| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Production in T Cells by Signal Transduced Through TNF-Related Apoptosis-Inducing Ligand1
*
Graduate Institute of Immunology, College of Medicine, National Taiwan University, Taipei, Taiwan, Republic of China;
Department of Microbiology and Immunology, National Yang-Ming University, Taipei, Taiwan, Republic of China; and
Department of Internal Medicine, Veterans General Hospital-Kaohsiung, Kaohsiung, Taiwan, Republic of China
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production in conjunction with
immobilized suboptimal anti-CD3 stimulation in mouse splenocytes.
The increase of T cell proliferation by death receptor 4-Fc was dose
dependent, and this effect could be blocked by soluble rTRAIL proteins,
indicating the occurrence of reverse signaling through TRAIL on T cell.
The enhanced secretion of IFN- mediated via TRAIL could be blocked
by SB203580, a p38 mitogen-activated protein kinase-specific inhibitor.
Thus, in addition to its role in inducing apoptosis by binding to the
death receptors, TRAIL itself can enhance T cell proliferation after
TCR engagement and signal the augmentation of IFN- secretion via a
p38-dependent pathway. This provides another example of reverse
signaling by a member of TNF superfamily. In conclusion, our data
suggest that TRAIL can itself transduce a reverse signal, and this may
shed light on the biological function of TRAIL. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TRAIL exists mainly in membrane-bound form, and its expression on T
cells is induced after T cell activation by anti-CD3 or type I IFN
(14). TRAIL and members of this ligand superfamily
primarily interact with their receptors by direct cell-cell contact
(15). This observation, coupled with the cross-species
sequence conservation of the cytoplasmic domains of these ligands, has
led to the suggestion that signaling occurs in both directions for this
family of ligand-receptor pairs (15). Recently, there is
growing evidence that ligands of the TNF superfamily, such as CD40L
(CD154) (16, 17, 18), CD30L (19), CD27L (CD70)
(20), FasL (21, 22), CD137L
(23), OX40L (24), and TNF-related
activation-induced cytokine (TRANCE) (25), also transduce
signals after engagement with their receptors. It has been shown that
reverse signaling via CD40L is involved in a range of different immune
processes, such as cytokine production, costimulation of T cell
activation, and proper formation of germinal centers (17).
Blair et al. (18) also demonstrated that CD40L could
trigger short-term CD4 T cell activation as well as mediating the
secretion of immunomodulatory cytokines and apoptosis. Cross-linking of
OX40L on CD40L-stimulated B cells results in a significantly enhanced
proliferative response of B cells and the down-regulation of the
transcription factor B cell lineage-specific activator protein
(24). In addition, cross-linking of CD30L by a mAb or by
CD30-Fc fusion protein induced the production of IL-8 by freshly
isolated neutrophils (19). Recently, it has been further
demonstrated that maximal proliferation of CTL requires reverse
signaling through FasL (21, 22). Moreover, reverse
signaling via CD27L/CD70 has been shown to induce a subset of leukemic
B cells to proliferate vigorously, an effect that is synergistically
enhanced by ligation of CD40, but inhibited by the presence of IL-4
(20). Meanwhile, addition of CD137-Fc fusion protein
induces a substantial degree of proliferation in human peripheral
monocytes (23). In a recent report, Chen further
demonstrated that TRANCE enhanced IFN- secretion in activated Th1
cells (25). These studies provide evidence to demonstrate
the importance of reverse signaling in activation of the immune system.
It is interesting to know whether bidirectional signaling might also
occur in other members of TNFR superfamily. Therefore, we investigated
the possible signal transduction via TRAIL after engagement with its
receptor on T cells.
In this study, we report that cross-linking of TRAIL by plate-bound
DR4-Fc fusion protein enhanced T cell proliferation and increased
IFN- production in conjunction with immobilized suboptimal
anti-CD3 stimulation in activated T cells in a dose-dependent
manner. The effect of increased IFN- production could be blocked by
SB203580, a p38 mitogen-activated protein kinase (MAPK)-specific
inhibitor. Thus, it appears that reverse signaling is also occurring
following the interaction of TRAIL and DR4. This provides yet another
example of reverse signaling by a member of TNF superfamily.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To generate soluble rDR4-Fc fusion molecule, the coding sequence for the extracellular domain of human DR4 was isolated by RT-PCR using the forward primer, CGGATTTCATGGCGCCACCACCA, and the reverse primer, GAAGATCTATTATGTCCATTGCC. The amplified product was ligated in-frame into BamHI-cut pUC19-IgG1-Fc vector containing the human IgG1 Fc coding sequence. The fusion gene was then subcloned into pBacPAK9 vector (Clontech, Palo Alto, CA). DR4-Fc fusion protein was recovered from the filtered supernatants of the recombinant virus-infected Sf21 cells using protein G-Sepharose beads (Pharmacia, Piscataway, NJ). The bound DR4-Fc protein was eluted with glycine buffer (pH 3) and dialyzed into PBS.
The extracellular portion of the TRAIL molecule was subcloned into pRSET(B) His vector (Invitrogen, Groningen, The Netherlands) and expressed in Escherichia coli. The purification of rHis-TRAIL fusion protein was performed by metal chelate column chromatography using Ni-NTA resin, according to the manufacturer’s recommendations (Qiagen, Hilden, Germany).
Immunoblotting
For immunoblotting, proteins were boiled for 5 min in SDS sampling buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 0.2% bromophenol blue, 20% glycerol), separated by 12% SDS-PAGE, and transferred to nitrocellulose membrane. The membrane was blocked with 5% milk in TBS (10 mM Tris-HCl, pH 7.6, 150 mM NaCl), washed with TBST (10 mM Tris-HCl, pH 7.4, 0.9% NaCl, 0.2% Tween 20), and incubated with the indicated Ab for 2 h at room temperature. The mouse anti-human IgG1 Fc (Chemicon, Temecula, CA) was used as first Ab. Bound Ab was revealed with HRP-conjugated anti-mouse IgG (Pharmacia) using ECL (Amersham, Arlington Heights, IL).
In vitro binding assay
For the in vitro binding assay, 10 µg soluble rTRAIL with or without DR4-Fc was incubated for 1 h with agitation at 4°C. Protein A-Sepharose beads (30 µl; Pharmacia, Piscataway, NJ), swollen and washed, were added and incubated for 4 h with agitation at 4°C. The beads were washed five times in cold buffer (50 mM HEPES, pH 7, 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40), and proteins were eluted by boiling for 5 min in SDS sampling buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 0.2% bromophenol blue, 20% glycerol), separated by 12% SDS-PAGE. The gel was then stained with Coomassie blue staining buffer (0.25% Coomassie blue, 25% methanol, 10% acetic acid).
Mouse T cell isolation
The BALB/c mice were maintained in the animal center at the National Taiwan University Medical Center and were used between 8 and 12 wk of age. All experiments were performed in accordance with our institutional guidelines.
Mice were sacrificed by cervical dislocation, and total splenocytes were isolated and treated with RBC lysis solution (Sigma, St. Louis, MO), and resuspended in RPMI 1640 medium supplemented with 10% heat-inactivated FCS. Adherent cells were removed by incubation with nylon wool, and the enriched T cells were isolated by passing through a nylon wool column. The purity of T cells isolated was near 90% after checking with anti-CD3 staining in flow cytometry.
T cell proliferation assay
For assaying T cell proliferation with DR4 costimulation, isolated T cells (2 x 105 cells/well) were cultured for 72 h in 96-well flat-bottom microtiter plates precoated with anti-murine CD3 (500 ng/ml, 2C11 clone) and DR4-Fc recombinant protein (10 µg/ml). The cultures were pulsed with [3H]thymidine (1 µCi/well) 18 h before harvesting the cells, and [3H]thymidine incorporation was measured in a Microbeta Plus liquid scintillation counter (Wallac, Gaithersburg, MD). Cultures were run in triplicate, and each experiment was repeated at least three times.
Cytokine assays
To trigger the activation of T cells via TRAIL, purified T cells
(2 x 105 cells/well) were stimulated with
suboptimal concentration of plate-bound anti-CD3 mAb (500 ng/ml,
2C11) and DR4-Fc fusion protein (10 µg/ml) or human IgG1 (10 µg/ml;
Sigma) for 72 h in 96-well flat-bottom microtiter plates in the
presence or absence of p38 MAPK inhibitor, SB203580. Cell culture
supernatants were collected, and levels of IFN- and IL-4 were
quantified using commercial ELISA kits (Endogen, Woburn, MA), according
to the vendor’s instructions. For some experiments, after stimulation
with plate-bound anti-CD3 and DR4-Fc or human IgG1 for 72 h,
the cells were rested on noncoated plate for 24 h, and the T cells
were then restimulated with plate-bound anti-CD3 mAb (500 ng/ml,
2C11), in conjunction with immobilized DR4-Fc fusion protein (10
µg/ml) or human IgG1 (10 µg/ml; Sigma). Supernatants were separated
from cells by centrifugation, and cytokine content was determined by
ELISA.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To study the expression of TRAIL on T cells, we constructed a
soluble fusion protein containing the extracellular domain of human DR4
and the Fc domain of human IgG1 and a soluble recombinant protein of
TRAIL containing the extracellular domain of human TRAIL. The rDR4-Fc
fusion protein was recovered from the filtered supernatants of the
recombinant baculovirus virus-infected Sf21 cells using protein
G-Sepharose beads. The cultured supernatant of recombinant baculovirus
was purified via the protein G column, and analyzed in SDS-PAGE
electrophoresis. As shown in Fig. 1
A, the purified rDR4-Fc
protein was demonstrated by immunoblotting using anti-human IgG1Fc
as the primary Ab. To determine that the rDR4-Fc protein is able to
interact with TRAIL, an in vitro binding assay was used to demonstrate
the binding between DR4-Fc and TRAIL. The results of the in vitro
binding of TRAIL to DR4-Fc were shown in Fig. 1B. The
soluble DR4-Fc protein was incubated with or without soluble rTRAIL,
and was then subjected for immunoprecipitation with protein A-Sepharose
beads. rTRAIL was coimmunoprecipitated with DR4-Fc, as shown in Fig. 1B, indicating that the purified DR4-Fc could bind to rTRAIL
protein in vitro. We also tested the apoptosis-inducing ability of
rTRAIL on an in vitro apoptosis system. As shown in Fig. 1C,
the rTRAIL protein induced apoptosis in TRAIL-susceptible target cells,
Jurkat cells (6) in a dose-dependent manner (Fig. 1C). Moreover, the apoptosis induced in Jurkat cells by
rTRAIL could be specifically blocked by DR4-Fc fusion protein (Fig. 1C), indicating that both recombinant TRAIL and DR4-Fc
fusion protein are with function.
|
D demonstrated that rDR4-Fc fusion proteins bound to
surface of activated mouse splenic T cells. A significant shift in
TRAIL-associated fluorescence was observed at 48 h after
stimulation in mouse T cells, but not in isotype control (Fig. 1D). The surface expression of TRAIL was in accordance with
the expression of TRAIL mRNA in mouse-activated T cells in RT-PCR
analysis (data not shown). The results indicated that mouse-activated T
cells expressed TRAIL on their surface. Cross-linking of TRAIL by plate-bound DR4-Fc enhanced proliferation of murine T cells activated by suboptimal anti-CD3
Proliferation assays using purified T cells from mouse splenocytes
revealed that cross-linking of TRAIL by plate-bound DR4-Fc induced
proliferation of murine T cells activated by immobilized suboptimal
anti-CD3 (Fig. 2). The plates
precoated with human IgG1 were used as controls. As shown in Fig. 2A, the proliferation of T cells was significantly enhanced
by immobilized DR4-Fc compared with immobilized human IgG1. This effect
is dependent on anti-CD3, because cell proliferation was not
detected in the absence of anti-CD3 (Fig. 2A). This
proliferation effect by plate-bound DR4-Fc was dose dependent, and
higher concentration of the plate-bound DR4-Fc induced increased
proliferation of preactivated murine T cells (Fig. 2B). We
found that cross-linking of TRAIL alone had no effect on the T cell
proliferation. In contrast, when both TCR and TRAIL were cross-linked
by anti-CD3 mAb (500 ng/ml) and DR4-Fc (10 µg/ml), respectively,
the proliferation of T cells was enhanced dramatically (Fig. 2A). To pinpoint TRAIL as the source of the proliferative
signal, soluble rTRAIL protein was added to block cell surface
TRAIL/DR4 interactions. A significant decrease in the proliferation of
T cells to the background level was observed upon the addition to the
culture of soluble TRAIL (Fig. 2A). Soluble TRAIL alone did
not affect the proliferation response on murine splenic T cells. To
further exclude the possibility that the neutralizing effect of TRAIL
could be due to its cytotoxic effect on T cells, thereby suppressing
their proliferation directly, and to ensure that the proliferation
effect is via interaction between DR4 and TRAIL, we used
anti-DR4-specific Ab (polyclonal antiserum to DR4; Alexis
Biochemicals, San Diego, CA) to block the interaction between
immobilized DR4-Fc and TRAIL on T cell surface. The results in Fig. 2C demonstrated that anti-DR4 Ab, like that of TRAIL,
could neutralize the stimulatory effect of immobilized DR4-Fc. The
anti-DR4 Ab alone did not affect the proliferation response on
mouse T cells. These results indicated that cross-linking of TRAIL on T
cell surface by plate-bound DR4-Fc induced maximal proliferation of
murine T cells in conjunction with suboptimal anti-CD3. Similar
results were also observed when purified human T cells were used (data
not shown).
|
in
murine-activated T cells
We then investigated the role of TRAIL in IFN- secretion during
T cell activation. To address this question, T cells were stimulated
with plate-bound suboptimal concentration of anti-CD3 mAb, 2C11
(500 ng/ml), in the presence of either immobilized soluble DR4-Fc
fusion protein or control human IgG1. The supernatant was collected,
and the cytokines secreted by T cells were quantified by ELISA. The
results in Fig. 3 demonstrated that
secretion of IFN- by T cells was significantly enhanced when TRAIL
was cross-linked by immobilized DR4-Fc compared with human IgG1 (Fig. 3A). The IL-4 secretion was also enhanced by immobilized
DR4-Fc in T cell activated by suboptimal CD3; however, the levels of
IL-4 in the culture supernatant were not as significantly elevated
compared with IFN- (Fig. 3B).
|
. In contrast, when both TCR and TRAIL were
cross-linked by anti-CD3 mAb (500 ng/ml) and DR4-Fc (10 µg/ml),
respectively, the secretion of IFN- was enhanced dramatically (Fig. 3A). We also tested whether the engagement of TRAIL by
DR4-Fc was cumulative. To address this question, T cells were
preactivated by plate-bound anti-CD3 mAb with or without
plate-bound DR4-Fc in both the priming and restimulation stages. Among
the four groups tested, we found that the highest level of IFN-
production was produced when T cells were cross-linked by anti-CD3
mAb and DR4-Fc fusion proteins in both the priming and restimulation
stages. The levels of IFN- produced, from highest to lowest, were
DR4-Fc/DR4-Fc > DR4-Fc/IgG1 > IgG1/DR4-Fc > IgG1/IgG1
(Fig. 3C). This observation suggested that engagement of
TRAIL could transduce a costimulatory signal to enhance IFN-
secretion during both priming and restimulation.
p38 MAPK inhibitor SB203580 blocked the up-regulation of IFN-
secretion via TRAIL on activated T cells
To understand the signaling pathway transduced by TRAIL, mouse T
cells activated by plate-bound anti-CD3 mAb and DR4-Fc were
incubated with SB203580, a p38 MAPK inhibitor. As shown in Fig. 4, the increased IFN- secretion by
immobilized DR4-Fc could be significantly suppressed by SB203580 in a
dose-dependent manner (Fig. 4). The results indicated that the p38 MAPK
inhibitor SB203580 blocked the up-regulation of IFN- secretion via
TRAIL on activated T cells. This suggested that the engagement of TRAIL
enhances the secretion of IFN- and which was dependent on the
activation of p38 MAPK.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
secretion
by activated T cells. In our results, the T cell costimulation effects
induced by immobilized DR4-Fc were dose dependent and could be
specifically blocked by soluble TRAIL and anti-DR4 Ab. In contrast,
these effects were not observed in immobilized human IgG1; therefore,
our data indicated that these effects might result from immobilized
DR4-Fc acting directly on preactivated T cells’ surface, instead of
acting indirectly via FcRs on surface of macrophages or other APCs.
Thus, the T cell proliferation response and enhanced IFN- production
induced by immobilized DR4-Fc in our assay system might result from the
reverse signaling by TRAIL on T cells. When plate-bound DR4-FC fusion
protein was used in conjunction with suboptimal amounts of
anti-CD3, a costimulatory signal was delivered for proliferation by
TRAIL to T cells. These data demonstrated that the source of this
positive signal is the TRAIL expressed on the T cells. The role of TCR engagement in conjunction with the TRAIL signal remains unclear. Other molecules known for their positive signaling capabilities have recently been implicated in the death of cells in the absence of a concomitant Ag receptor signal. For example, signaling through CD40 without concurrent engagement of the B cell receptor leads to Fas-mediated cell death (26, 27), and may serve an immunoregulatory role by removing nonspecific B cells. It will be interesting to determine whether TRAIL can still signal without engagement of the CD3/TCR complex, and to analyze the consequences of such uncoupled signaling. In light of the discovery that CD40 signals can direct germinal center B cells to become memory B cells (28), one could speculate on the role of TRAIL in the clonal expansion of Ag-specific T cells and the generation of memory T cells.
Although it is important to note that the molecules mediating these signals have yet to be identified, due to the short cytoplasmic domain of TRAIL, it has not been noticed that TRAIL might have the capability to transduce signal by itself. This implied that there might be other important intracellular molecules associated with TRAIL to transduce the signal. Even though the phenomenon of reverse signaling has been observed in several members of TNF superfamily, including CD40L/CD154, CD30L, CD27L/CD70, FasL, CD137L, OX40L, and TRANCE (16, 17, 18, 19, 20, 21, 22, 23, 24, 25), the downstream signaling pathways after cross-linking of TNF and other members of TNF family have not been elucidated until recently. It has been reported that a casein kinase I (CKI) consensus sequence is conserved in the cytoplasmic domain of 6 of 15 members of the type II integral membrane TNF ligand family (29). Therefore, Watts et al. (29) speculated that the CKI motif might be also phosphorylated in other TNF ligand family member. This represents a new insight into the mechanism of reverse signaling in this cytokine family. However, there is no CKI motif in the cytoplasmic region of TRAIL, and our study provides evidence that p38 MAPK is involved in reverse signaling via TRAIL. This raises the question as to whether MAPK signaling pathways are also initiated via other members of TNF superfamily. In a recent report, Chen et al. (25) also demonstrated that p38 MAPK was involved in reverse signal through TRANCE. The presence of reverse signaling further increases the complexity to our current understanding of TNF/TNFR superfamilies.
In recent studies, results obtained using soluble rTRAIL receptor
DR5-Fc in mice exacerbated autoimmune arthritis and led to profound
hyperproliferation of synovial cells and arthritogenic
(30). Furthermore, Hilliard et al. (31) found
that chronic TRAIL blockade in mice with soluble DR5 exacerbated
experimental autoimmune encephalomyelitis induced by myelin
oligodendrocyte glycoprotein. These effects might not only result from
the blockage of TRAIL/TRAIL receptor interaction in vivo, but it also
raised the possibility that these effects might result from the
DR5/TRAIL engagement to transduce a reverse signal to preactivated T
cells. Our study has clearly demonstrated that triggering of TRAIL by
immobilized DR4-Fc, in conjunction with immobilized suboptimal
anti-CD3 mAb, induced maximal proliferation response and enhanced
IFN- secretion by activated T cells. Thus, the exacerbated
autoimmune arthritis and hyperproliferation of synovial cells as well
as promotion of experimental autoimmune encephalomyelitis in mice
chronically treated with DR5 might result from the triggering of
preactivated T cells in vivo. This observation provides an explanation
for the profound hyperproliferation of synovial cells and
encephalomyelitic lymphocytes, and heightened the production of
cytokines and autoantibodies after DR5 treatment in mice (30, 31).
To date, the actual biological function of TRAIL and its four receptors in vivo is still not clear, and it is also not known whether these four different TRAIL receptors have different effects on TRAIL. Among the four TRAIL receptors, the DcR1/TRAIL-R3 and DcR2/TRAIL-R4 do not contain death domain and are unable to transduce death signal like DR4/TRAIL-R1 and DR5/TRAIL-R2. However, DcR1 and DcR2 might be able to cross-link TRAIL to transduce the reverse signal. Thus, DcR1 and DcR2 might play another role in the reciprocal signaling between TRAIL and TRAIL receptors. It will be interesting to know the differential effect of TRAIL receptor on TRAIL reverse signaling. Our study may provide a new insight into the biological function of TRAIL.
In conclusion, our results provide another evidence to demonstrate the existence of reverse signaling in a member of TNF superfamily, suggesting bidirectional signaling might be a general phenomenon in ligand/receptor interactions of TNF/TNFR superfamilies.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 A.-H.C. and H.-F.T. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. Ping-Ning Hsu, Graduate Institute of Immunology, College of Medicine, National Taiwan University, No. 1, Sec. 1, Jen-Ai Road, Taipei, Taiwan, Republic of China. E-mail address: phsu{at}ha.mc.ntu.edu.tw
4 Abbreviations used in this paper: L, ligand; CKI, casein kinase I; DcR, decoy receptor; DR, death receptor; MAPK, mitogen-activated protein kinase; TRAIL, TNF-related apoptosis-inducing ligand; TRANCE, TNF-related activation-induced cytokine.
Received for publication February 6, 2001. Accepted for publication June 1, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 7:813.[Medline]
by activated Th1 cells occurs via reverse signaling through TNF-related activation-induced cytokine. J. Immunol. 166:270.This article has been cited by other articles:
|
|
 |
|
  Q. J. Wang, K.-i. Hanada, and J. C. Yang Characterization of a Novel Nonclassical T Cell Clone with Broad Reactivity against Human Renal Cell Carcinomas J. Immunol., September 15, 2008; 181(6): 3769 - 3776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Brands, E. Colvin, L. J. Williams, R. Wang, R. B. Lock, and B. E. Tuch Reduced Immunogenicity of First-Trimester Human Fetal Pancreas Diabetes, March 1, 2008; 57(3): 627 - 634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Fionda, F. Nappi, M. Piccoli, L. Frati, A. Santoni, and M. Cippitelli Inhibition of Trail Gene Expression by Cyclopentenonic Prostaglandin 15-Deoxy-{Delta}12,14-Prostaglandin J2 in T Lymphocytes Mol. Pharmacol., November 1, 2007; 72(5): 1246 - 1257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sun and P. J. Fink A New Class of Reverse Signaling Costimulators Belongs to the TNF Family J. Immunol., October 1, 2007; 179(7): 4307 - 4312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Dieli, D. Vermijlen, F. Fulfaro, N. Caccamo, S. Meraviglia, G. Cicero, A. Roberts, S. Buccheri, M. D'Asaro, N. Gebbia, et al. Targeting Human {gamma}{delta} T Cells with Zoledronate and Interleukin-2 for Immunotherapy of Hormone-Refractory Prostate Cancer Cancer Res., August 1, 2007; 67(15): 7450 - 7457. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kim, A. Dabrowska, R. G. Jenner, and A. Aldovini Human and Simian Immunodeficiency Virus-Mediated Upregulation of the Apoptotic Factor TRAIL Occurs in Antigen-Presenting Cells from AIDS-Susceptible but Not from AIDS-Resistant Species J. Virol., July 15, 2007; 81(14): 7584 - 7597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Rus, V. Nguyen, R. Puliaev, I. Puliaeva, V. Zernetkina, I. Luzina, J. C. Papadimitriou, and C. S. Via T Cell TRAIL Promotes Murine Lupus by Sustaining Effector CD4 Th Cell Numbers and by Inhibiting CD8 CTL Activity J. Immunol., March 15, 2007; 178(6): 3962 - 3972. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sun, K. T. Ames, I. Suzuki, and P. J. Fink The Cytoplasmic Domain of Fas Ligand Costimulates TCR Signals J. Immunol., August 1, 2006; 177(3): 1481 - 1491. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Shi, J. Mao, G. Yu, J. Zhang, and J. Wu Tumor Vaccine Based on Cell Surface Expression of DcR3/TR6 J. Immunol., April 15, 2005; 174(8): 4727 - 4735. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-H. Chou, H.-F. Tsai, Y.-Y. Wu, C.-Y. Hu, L.-H. Hwang, P.-I. Hsu, and P.-N. Hsu Hepatitis C Virus Core Protein Modulates TRAIL-Mediated Apoptosis by Enhancing Bid Cleavage and Activation of Mitochondria Apoptosis Signaling Pathway J. Immunol., February 15, 2005; 174(4): 2160 - 2166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. W. Thomas, G. M. Myhre, R. Tschumper, R. Sreekumar, D. Jelinek, D. J. McKean, J. J. Lipsky, W. J. Sandborn, and L. J. Egan Selective Inhibition of Inflammatory Gene Expression in Activated T Lymphocytes: A Mechanism of Immune Suppression by Thiopurines J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 537 - 545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-R. Yang, S.-L. Hsieh, F.-M. Ho, and W.-W. Lin Decoy Receptor 3 Increases Monocyte Adhesion to Endothelial Cells via NF-{kappa}B-Dependent Up-Regulation of Intercellular Adhesion Molecule-1, VCAM-1, and IL-8 Expression J. Immunol., February 1, 2005; 174(3): 1647 - 1656. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Arens, M. A. Nolte, K. Tesselaar, B. Heemskerk, K. A. Reedquist, R. A. W. van Lier, and M. H. J. van Oers Signaling through CD70 Regulates B Cell Activation and IgG Production J. Immunol., September 15, 2004; 173(6): 3901 - 3908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. G. Neely, S. Epelman, L. L. Ma, P. Colarusso, C. J. Howlett, E. K. Amankwah, A. C. McIntyre, S. M. Robbins, and C. H. Mody Monocyte Surface-Bound IL-15 Can Function as an Activating Receptor and Participate in Reverse Signaling J. Immunol., April 1, 2004; 172(7): 4225 - 4234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kirchner, S. Boldt, W. Kolch, S. Haffner, S. Kazak, P. Janosch, E. Holler, R. Andreesen, and G. Eissner LPS resistance in monocytic cells caused by reverse signaling through transmembrane TNF (mTNF) is mediated by the MAPK/ERK pathway J. Leukoc. Biol., February 1, 2004; 75(2): 324 - 331. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Guo, M. Zhang, H. An, W. Chen, S. Liu, J. Guo, Y. Yu, and X. Cao Fas ligation induces IL-1{beta}-dependent maturation and IL-1{beta}-independent survival of dendritic cells: different roles of ERK and NF-{kappa}B signaling pathways Blood, December 15, 2003; 102(13): 4441 - 4447. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Shi, Y. Wu, J. Zhang, and J. Wu Death Decoy Receptor TR6/DcR3 Inhibits T Cell Chemotaxis In Vitro and In Vivo J. Immunol., October 1, 2003; 171(7): 3407 - 3414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. V. Proussakova, N. A. Rabaya, A. B. Moshnikova, E. S. Telegina, A. Turanov, M. G. Nanazashvili, and I. P. Beletsky Oligomerization of Soluble Fas Antigen Induces Its Cytotoxicity J. Biol. Chem., September 19, 2003; 278(38): 36236 - 36241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Younes and M. E. Kadin Emerging Applications of the Tumor Necrosis Factor Family of Ligands and Receptors in Cancer Therapy J. Clin. Oncol., September 15, 2003; 21(18): 3526 - 3534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Koyama, H. Tsukamoto, K. Masumoto, D. Himeji, K. Hayashi, M. Harada, and T. Horiuchi A novel polymorphism of the human APRIL gene is associated with systemic lupus erythematosus Rheumatology, August 1, 2003; 42(8): 980 - 985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wan, J. Zhang, H. Luo, G. Shi, E. Kapnik, S. Kim, P. Kanakaraj, and J. Wu A TNF Family Member LIGHT Transduces Costimulatory Signals into Human T Cells J. Immunol., December 15, 2002; 169(12): 6813 - 6821. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Kaplan, E. E. Lewis, E. A. Shelden, E. Somers, R. Pavlic, W. J. McCune, and B. C. Richardson The Apoptotic Ligands TRAIL, TWEAK, and Fas Ligand Mediate Monocyte Death Induced by Autologous Lupus T Cells J. Immunol., November 15, 2002; 169(10): 6020 - 6029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Shi, H. Luo, X. Wan, T. W. Salcedo, J. Zhang, and J. Wu Mouse T cells receive costimulatory signals from LIGHT, a TNF family member Blood, October 16, 2002; 100(9): 3279 - 3286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-L. Hsu, Y.-C. Chang, S.-J. Chen, Y.-J. Liu, A. W. Chiu, C.-C. Chio, L. Chen, and S.-L. Hsieh Modulation of Dendritic Cell Differentiation and Maturation by Decoy Receptor 3 J. Immunol., May 15, 2002; 168(10): 4846 - 4853. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or anti-CD3 mAb plus DR4-Fc (10 µg/ml) (
) in the
presence of 0–1 µM concentration of SB203580 for 3 days. Supernatant
was harvested and assayed for their IFN-