HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Qi, L. Articles by Ostrand-Rosenberg, S. Search for Related Content PubMed PubMed Citation Articles by Qi, L. Articles by Ostrand-Rosenberg, S.

H2-O Inhibits Presentation of Bacterial Superantigens, but Not Endogenous Self Antigens¹

Department of Biological Sciences, University of Maryland, Baltimore, MD 21250

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
H2-O/HLA-DO are MHC class II accessory molecules that modulate exogenous Ag presentation. Most class II accessory molecules are expressed in all professional APC; however, H2-O is only expressed in B cells and medullary thymic epithelial cells. Because B cells present exogenous Ags and superantigens (SAgs), and medullary thymic epithelial cells are specialized APC for self Ags during negative selection in the thymus, we have hypothesized that H2-O might play a role in MHC class II-restricted SAg and self Ag presentation. In this study, we demonstrate that H2-O expression inhibits presentation of the bacterial SAgs staphylococcal enterotoxins A and B to four SAg-reactive T hybridoma cells. In contrast, H2-O has no effect on presentation of endogenous self Ags, as measured by tumorigenicity in vivo and Ag presentation to three self Ag-specific T hybridoma cells. Additional experiments suggest that H2-O inhibits presentation of exogenous Ags by both newly synthesized and recycling MHC class II molecules. These data suggest H2-O may have a physiological role in tolerance induction and SAg-mediated toxic shock.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
CD4⁺ T lymphocytes are activated by antigenic peptides presented by MHC class II molecules of APC. MHC class II-associated accessory molecules play an essential role in guiding MHC class II molecules in their intracellular trafficking patterns and in shaping the class II peptide repertoire (1). In classic exogenous Ag presentation, invariant chain (Ii)³ binds to newly synthesized class II molecules, preventing the binding of peptides in the endoplasmic reticulum (ER) and directing class II/Ii complexes to endocytic compartments and/or MHC class II compartments (MIICs). In the MIICs, Ii is progressively degraded to MHC class II-associated Ii peptide, which is subsequently displaced by higher affinity peptide with the help of H2-DM (HLA-DM in humans). A third accessory molecule, H2-O (HLA-DO in humans), is also implicated in MHC class II-restricted exogenous Ag presentation. In the absence of H2-DM, H2-O is retained in the ER (2). However, when H2-DM is coexpressed, then H2-O is transported from the ER to the MIIC, where in combination with H2-DM it alters the repertoire of peptides bound to MHC class II molecules (3, 4, 5, 6, 7). Unlike Ii and H2-DM, which are ubiquitously expressed in all professional APC, H2-O is mainly expressed in B lymphocytes and medullary thymic epithelial cells (mTEC) (8, 9). Because B cells present superantigens (SAgs) as well as exogenous Ags, and mTEC present endogenous self Ags during negative selection of T cells in the thymus (10), we have hypothesized that H2-O might play a role in MHC class II-restricted SAgs and self Ag presentation.

We have tested this hypothesis by generating H2-O-transfected cells and using the transfectants as APC for SAgs and self Ags. Because earlier reports showed that H2-O also interacts with Ii (2, 8), we have assessed the effects of H2-O in the presence or absence of Ii. Our results demonstrate that H2-O inhibits SAg presentation, but does not affect endogenous self Ag presentation. We have also examined H2-O effects on exogenous Ag presentation and find that H2-O inhibits presentation of exogenous peptides associated with both newly synthesized and recycling MHC class II molecules. In no case does Ii expression alter the functions of H2-O, suggesting that H2-O is a potent inhibitor of SAg and exogenous Ag presentation via an Ii-independent mechanism.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell lines and transfections

SaI is a MHC class II-negative A/J-derived spindle cell sarcoma (11). SaI/A^k, SaI/A^k/DM, SaI/A^k/Ii, SaI/CIITA (MHC class II transcriptional activator), and their hen egg lysozyme (HEL)-transfected SaI cells (SaI/A^k/DM/HEL and SaI/A^k/Ii/HEL) were previously described. In these transfectants, HEL is tagged with a (KDEL) signal which causes HEL to be retained in the ER (12, 13). H2-O transfectants were generated as described (13) using the pCMU/Oa and pCMU/Ob plasmids encoding the H2-O- and H2-O-chains, respectively. Transfectant nomenclature uses "DM" and "DO" for H2-DM and H2-O, respectively. Cells expressing H2-O were selected in 1.5 µg/ml puromycin (BD Biosciences, San Jose, CA) for SaI/A^k/DM/DO and SaI/A^k/DM/HEL/DO cells, or 400 µg/ml hygromycin (Calbiochem, La Jolla, CA) for SaI/CIITA/DO cells, tested by flow cytometry, and then cloned by limiting dilution.

Reagents

Brefeldin A (BFA), chloroquine, staphylococcal enterotoxins A and B (SEA and SEB), HEL, and RNase were purchased from Sigma (St. Louis, MO). HEL_46–61 peptide (NTDGSTDYGILQINSR) was purified by HPLC. Mouse mAbs 10-2.16 (anti I-A^k) (14), hyHEL7 and hyHEL10 (anti-HEL) (15), rat mAb In-1 (anti-Ii) (16), and rabbit antiserum K553 (anti-H2-DM) (17) were previously described (18). Mouse mAb 9E10 (anti-c-myc) was obtained from the Developmental Studies Hybridoma Bank (University of Iowa, Iowa City, IA, and Johns Hopkins University, Baltimore, MD). Rabbit antiserum K535 against the C-terminal tail of the H2-O-chain was previously described (5).

Flow cytometry

Tumor cells were stained by indirect immunofluorescence either internally or externally, and analyzed on an Epics XL flow cytometer, as previously described (13).

RT-PCR

Total RNA was extracted using a RNeasy Minikit (Qiagen, Valencia, CA), according to the manufacturer’s directions. A total of 100 ng RNA was amplified using a one-step RT-PCR kit (Qiagen) and the following conditions: 50°C x 30 min and 95°C x 15 min, followed by 30 cycles of 95°C x 30 s, 60°C x 30 s, and 72°C x 30 s. H2-Oa 5' primer, CCTTCTACCAATCTTACGACGC, and 3' primer, GTGTGCCTGTGATCATGAGCAC; H2-Ob 5' primer, TGGTCCTAACCGTAATGAGCTTCCTG, and 3' primer, GTTCCACCAAGATGTCCAGATGAGCT.

Cell surface biotinylation

Log-phase cells (>95% viability) were washed twice with cold PBS containing 0.1 mM CaCl₂ and 1 mM MgCl₂, and resuspended at 10⁷/ml in 0.5 mg/ml sulfo-N-hydroxy succinimide-long chain-biotin (Pierce, Rockford, IL) for 30 min at 4°C with gentle shaking. The reaction was stopped by addition of glycine to a final concentration of 10 mM. Biotinylated cells were washed twice with excess PBS and subjected to immunoprecipitation.

Immunoprecipitation

All procedures were conducted at 4°C. A total of 3 x 10⁷ tumor cells/ml or 3 x 10⁸ splenocytes/ml was incubated in lysis buffer (20 mM Tris, pH 8, 150 mM NaCl, 5 mM EDTA, and 1% Nonidet P-40) containing protease-inhibitor cocktails (Roche, Indianapolis, IN) for 40 min, and lysates were microcentrifuged for 30 min to remove nuclei and cellular debris. Resulting supernatants were divided into 100-µl aliquots and were precleared once with 0.2 µl rabbit serum and twice with 50 µl 10% protein G-Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ). Precleared supernatants were incubated with 0.2 µl K535 or 3 µg 9E10 for 1 h, followed by addition of 200 µl 10% protein G-Sepharose for another 1 h. The resulting immunoprecipitates were pelleted by microcentrifugation and washed four times with wash buffer (50 mM Tris, pH 8, 150 mM NaCl, and 0.1% Nonidet P-40).

Endoglycosidase H (endo H) assay

Immunoprecipitated beads were resuspended in 40 µl endo H buffer (20 mM Na₂PO₄, pH 6.5, 0.1% SDS, and 0.02% NaN₃) and boiled for 5 min. After microcentrifugation at room temperature, the supernatants were divided into two aliquots. Recombinant endo H (2 mu; Roche) was added to one aliquot, and both aliquots were incubated overnight at 37°C and then boiled for 5 min to inactivate endo H before analysis by Western blot.

Western blot

Western blot analyses were performed as described (18) using 12% SDS-PAGE. For c-myc or H2-O analysis, incubation with 9E10 (1:500) or K535 (1:3000) was followed by sheep anti-mouse or donkey anti-rabbit HRP (1:10,000; Amersham), respectively. In surface biotinylation assays, biotinylated proteins were visualized with streptavidin-HRP (1:20,000; Pierce). Bands were quantified by densitometry using National Institutes of Health Scion Image software (http://www.scioncorp.com).

SAg-binding analysis

APC at 5 x 10⁵/ml in PBS/2% FCS were incubated with 10 µg/ml biotinylated SEB (Toxin Technology, Sarasota, FL) for 45 min at 37°C and washed four times with PBS before incubation with 30 µl 2.5 µg/ml streptavidin-PE (BD Biosciences) for 20 min at 4°C. Following labeling, the cells were washed at 4°C four times with PBS, and SAg binding was quantified by flow cytometry. Fluorescence intensity = (anti-log of mean channel fluorescence with biotin-SEB + streptavidin-PE) - (anti-log of mean channel fluorescence with streptavidin-PE).

Ag presentation assays

SAg-reactive and Ag-specific CD4⁺ T hybridoma cells used in this study are shown in Table I. Exogenous and endogenous Ag presentation assays were performed as described (13). For SAg presentation assays, 5 x 10⁴ APC were incubated with 5 x 10⁴ T hybridoma cells plus SAg for 18–20 h at 37°C. For exogenous Ag presentation assays with chloroquine or BFA, 1.5 x 10⁵ SaI/A^k/DM or SaI/CIITA cells were incubated at 37°C with chloroquine for 30 min or BFA for 15 min, followed by addition of native HEL, RNase, or HEL_46–61 peptide for an additional 4–5 h. Chloroquine or BFA was present during the incubation with Ag. To ensure adequate T cell responses, different concentrations of Ag were used for different APC and hybridoma cells. SaI/A^k/DM and SaI/CIITA cells were pulsed with HEL at 1 mg/ml for 3A9 and 3B11.1, RNase at 1 mg/ml for TS12, or HEL_46–61 peptides at 100 µg/ml for 3A9. SaI/A^k/DM cells were pulsed with HEL at 8 mg/ml for 2B6.3, 2D4.1, and 1B9. SaI/CIITA cells were pulsed with HEL at 20 mg/ml for 2B6.3. SaI/CIITA/DO.G1 cells were pulsed with HEL at 2 mg/ml for 2B6.3, 3A9, and 3B11.1, or with RNase at 10 mg/ml for TS12. SaI/A^k/DM/DO.7 cells were pulsed with HEL at 10 mg/ml for 2B6.3, 2D4.1, and 1B9, with HEL at 2 mg/ml for 3B11.1 and 3A9, or with RNase at 10 mg/ml for TS12. Following incubation with Ag, the APC were fixed with 0.05% glutaraldehyde for 30 s on ice, quenched in 200 mM glycine, and washed twice with PBS and once with culture medium. A total of 5 x 10⁴ Ag-loaded, fixed APC was then incubated with 7 x 10⁴ T hybridoma cells for 18–20 h at 37°C. Ag-specific and SAg-mediated T cell activation was measured by quantifying the amount of IL-2 in the assay supernatants using an IL-2 ELISA (Pierce), as previously described (12). Values are the average of triplicate cultures ± SD. In experiments using chloroquine or BFA, percentage of response = 100% x ((IL-2 _{with drug})/(IL-2 _{without drug})).

C57BL/6 H2-Oa⁺ (H2-O⁺⁺) and H2-Oa^- (H2-O^-+) mice were previously described (5). A/J mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice were housed and bred in the Biology Department animal facility. Six- to eight-week-old male and female mice were used. Tumor challenges were performed as previously described (12). All animal procedures have been approved by the University of Maryland Baltimore County Institutional Animal Care and Use Committee.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Characterization of H2-O-expressing SaI cells

To study the functions of H2-O in the absence or presence of Ii, SaI/A^k/DM and SaI/CIITA cells were transfected with plasmids encoding H2-O- and H2-O-chains, respectively (SaI/A^k/DM/DO and SaI/CIITA/DO cells). Fig. 1, A and B, shows the flow cytometry profiles of three SaI/A^k/DM/DO clones (clones 4, 5, and 7) and two SaI/CIITA/DO clones (clones A10 and G1), respectively, stained for surface MHC class II (I-A^k) and internal H2-DM, H2-O, and/or Ii. In CIITA-transduced cells, MHC class II, Ii, and H2-DM, but not H2-O, are coordinately up-regulated (26). H2-O expression in all clones was confirmed by Western blot analysis (Fig. 1C) and RT-PCR (data not shown). An H2-O^-+ clone (SaI/CIITA/DO.3) was also obtained, and its phenotype was confirmed by RT-PCR and immunoprecipitation (data not shown).

View larger version (66K): [in this window] [in a new window]   FIGURE 1. Characterization of H2-O-transfected SaI/Ak/DM and SaI/CIITA cells. SaI/Ak/DM/DO (A) and SaI/CIITA/DO (B) cells were stained for surface I-Ak (10-2.16) and internal expression of H2-DM (K553), H2-O (K535), or Ii (In-1). Solid lines represent Ab-specific staining; dotted lines represent staining with fluorescent conjugate without specific Ab. C, Whole cell lysates were boiled before 12% SDS-PAGE, and membranes were probed for H2-O (K535, top) and I-Ak (10-2.16, bottom). Lysates from A/J splenocytes were included as a positive control. D, Endo H sensitivity of H2-O. H2-O immunoprecipitates from H2-O++ transfectants (lanes 1–4), H2-O-+ transfectants (lanes 5 and 6), or H2-O++ splenocytes (lanes 7 and 8) or H2-O-+ splenocytes (lanes 9 and 10) were mock treated (-) or treated with endo H (+) before SDS-PAGE and immunoblotting for H2-O (K535). L, Ig light chain; s, endo H sensitive; r, endo H resistant. E, Expression of H2-O does not reduce the percentage of SDS-stable MHC class II dimers in SaI/Ak/DM/DO and SaI/CIITA/DO cells. Western blots of boiled (B) or nonboiled (NB) cell extracts were probed for I-Ak (10-2.16). C, Compact I-Ak dimers; , free I-Ak chain; Aggr., aggregates; C% = 100% x ((density of C)/(density of (C + + Aggr.))). These data are representative of at least two independent experiments.

Correct MHC class II conformation is critical for effective Ag presentation. One measure of class II conformation is MHC class II/peptide complex stability in 1–2% SDS (27). The role of H2-O in modulating MHC class II SDS stability is controversial (3, 4, 5, 6, 7). To determine the effect of H2-O on I-A^k molecules in the SaI transfectants, boiled and nonboiled cell extracts were Western blotted and probed for I-A^k. As shown in Fig. 1E, the percentage of SDS-stable MHC class II dimers in H2-O⁺ and H2-O^- transfectants is similar (41–53% in SaI/A^k and 75–80% in SaI/CIITA transfectants, respectively). Therefore, H2-O does not significantly alter SDS stability of I-A^k molecules.

H2-O inhibits presentation of bacterial SAg to T cells

SEB activates murine T cells by binding to the V7, V8, or V17 region of the TCR and -chain of the MHC class II of the APC (28). To determine whether H2-O affects SEB presentation, SaI cells with or without H2-O were incubated with two V8⁺ T hybridoma cells (Table I) that release IL-2 in response to SEB presentation. As shown in Fig. 2A, presentation of SEB by the three SaI/A^k/DM/DO clones to T hybridoma cells 3B11.1 and 3A9 is reduced compared with presentation by parental SaI/A^k/DM cells. Similarly, as shown in Fig. 2B, SEB activation of T hybridoma cells 3B11.1, 3A9, and SKK45.10 by the two SaI/CIITA/DO clones is reduced relative to presentation by parental SaI/CIITA cells. To ascertain that the reduced presentation is not due to plasmid vector sequences and requires both the H2-O- and H2-O-chains, SaI/CIITA/DO.3 (H2-O^-+) cells were used as APC for SEB. Hybridoma responses to SEB plus SaI/CIITA/DO.3 or SaI/CIITA cells were equivalent (data not shown).

View larger version (27K): [in this window] [in a new window]   FIGURE 2. H2-O inhibits SEB presentation. SaI/Ak/DM/DO (A) or SaI/CIITA/DO (B) transfectants were incubated with SEB-reactive T hybridoma cells (3B11.1, 3A9, or SKK45.10) in the presence of SEB. These data are representative of three independent experiments.

View larger version (26K): [in this window] [in a new window]   FIGURE 3. H2-O inhibits SEA presentation. SaI/Ak/DM/DO (left) or SaI/CIITA/DO (right) transfectants were incubated with SEA-reactive T hybridoma cells A2.A2 in the presence of SEA. These data are representative of three independent experiments.

H2-O may inhibit SAg presentation by reducing SAg binding to surface class II molecules. To test this hypothesis, SEB binding to H2-O⁺ and H2-O^- transfectants was quantified by flow cytometry using biotinylated SEB. As shown in Fig. 4, SEB binding to MHC class II molecules of SaI/A^k/DM/DO and SaI/CIITA/DO cells is 3- to 10-fold decreased compared with SEB binding to SaI/A^k/DM and SaI/CIITA cells. Therefore, expression of H2-O partially blocks SAg binding to MHC class II molecules, suggesting that H2-O-mediated inhibition of SAg presentation may be the result of decreased SAg binding to surface MHC class II molecules.

View larger version (24K): [in this window] [in a new window]   FIGURE 4. H2-O decreases SEB binding to cell surface MHC class II. SaI transfectants were incubated with biotinylated SEB, followed by streptavidin-PE. The data are representative of two independent experiments.

MHC class II molecules also present endogenous self Ags (29). We have exploited this phenomenon and used SaI/A^k sarcoma cells as cancer vaccines (30). The vaccines were originally designed to directly present endogenous tumor Ags to host CD4⁺ T cells. In vitro Ag presentation (12, 13) and in vivo immunization (18, 31) experiments support the hypothesis that the class II-transfected tumor cells with or without coexpression of H2-DM are APC for tumor-encoded self Ags. If H2-O inhibits presentation of self Ags, then H2-O-transfected SaI/A^k/DM cells might regain their malignant phenotype and cause tumors in syngeneic, immunocompetent mice. To test this hypothesis, syngeneic A/J mice were inoculated i.p. with SaI/A^k/DM/DO transfectants. H2-O^- SaI/A^k and SaI/A^k/DM, and MHC class II^- SaI cells served as controls. As shown in Table II, the three SaI/A^k/DM/DO clones are rejected, as are SaI/A^k and SaI/A^k/DM tumor cells, while SaI cells are malignant in 100% of mice. Therefore, H2-O does not inhibit presentation of endogenous tumor Ags, as measured by tumor rejection.

Although the tumor rejection experiments suggest that H2-O does not alter presentation of self Ags, H2-O may exert subtle effects that are not detected by this assay. Therefore, we have generated SaI/A^k/DM/DO and SaI/A^k/DM cells expressing KDEL-tagged HEL as a self Ag (SaI/A^k/DM/HEL/DO and SaI/A^k/DM/HEL cells) and tested them as APC to a panel of HEL-specific, I-A^k-restricted T hybridoma cells (Table I). Previous studies demonstrated that the HEL proteins in these transfectants are retained in the ER and are not secreted or present at the cell surface (18). Fig. 5A shows the flow cytometry profiles of three SaI/A^k/DM/HEL/DO clones (clones 3, 17, and 22) stained for surface I-A^k, and for internal H2-DM, H2-O, and HEL. RT-PCR and Western blot analyses confirmed expression of H2-O by the transfectants (data not shown). Fig. 5B shows the results of Ag presentation assays in which the three SaI/A^k/DM/HEL/DO clones, along with SaI/A^k/DM/HEL cells, were tested as APC for HEL epitopes 25–43, 34–45, and 46–61. SaI/A^k/Ii/HEL cells are included as a negative control because Ii blocks presentation of self Ags (12, 18). In all cases, the SaI/A^k/DM/HEL/DO clones are comparable with SaI/A^k/DM/HEL cells in presenting three HEL epitopes, confirming that H2-O expression does not alter presentation of endogenous self Ags.

View larger version (16K): [in this window] [in a new window]   FIGURE 5. H2-O does not affect self Ag presentation. A, SaI/Ak/DM/HEL/DO clones 3, 17, and 22 and SaI/Ak/DM/HEL cells were stained for cell surface expression of I-Ak and internal expression of H2-DM, H2-O, or HEL (hyHEL 7 and 10), as described in Fig. 1. B, HEL-transfected clones were incubated with HEL-specific I-Ak-restricted T hybridoma cells (2B6.3, 3B11.1, or 3A9). These data are representative of three independent experiments.

The effect of H2-O on presentation of exogenous Ags has been previously tested, and the results are controversial. In some studies, H2-O expression inhibits exogenous Ag presentation (5, 7), while in other studies H2-O enhances presentation (5, 6). Using five HEL-specific and one RNase-specific, I-A^k-restricted T hybridomas (Table I), we have tested H2-O transfectants as APC for exogenous HEL and RNase, respectively. As shown in Fig. 6, three SaI/A^k/DM/DO clones (Fig. 6A) and two SaI/CIITA/DO clones (Fig. 6B) are inhibited for presentation of all tested HEL and RNase epitopes relative to parental SaI/A^k/DM and SaI/CIITA cells. The inhibition is not due to dysfunctional MHC class II molecules because H2-O⁺ clones efficiently present exogenously pulsed peptides (data not shown). Therefore, H2-O consistently inhibits presentation of exogenous Ags by both Ii⁺ and Ii^- APC.

View larger version (35K): [in this window] [in a new window]   FIGURE 6. H2-O inhibits presentation of exogenous Ags. H2-O+ or H2-O- SaI/Ak/DM (A) or SaI/CIITA (B) cells were incubated with HEL-specific or RNase-specific, I-Ak-restricted T hybridoma cells (3B6.3, 3B11.1, 3A9, 2D4.1, 1B9, or TS12) in the presence of exogenous native HEL or RNase, respectively. These data are representative of at least three independent experiments with each hybridoma.

View larger version (30K): [in this window] [in a new window]   FIGURE 7. Epitopes derived from exogenous Ags are presented by newly synthesized or recycling MHC class II molecules. SaI/CIITA, SaI/Ak/DM, SaI/CIITA/DO.G1, or SaI/Ak/DM/DO.7 cells were treated with BFA (A) or chloroquine (B) before addition of native HEL, RNase, or HEL46–61 peptide for 4–5 h. APC were then fixed and incubated with specific T hybridoma cells. Responses (IL-2, pg/ml) in the absence of chloroquine or BFA were: SaI/CIITA, 1675 pg/ml (2B6.3), 2423 pg/ml (3B11.1), 2484 pg/ml (3A9), 890 pg/ml (TS12), and 2597 pg/ml (3A9 + HEL46–61); SaI/Ak/DM, 692 pg/ml (2B6.3), 5152 pg/ml (3B11.1), 4132 pg/ml (3A9), 870 pg/ml (2D4.1), 794 pg/ml (1B9), 2014 pg/ml (TS12), and 5810 pg/ml (3A9 + HEL46–61); SaI/CIITA/DO.G1, 1032 pg/ml (2B6.3), 1457 pg/ml (3B11.1), 730 pg/ml (3A9), and 155 pg/ml (TS12); SaI/Ak/DM/DO.7, 237 pg/ml (2B6.3), 2314 pg/ml (3B11.1), 363 pg/ml (3A9), 212 pg/ml (2D4.1), 337 pg/ml (1B9), and 435 pg/ml (TS12). The legend in part A also refers to part B. C, H2-O is expressed at the cell surface. Surface proteins of SaI/Ak/DM (lane 1) and SaI/Ak/DM/DO.5 (lane 2) cells were biotinylated, followed by immunoprecipitation of H2-O (K535) or c-myc (9E10) and SDS-PAGE. Western blots were probed with streptavidin (SA)-HRP or 9E10 (anti-c-myc). IP, Immunoprecipitation; *, a nonspecific band. These data are representative of at least two independent experiments.

Previous studies have established that the majority of H2-O is localized to the MIICs by tightly associating with H2-DM (2). However, H2-O may affect Ag presentation by its expression at the cell surface. To determine whether H2-O is expressed on the outer face of the plasma membrane, surface proteins of SaI/A^k/DM and SaI/A^k/DM/DO cells were biotinylated, and Western blots of H2-O immunoprecipitates were probed with streptavidin-HRP. As shown in Fig. 7C, H2-O is detected by streptavidin-HRP, and hence is present at the exterior face of the plasma membrane (left panel). To demonstrate that the biotinylation procedure exclusively labels cell surface proteins, c-myc, a cytosolic and nuclear Ag, was immunoprecipitated from biotinylated cells. As shown in Fig. 7C, c-myc is only detected by blotting with c-myc Ab (right panel) and not with streptavidin-HRP (middle panel). Therefore, H2-O is present in the MIICs and at the cell surface.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Expression of H2-O in MHC class II⁺ tumor cells dramatically inhibits the presentation of the SAgs SEB and SEA. Recent experiments with splenic B lymphocytes from wild-type and H2-O knockout mice confirm the inhibitory effect of H2-O expression on SEB presentation (V. Clements, L. Qi, and S. Ostrand-Rosenberg, unpublished results). Although the inhibition could be the result of several factors, the observation that H2-O⁺ cells bind less SEB than H2-O^- cells suggests that the inhibition may be due to reduced cell surface SAg/MHC class II complexes. There are several possible mechanisms for the decrease in SAg binding to MHC class II: 1) Peptide binding alters MHC class II conformation (27). Because H2-O alters the repertoire of exogenous peptides by interacting with H2-DM in the MIICs, it may modify the conformation of MHC class II molecules via an H2-DM-dependent mechanism and thereby reduce SAg binding. 2) SAg binding may be sterically blocked by long peptides bound in the peptide groove of class II molecules (37). If H2-O preferentially mediates binding of longer peptides, then steric interference from longer peptides could alter SAg binding to MHC class II molecules. The data of van Ham et al. (7) do not favor this hypothesis. 3) H2-O may bind to MHC class II molecules at the cell surface. We and others have shown there is H2-O at the plasma membrane (Fig. 7C) (8), although it remains unclear whether surface H2-O interacts with H2-DM or MHC class II molecules. Recently, Arndt et al. (38) reported that 10–15% of total HLA-DM is functional at the cell surface, binding to MHC class II molecules. Therefore, surface class II/H2-DM/H2-O complexes may exist, which alter the conformation of MHC class II or directly compete for SAg binding sites, and thereby lead to a reduction in SAg binding. 4) Recent studies have shown that in the MIICs, HLA-DO may directly interact with MHC class II and other tetraspan proteins, such as CD82 and CD63, independent of HLA-DM binding (39). Therefore, H2-O may affect SAg presentation by its interaction with proteins other than H2-DM and via as yet uncharacterized mechanisms.

Regardless of the mechanism by which H2-O reduces SAg-induced T cell activation, the dramatic reduction suggests that H2-O may play a role in vivo in presentation of SAgs. Bacterial SAgs are immunostimulatory proteins that cause significant diseases in humans, ranging from toxic shock syndrome to autoimmune pathologies (28). These diseases occur when MHC class II⁺ host APC bind and present SAgs to host T cells. Although B cells present SAgs (40), they are less efficient presenters of SAg than H2-O^- APC, such as dendritic cells (DC) and macrophages (41). The discrepancy in SAg presentation between B cells, macrophages, and DC was originally attributed to differences in levels of expression of costimulatory and/or MHC class II molecules (41). However, given the inhibitory effects of H2-O on SAg presentation, it is also possible that DC and macrophages are better SAg presenters because they lack H2-O.

H2-O appears to selectively affect Ag presentation based on the origin of the Ag. That is, presentation of exogenous Ags such as soluble HEL and RNase, is inhibited, whereas presentation of endogenous self Ags, such as self HEL and tumor Ags, is not affected. This dichotomy may reflect differences in where exogenous vs endogenous peptides are loaded onto MHC class II molecules. Recent studies suggest that the binding of endogenous self peptides to MHC class II occurs in the endocytic pathway, as does binding of exogenous peptides (13, 42). However, binding of endogenous vs exogenous peptides may occur in different compartments of MIICs (13, 18), and different pHs in these compartments may account for differential effects of H2-O (5, 7).

H2-O expression in mTEC may also play a role in T cell selection in the thymus. mTEC together with bone marrow-derived APC (DC) are major APC for negative selection of developing T lymphocytes in the thymus (10). mTEC are H2-O⁺, while DC are H2-O^- (8, 9). If H2-O functions in mTEC as it does in the SaI transfectants, then mTEC may be inhibited for presentation of exogenous Ags, but not endogenous self Ags. Therefore, mTEC may preferentially delete autoreactive T cells specific for endogenous self Ags, but not T cells reactive to exogenous self Ags. In contrast, because DC are H2-O^-, they may preferentially delete T cells reactive to exogenous self Ags presented by cross-presentation. The combination of H2-O⁺ (mTEC) and H2-O^- (DC) APC may complement each other and delete autoreactive T cells specific for both endogenous and exogenous Ags, and thereby minimize overall autoreactivity. The expression of H2-O in mTEC and its absence in DC may also explain the observation that unlike DC, mTEC do not induce full tolerance (43).

Note added in proof.

A recent study (44) demonstrated that HLA-DR3 conformation could be altered by HLA-DM in a peptide-independent manner. Therefore, H2-O may reduce SAg presentation in a peptide-independent fashion by either binding directly to class II or by interacting with H2-DM.

	Acknowledgments

 
We are grateful to Drs. L. Karlsson for pCMU/Oa and pCMU/Ob plasmids, H2-DM and H2-O antisera, H2-Oa⁺ and H2-Oa^- mice; R. Germain for the 2B6.3, 3B11.1, 1B9, and 2D4.1 hybridomas; P. Marrack for the SKK45.10 hybridoma; and L. Glimcher for the A2.A2 hybridoma. We very much appreciate Drs. L. Karlsson, J. Yewdell, and S. Sadegh-Nasseri for informative discussions, V. Clements for her excellent technical assistance, and S. Mason for care of the mice.

	Footnotes

 
¹ These studies were supported by National Institutes of Health Grants R01CA52527 and R01CA84232.

² Address correspondence and reprint requests to Dr. Suzanne Ostrand-Rosenberg, Department of Biological Sciences, University of Maryland, 1000 Hilltop Circle, Baltimore, MD 21250. E-mail address: srosenbe{at}umbc.edu

³ Abbreviations used in this paper: Ii, invariant chain; BFA, brefeldin A; CIITA, MHC class II transcriptional activator; DC, dendritic cells; endo H, endoglycosidase H; ER, endoplasmic reticulum; HEL, hen egg lysozyme; MIIC, MHC class II compartment; mTEC, medullary thymic epithelial cells; SAg, superantigen; SEA, staphylococcal enterotoxin A; SEB, staphylococcal enterotoxin B.

Received for publication January 9, 2001. Accepted for publication June 1, 2001.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Busch, R., R. Doebele, N. Patil, A. Pashine, E. Mellins. 2000. Accessory molecules for MHC class II peptide loading. Curr. Opin. Immunol. 12:99.[Medline]
2. Liljedahl, M., T. Kuwana, W. P. Fung-Leung, M. R. Jackson, P. A. Peterson, L. Karlsson. 1996. HLA-DO is a lysosomal resident which requires association with HLA-DM for efficient intracellular transport. EMBO J. 15:4817.[Medline]
3. Denzin, L., D. Sant’Angelo, C. Hammond, M. Surman, P. Cresswell. 1997. Negative regulation by HLA-DO of MHC class II-restricted antigen processing. Science 278:106.[Abstract/Free Full Text]
4. Van Ham, S., E. Tjin, B. Lillemeier, U. Gruneberg, K. van Meijgaarden, L. Pastoors, D. Verwoerd, A. Tulp, B. Canas, D. Rahman, et al 1997. HLA-DO is a negative modulator of HLA-DM-mediated MHC class II peptide loading. Curr. Biol. 7:950.[Medline]
5. Liljedahl, M., O. Winqvist, C. D. Surh, P. Wong, K. Ngo, L. Teyton, P. A. Peterson, A. Brunmark, A. Y. Rudensky, W. P. Fung-Leung, L. Karlsson. 1998. Altered antigen presentation in mice lacking H2-O. Immunity 8:233.[Medline]
6. Kropshofer, H., A. B. Vogt, C. Thery, E. A. Armandola, B. C. Li, G. Moldenhauer, S. Amigorena, G. J. Hammerling. 1998. A role for HLA-DO as a co-chaperone of HLA-DM in peptide loading of MHC class II molecules. EMBO J. 17:2971.[Medline]
7. Van Ham, M., M. van Lith, B. Lillemeier, E. Tjin, U. Gruneberg, D. Rahman, L. Pastoors, K. van Meijgaarden, C. Roucard, J. Trowsdale, et al 2000. Modulation of the major histocompatibility complex class II-associated peptide repertoire by human histocompatibility leukocyte antigen (HLA)-DO. J. Exp. Med. 191:1127.[Abstract/Free Full Text]
8. Karlsson, L., C. D. Surh, J. Sprent, P. A. Peterson. 1991. A novel class II MHC molecule with unusual tissue distribution. Nature 351:485.[Medline]
9. Surh, C. D., E. K. Gao, H. Kosaka, D. Lo, C. Ahn, D. B. Murphy, L. Karlsson, P. Peterson, J. Sprent. 1992. Two subsets of epithelial cells in the thymic medulla. J. Exp. Med. 176:495.[Abstract/Free Full Text]
10. Klein, L., B. Kyewski. 2000. Self-antigen presentation by thymic stromal cells: a subtle division of labor. Curr. Opin. Immunol. 12:179.[Medline]
11. Ostrand-Rosenberg, S., A. Thakur, V. Clements. 1990. Rejection of mouse sarcoma cells after transfection of MHC class II genes. J. Immunol. 144:4068.[Abstract]
12. Armstrong, T., V. Clements, B. Martin, J. P. Y. Ting, S. Ostrand-Rosenberg. 1997. Major histocompatibility complex class II-transfected tumor cells present endogenous antigen and are potent inducers of tumor-specific immunity. Proc. Natl. Acad. Sci. USA 94:6886.[Abstract/Free Full Text]
13. Qi, L., S. Ostrand-Rosenberg. 2000. MHC class II presentation of endogenous tumor antigen by cellular vaccines depends on the endocytic pathway but not H-2M. Traffic 1:152.[Medline]
14. Oi, V., P. Jones, J. Goding, L. Herzenberg, L. Herzenberg. 1978. Properties of monoclonal antibodies to mouse Ig allotypes, H-2, and Ia antigens. Curr. Top. Microbiol. Immunol. 81:115.[Medline]
15. Smith-Gill, S., T. Lavoie, C. Mainhart. 1984. Antigenic regions defined by monoclonal antibodies correspond to structural domains of avian lysozyme. J. Immunol. 133:384.[Abstract]
16. Koch, N., A. Harris. 1984. Differential expression of the invariant chain in mouse tumor cells: relationship to B lymphoid development. J. Immunol. 132:12.[Abstract]
17. Karlsson, L., A. Peleraux, R. Lindstedt, M. Liljedahl, P. A. Peterson. 1994. Reconstitution of an operational MHC class II compartment in non antigen-presenting cells. Science 266:1569.[Abstract/Free Full Text]
18. Qi, L., J. M. Rojas, S. Ostrand-Rosenberg. 2000. Tumor cells present MHC class II-restricted nuclear and mitochondrial antigens and are the predominant antigen presenting cells in vivo. J. Immunol. 165:5451.[Abstract/Free Full Text]
19. Adorini, L., J. Guery, S. Fuchs, V. Ortiz-Navarrete, G. Hammerling, F. Momburg. 1993. Processing of endogenously synthesized hen egg-white lysozyme retained in the endoplasmic reticulum or in secretory form gives rise to a similar but not identical set of epitopes recognized by class II-restricted T cells. J. Immunol. 151:3576.[Abstract]
20. Allen, P. M., E. R. Unanue. 1984. Differential requirements for antigen processing by macrophages for lysozyme-specific T cell hybridomas. J. Immunol. 132:1077.[Medline]
21. Haskins, K., C. Hannum, J. White, N. Roehm, R. Kubo, J. Kappler, P. Marrack. 1984. The antigen-specific, major histocompatibility complex-restricted receptor on T cells. VI. An antibody to a receptor allotype. J. Exp. Med. 160:452.[Abstract/Free Full Text]
22. Johnson, N., A. Cavland, P. Allen, L. Glimcher. 1989. T cell receptor gene segment usage in a panel of hen-egg white lysozyme specific I-A^k-restricted T helper hybridomas. J. Immunol. 142:3298.[Abstract]
23. Adorini, L., J. Moreno, F. Momburg, G. J. Hammerling, J. C. Guery, A. Valli, S. Fuchs. 1991. Exogenous peptides compete for the presentation of endogenous antigens to major histocompatibility complex class II-restricted T cells. J. Exp. Med. 174:945.[Abstract/Free Full Text]
24. Guery, J. C., A. Sette, J. Leighton, A. Dragomir, L. Adorini. 1992. Selective immunosuppression by administration of major histocompatibility complex (MHC) class II-binding peptides. I. Evidence for in vivo MHC blockade preventing T cell activation. J. Exp. Med. 175:1345.[Abstract/Free Full Text]
25. Lorenz, R., A. Tyler, P. Allen. 1988. T cell recognition of bovine ribonuclease: self/non-self discrimination at the level of binding to the I-A^k molecule. J. Immunol. 141:4124.[Abstract]
26. Chang, C. H., S. Guerder, S. C. Hong, W. van Ewijk, R. A. Flavell. 1996. Mice lacking the MHC class II transactivator (CIITA) show tissue-specific impairment of MHC class II expression. Immunity 4:167.[Medline]
27. Sadegh-Nasseri, S., R. N. Germain. 1991. A role for peptide in determining MHC class II structure. Nature 353:167.[Medline]
28. Lavoie, P. M., J. Thibodeau, F. Erard, R. P. Sekaly. 1999. Understanding the mechanism of action of bacterial superantigens from a decade of research. Immunol. Rev. 168:257.[Medline]
29. Sant, A. J.. 1994. Endogenous antigen presentation by MHC class II molecules. Immunol. Res. 13:253.[Medline]
30. Baskar, S., L. Glimcher, N. Nabavi, R. T. Jones, S. Ostrand-Rosenberg. 1995. Major histocompatibility complex class II⁺B7-1⁺ tumor cells are potent vaccines for stimulating tumor rejection in tumor-bearing mice. J. Exp. Med. 181:619.[Abstract/Free Full Text]
31. Armstrong, T., V. Clements, S. Ostrand-Rosenberg. 1998. MHC class II-transfected tumor cells directly present antigen to tumor-specific CD4⁺ T lymphocytes. J. Immunol. 160:661.[Abstract/Free Full Text]
32. Pinet, V., M. Vergelli, R. Martin, O. Bakke, E. O. Long. 1995. Antigen presentation mediated by recycling of surface HLA-DR molecules. Nature 375:603.[Medline]
33. Zhong, G., P. Romagnoli, R. N. Germain. 1997. Related leucine-based cytoplasmic targeting signals in invariant chain and major histocompatibility complex class II molecules control endocytic presentation of distinct determinants in a single protein. J. Exp. Med. 185:429.[Abstract/Free Full Text]
34. Griffin, J. P., R. Chu, C. V. Harding. 1997. Early endosomes and a late endocytic compartment generate different peptide-class II MHC complexes via distinct processing mechanisms. J. Immunol. 158:1523.[Abstract]
35. Nowell, J., V. Quaranta. 1985. Chloroquine affects biosynthesis of Ia molecules by inhibiting dissociation of invariant () chains from - dimers in B cells. J. Exp. Med. 162:1371.[Abstract/Free Full Text]
36. Adorini, L., S. Ullrich, E. Appella, S. Fuchs. 1990. Inhibition by brefeldin A of presentation of exogenous protein antigens to MHC class II-restricted T cells. Nature 346:63.[Medline]
37. Woodland, D. L., R. Wen, M. A. Blackman. 1997. Why do superantigens care about peptides?. Immunol. Today 18:18.[Medline]
38. Arndt, S. O., A. B. Vogt, S. Markovic-Plese, R. Martin, G. Moldenhauer, A. Wolpl, Y. Sun, D. Schadendorf, G. J. Hammerling, H. Kropshofer. 2000. Functional HLA-DM on the surface of B cells and immature dendritic cells. EMBO J. 19:1241.[Medline]
39. Hammond, C., L. K. Denzin, M. Pan, J. M. Griffith, H. J. Geuze, P. Cresswell. 1998. The tetraspan protein CD82 is a resident of MHC class II compartments where it associates with HLA-DR, -DM, and -DO molecules. J. Immunol. 161:3282.[Abstract/Free Full Text]
40. Kappler, J. W., A. Herman, J. Clements, P. Marrack. 1992. Mutations defining functional regions of the superantigen staphylococcal enterotoxin B. J. Exp. Med. 175:387.[Abstract/Free Full Text]
41. Bhardwaj, N., J. W. Young, A. J. Nisanian, J. Baggers, R. M. Steinman. 1993. Small amounts of superantigen, when presented on dendritic cells, are sufficient to initiate T cell responses. J. Exp. Med. 178:633.[Abstract/Free Full Text]
42. Lich, J. D., J. F. Elliott, J. S. Blum. 2000. Cytoplasmic processing is a prerequisite for presentation of an endogenous antigen by major histocompatibility complex class II proteins. J. Exp. Med. 191:1513.[Abstract/Free Full Text]
43. Sprent, J., S. R. Webb. 1987. Function and specificity of T cell subsets in the mouse. Adv. Immunol. 41:39.[Medline]
44. Verreck, F. A., C. A. Fargeas, G. J. Hammerling. 2001. Conformational alterations during biosynthesis of HLA-DR3 molecules controlled by invariant chain and HLA-DM. Eur. J. Immunol. 31:1029.[Medline]

This article has been cited by other articles:

				J. L. Fallas, W. Yi, N. A. Draghi, H. M. O'Rourke, and L. K. Denzin Expression Patterns of H2-O in Mouse B Cells and Dendritic Cells Correlate with Cell Function J. Immunol., February 1, 2007; 178(3): 1488 - 1497. [Abstract] [Full Text] [PDF]

				P. Sinha, V. K. Clements, and S. Ostrand-Rosenberg Interleukin-13-regulated M2 Macrophages in Combination with Myeloid Suppressor Cells Block Immune Surveillance against Metastasis Cancer Res., December 15, 2005; 65(24): 11743 - 11751. [Abstract] [Full Text] [PDF]

				A. Bellemare-Pelletier, J. Tremblay, S. Beaulieu, M.-R. Boulassel, J.-P. Routy, B. Massie, R. Lapointe, and J. Thibodeau HLA-DO transduced in human monocyte-derived dendritic cells modulates MHC class II antigen processing J. Leukoc. Biol., July 1, 2005; 78(1): 95 - 105. [Abstract] [Full Text] [PDF]

				S. K. Dissanayake, N. Tuera, and S. Ostrand-Rosenberg Presentation of Endogenously Synthesized MHC Class II-Restricted Epitopes by MHC Class II Cancer Vaccines Is Independent of Transporter Associated with Ag Processing and the Proteasome J. Immunol., February 15, 2005; 174(4): 1811 - 1819. [Abstract] [Full Text] [PDF]

				J. L. Fallas, H. M. Tobin, O. Lou, D. Guo, D. B. Sant'Angelo, and L. K. Denzin Ectopic Expression of HLA-DO in Mouse Dendritic Cells Diminishes MHC Class II Antigen Presentation J. Immunol., August 1, 2004; 173(3): 1549 - 1560. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Qi, L. Articles by Ostrand-Rosenberg, S. Search for Related Content PubMed PubMed Citation Articles by Qi, L. Articles by Ostrand-Rosenberg, S.