. 1999. Target-cell specificity of fusogenic liposomes: membrane fusion-mediated macromolecule delivery into human blood mononuclear cells. Biochim. Biophys. Acta 1416:339.[Medline]
  23. Hiroi, T., K. Iwatani, H. Iijima, S. Kodama, M. Yanagita, H. Kiyono. 1998. Nasal immune system: distinctive Th0 and Th1/Th2 type environments in murine nasal-associated lymphoid tissues and nasal passage, respectively. Eur. J. Immunol. 28:3346.[Medline]
  24. Yamamoto, M., K. Fujihashi, K. Kawabata, J. R. McGhee, H. Kiyono. 1998. A mucosal intranet: intestinal epithelial cells down-regulate intraepithelial, but not peripheral, T lymphocytes. J. Immunol. 160:2188.[Abstract/Free Full Text]
  25. Hassid, S., I. Salmon, M. Brugmans, S. Dawance, R. Kiss, H. J. Gabius, A. Danguy. 1997. Histochemical study of the epithelia of nasal polyps by biotinylated lectins and neoglycoprotein: a comparison with the normal human respiratory epithelium. Eur. J. Morphol. 35:79.[Medline]
  26. Takata, S., O. Ohtani, Y. Watanabe. 2000. Lectin binding patterns in rat nasal-associated lymphoid tissue (NALT) and the influence of various types of lectin on particle uptake in NALT. Arch. Histol. Cytol. 63:305.[Medline]
  27. Nakanishi, T., J. Kunisawa, A. Hayashi, Y. Tsutsumi, K. Kubo, S. Nakagawa, H. Fujiwara, T. Hamaoka, T. Mayumi. 1997. Positively charged liposome functions as an efficient immunoadjuvant in inducing immune responses to soluble proteins. Biochem. Biophys. Res. Commun. 240:793.[Medline]
  28. Ma, H., J. A. Kapp. 2000. Antigenic epitopes regulate the phenotype of CD8+ CTL primed by exogenous antigens. J. Immunol. 164:5698.[Abstract/Free Full Text]
  29. Shiraishi, H., S. Hayakawa, K. Satoh. 1996. Murine experimental abortion by IL-2 administration is caused by activation of cytotoxic T lymphocytes and placental apoptosis. J. Clin. Lab. Immunol. 48:93.[Medline]
  30. Frey, A., M. R. Neutra. 1997. Targeting of mucosal vaccines to Peyer’s patch M cells. Behring Inst. Mitt. 98:376.
  31. Hathaway, L. J., J. P. Kraehenbuhl. 2000. The role of M cells in mucosal immunity. Cell. Mol. Life Sci. 57:323.[Medline]
  32. Sansonetti, P. J., A. Phalipon. 1999. M cells as ports of entry for enteroinvasive pathogens: mechanisms of interaction, consequences for the disease process. Semin. Immunol. 11:193.[Medline]
  33. Gao, J., B. P. De, A. K. Banerjee. 1999. Human parainfluenza virus type 3 up-regulates major histocompatibility complex class I and II expression on respiratory epithelial cells: involvement of a STAT1- and CIITA-independent pathway. J. Virol. 73:1411.[Abstract/Free Full Text]
  34. Terajima, M., M. Yamaya, K. Sekizawa, S. Okinaga, T. Suzuki, N. Yamada, K. Nakayama, T. Ohrui, T. Oshima, Y. Numazaki, H. Sasaki. 1997. Rhinovirus infection of primary cultures of human tracheal epithelium: role of ICAM-1 and IL-1{beta}. Am. J. Physiol. 273:L749.[Abstract/Free Full Text]
  35. Nakanishi, T., J. Kunisawa, A. Hayashi, Y. Tsutsumi, K. Kubo, S. Nakagawa, M. Nakanishi, K. Tanaka, T. Mayumi. 1999. Positively charged liposome functions as an efficient immunoadjuvant in inducing cell-mediated immune response to soluble proteins. J. Controlled Release 61:233.[Medline]
  36. Gregoriadis, G., B. McCormack, M. Obrenovic, R. Saffie, B. Zadi, Y. Perrie. 1999. Vaccine entrapment in liposomes. Methods 19:156.[Medline]
  37. Mayer, L. F., R. S. Blumberg. 1999. Antigen presenting cells: epithelial cells. P. L. Ogra, and J. Mestecky, and M. E. Lamm, and W. Storober, and J. Bienesnstock, and J. R. McGhee, eds. In Mucosal Immunogy Vol. 2:365. Academic Press, San Diego.
  38. Hershberg, R. M., L. F. Mayer. 2000. Antigen processing and presentation by intestinal epithelial cells—polarity and complexity. Immunol. Today 21:123.[Medline]
  39. Telega, G. W., D. C. Baumgart, S. R. Carding. 2000. Uptake and presentation of antigen to T cells by primary colonic epithelial cells in normal and diseased states. Gastroenterology 119:1548.[Medline]
  40. Papi, A., L. A. Stanciu, N. G. Papadopoulos, L. M. Teran, S. T. Holgate, S. L. Johnston. 2000. Rhinovirus infection induces major histocompatibility complex class I and costimulatory molecule up-regulation on respiratory epithelial cells. J. Infect. Dis. 181:1780.[Medline]
  41. Takatsu, K.. 1997. Cytokines involved in B-cell differentiation and their sites of action. Proc. Soc. Exp. Biol. Med. 215:121.[Medline]
  42. Jackson, R. J., M. Marinaro, J. L. VanCott, M. Yamamoto, N. Okahashi, K. Fujihashi, H. Kiyono, S. N. Chatfield, J. R. McGhee. 1996. Mucosal immunity: regulation by helper T cells and a novel method for detection. J. Biotechnol. 44:209.[Medline]
  43. Husband, A. J., S. Bao, K. W. Beagley. 1999. Analysis of the mucosal microenvironment: factors determining successful responses to mucosal vaccines. Vet. Immunol. Immunopathol. 72:135.[Medline]
  44. Mestecky, J., J. R. McGhee. 1987. Immunoglobulin A (IgA): molecular and cellular interactions involved in IgA biosynthesis and immune response. Adv. Immunol. 40:153.[Medline]
  45. Miller, M. D., S. Gould-Fogerite, L. Shen, R. M. Woods, S. Koenig, R. J. Mannino, N. L. Letvin. 1992. Vaccination of rhesus monkeys with synthetic peptide in a fusogenic proteoliposome elicits simian immunodeficiency virus-specific CD8+ cytotoxic T lymphocytes. J. Exp. Med. 176:1739.[Abstract/Free Full Text]
  46. Gould-Fogerite, S., J. E. Mazurkiewicz, Jr K. Raska, K. Voelkerding, J. M. Lehman, R. J. Mannino. 1989. Chimerasome-mediated gene transfer in vitro and in vivo. Gene 84:429.[Medline]
  47. Gould-Fogerite, S., R. J. Mannino. 1985. Rotary dialysis: its application to the preparation of large liposomes and large proteoliposomes (protein-lipid vesicles) with high encapsulation efficiency and efficient reconstitution of membrane proteins. Anal. Biochem. 148:15.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. Gohda, J. Kunisawa, F. Miura, Y. Kagiyama, Y. Kurashima, M. Higuchi, I. Ishikawa, I. Ogahara, and H. Kiyono
Sphingosine 1-Phosphate Regulates the Egress of IgA Plasmablasts from Peyer's Patches for Intestinal IgA Responses
J. Immunol., April 15, 2008; 180(8): 5335 - 5343.
[Abstract] [Full Text] [PDF]

Home page
 BioinformaticsHome page
M. M. Gosink, H. T. Petrie, and N. F. Tsinoremas
Electronically subtracting expression patterns from a mixed cell population
Bioinformatics, December 15, 2007; 23(24): 3328 - 3334.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. Kunisawa, Y. Kurashima, M. Higuchi, M. Gohda, I. Ishikawa, I. Ogahara, N. Kim, M. Shimizu, and H. Kiyono
Sphingosine 1-phosphate dependence in the regulation of lymphocyte trafficking to the gut epithelium
J. Exp. Med., October 1, 2007; 204(10): 2335 - 2348.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. Kurashima, J. Kunisawa, M. Higuchi, M. Gohda, I. Ishikawa, N. Takayama, M. Shimizu, and H. Kiyono
Sphingosine 1-Phosphate-Mediated Trafficking of Pathogenic Th2 and Mast Cells for the Control of Food Allergy
J. Immunol., August 1, 2007; 179(3): 1577 - 1585.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. Kunisawa, Y. Kurashima, M. Gohda, M. Higuchi, I. Ishikawa, F. Miura, I. Ogahara, and H. Kiyono
Sphingosine 1-phosphate regulates peritoneal B-cell trafficking for subsequent intestinal IgA production
Blood, May 1, 2007; 109(9): 3749 - 3756.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
G. Sakaue, T. Hiroi, Y. Nakagawa, K. Someya, K. Iwatani, Y. Sawa, H. Takahashi, M. Honda, J. Kunisawa, and H. Kiyono
HIV Mucosal Vaccine: Nasal Immunization with gp160-Encapsulated Hemagglutinating Virus of Japan-Liposome Induces Antigen-Specific CTLs and Neutralizing Antibody Responses
J. Immunol., January 1, 2003; 170(1): 495 - 502.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kunisawa, J.
Right arrow Articles by Mayumi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kunisawa, J.
Right arrow Articles by Mayumi, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS