|
|
||||||||


*
Laboratory of Molecular Immunology, Center for Neurologic Diseases, Brigham and Womens Hospital, and
Department of Adult Oncology, Dana Farber Cancer Institute and Harvard Medical School, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CD4+CD25+ regulatory cells have been the object of intense study because their function appears critical in maintaining self tolerance. A number of characteristics have been described for the murine CD4+CD25+ cells that may provide insight into their mechanism of action. Most notably, CD4+CD25+ regulatory T cells suppress proliferation of cocultured CD25- T cells only on stimulation with soluble as compared with the more highly cross-linked plate-bound anti-CD3 (11, 12). They inhibit IL-2 production by responder T lymphocytes within 16 h of coculture and are themselves unable to secrete IL-2 (11, 13). In addition, CD4+CD25+ T cells constitutively express CTLA-4, a molecule that inhibits T cell activation either by delivering a negative signal coincident with TCR stimulation or by competitively inhibiting costimulation by its greater affinity for B7-1 and B7-2 as compared with CD28 (9, 14). In vivo and in vitro studies addressing the potential role of CD28 in the biology of CD4+CD25+ T cells suggest that CD28 costimulation may differentially affect the clonal expansion as opposed to the function of these regulatory cells. CD4+CD25+ T cells require CD28 and B7 for development and peripheral homeostasis as CD28-/- or B7-1-/-B7-2-/- NOD mice exhibited a severe deficit of these regulatory cells with associated worsening of diabetes (8). In contrast, in vitro studies have demonstrated that the suppressive ability of these murine CD4+CD25+ T cells is inhibited by providing anti-CD28 costimulation or exogenous IL-2 in conjunction with TCR stimulation (11, 12). In total, these observations suggest that the strength of TCR signal as well as the degree of costimulation may play different roles in the maintenance as opposed to the effector function of CD4+CD25+ T cells.
The critical importance of identifying and defining the mechanism of
action of regulatory T cells in humans prompted us to search for the
presence of a similar population of
CD4+CD25+ T cells in
peripheral blood. In a recent report, Stephens et al. (15)
described the existence of
CD4+CD25+ regulatory cells
from human thymus that could inhibit 60% of PHA-induced proliferation
in cocultures. Here, we report the identification of a subset within
the CD4+CD25+ T cells in
the circulation of normal humans that exhibit strong in vitro
regulatory function (>95% inhibition of
anti-CD3-induced proliferation) with characteristics
similarto those of murine
CD4+CD25+ regulatory cells.
This CD4+CD25high T
cell subset in humans comprises
12% of circulating
CD4+ T cells, unlike that in rodents where
610% of CD4+ T cells demonstrate regulatory
function. Whereas the entire population of
CD4+CD25+ T cells
expressing both low and high CD25 levels exhibit regulatory function in
the mouse, only the
CD4+CD25high population
(CD4+CD25high) exhibits a
similarly strong regulatory function in humans. These
CD4+CD25high cells inhibit
proliferation and cytokine secretion induced by TCR cross-linking of
CD4+CD25- responder T
cells in a contact-dependent manner. Although higher numbers of
CD4+CD25+high
T cells are required, these regulatory cell can still suppress
proliferation in the absence of the PD-1/PD-L1 or CTLA-4/B7 pathways.
Thus, regulatory CD4 T cells expressing high levels of the IL-2
receptor exist in human peripheral blood, providing the opportunity to
determine whether alterations in this population of T cells are
involved in the induction of human autoimmune disorders.
| Materials and Methods |
|---|
|
|
|---|
Cells were cultured in RPMI 1640 supplemented with 2 nM L-glutamine, 5 mM HEPES, and 100 U/ml penicillin/µg/ml streptomycin (all from BioWhittaker, Walkersville, MD), 0.5 mM sodium pyruvate, 0.05 mM nonessential amino acids (both from Life Technologies, Gaithersburg, MD), and 5% human AB serum (Gemini Bio-Products, Woodland, CA) in 96-well U-bottom plates (Costar, Corning, NY). The anti-CD3 (clone UCHT1 for plate-bound assays and clone Hit3a for soluble conditions) and anti-CD28 (clone 28.2, at 5 µg/ml) Abs were purchased from BD PharMingen (San Diego, CA). The anti-CD28 (clone 3D10) was provided by Genetics Institute (Cambridge, MA). (In subsequent assays, the UCHT1 anti-CD3 mAb gave the same results as the Hit3a mAb when tested in soluble form; data not shown.) For plate-bound anti-CD3 stimulation, 50 µl of the anti-CD3 Ab diluted into PBS (Life Technologies) at the indicated concentration of 5.0 or 0.05 µg/ml were added to the each culture well, placed at 37°C for 4 h, and then washed twice with PBS. The anti-PD-L1 Ab (2A3) (16) was used at 10 µg/ml. The mouse anti-human CTLA-4 Fab (mAb 20A) was provided by Genetics Institute and has been shown to functionally block interaction with B7-1/2 (17). Recombinant human IL-2 (IL-2; Teceleukin, obtained from the National Cancer Institute, Bethesda, MD) was added to those indicated cultures to a final concentration of 50 U/ml.
Cell isolation and stimulation
Human blood mononuclear cells were isolated from freshly drawn
human blood by Ficoll-Hypaque (Amersham Pharmacia, Piscataway, NJ)
gradient centrifugation. The CD4CD25-,
CD4CD25low, and CD4CD25high
populations were isolated from 1 x 108 PBMC
by sorting using a FACSVantage SE (BD Biosciences, San Jose,
CA). These cells were incubated with 400 µl each
anti-CD4-CyChrome (IgG1; BD PharMingen) and anti-CD25-PE
(IgG2a; Immunotech, Brea, CA). Control samples (1 x
106) were stained with anti-CD4-CyChrome and
IgG2a (BD PharMingen) or anti-CD25-PE and IgG1-CyChrome (BD
PharMingen). The analysis and sort gates were restricted to the
population of lymphocytes by means of their forward and side scatter
properties. Large, activated T cells were excluded. On reanalysis the
forward and side scatter properties of the
CD4+CD25high cells were not
appreciably different from those of the
CD4+CD25- population
indicating that these cell populations are similar in size. T
cell-depleted accessory cells were isolated by negative selection of
PBMC by incubation with anti-TCR pan 
Ab (Immunotech)
followed by gentle removal by Bio-Mag goat anti-mouse IgG-coated
magnetic beads (Polysciences, Warrington, PA) and then by irradiation
at 3300 rad. The indicated number of
CD4+CD25- or high
cells (2.55 x 103/well) were
plated with a 10-fold excess of T cell-depleted accessory cells.
Extremely low numbers of cells were added to these cultures as they
were incubated for up to 7 days. To determine proliferation, one-half
of the culture supernatant (100 µl) was removed from each well before
adding 1 µCi [3H]thymidine (NEN, Boston, MA)
for the final 16 h of culture before harvesting on the day
designated in each figure legend. All assays exhibited <10% SEM and
were repeated in a minimum of three independent experiments using blood
from different donors.
Transwell analysis
The CD4+CD25-, CD4+CD25high, and T cell-depleted accessory cell populations were isolated as described above and cultured in Transwell plates (Costar, Corning, NY). Both chambers of each Transwell received T cell-depleted accessory cells (5 x 105/well) and soluble anti-CD3 (10 µg/ml) plus soluble anti-CD28 (5 µg/ml) as described. The proliferation of CD4+CD25- cells (5 x 104) plated in the lower chamber of each Transwell was monitored in the presence or absence of direct contact with 5 x 104 CD4+CD25high regulatory cells. [3H]Thymidine (4 µCi) was added at day 4, and the wells were harvested at day 5.
FACS analysis of surface Ags
Human PBMC were isolated post-Ficoll gradient separation
and stained with anti-CD4-CyChrome (IgG1; BD PharMingen) and either
anti-CD25-PE (IgG2a) or anti-CD25-FITC (IgG2a), both purchased
from Immunotech. As the third color, the samples stained with
anti-CD4-CyChrome and anti-CD25-PE were also stained with
either IgG1-FITC or anti-CD62L-FITC (IgG1) from Immunotech,
IgG2b-FITC (Caltag, South San Francisco, CA), or anti-CD45RA-FITC
(IgG2b; BD PharMingen). As the third color, the samples stained with
anti-CD4-CyChrome and anti-CD25-FITC were also stained with
IgG1-PE, IgG2a-PE, anti-HLA DR-PE (IgG2b), or
anti-CD122(IL-2R
)-PE (IgG1) from BD PharMingen;
anti-CD45RO-PE (IgG2a), anti-CD58(LFA3)-PE (IgG2a), or
anti-CD71-PE (IgG1) from Immunotech, or IgG2b-PE from Beckman
Coulter (Miami, FL). The samples were run on an EPICS flow
cytometer, collecting data on 2 x 105
lymphocytes (gated by forward and side scatter properties), and
analyzed using CellQuest software (BD Biosciences). Although
appropriate isotype controls were run for each sample, because they
gave similar results, only the IgG1 isotype third color stain is
shown.
Cytokine analyses by ELISA
The supernatants that were removed before addition of
[3H]thymidine and were diluted and analyzed on
Immulon 4 ELISA plates (Dynex Technologies, Chantilly, VA) using the Ab
pairs IFN-
(M-700A, M-701-B biotin; Endogen, Woburn, MA),
IL-10 (18551D, 18562D-biotinylated; BD PharMingen), and IL-13 (554570,
biotinylated 555054; BD PharMingen), developed with an
avidin-peroxidase conjugate (1/10,000 dilution) (Sigma, St. Louis, MO)
and tetramethylbenzidine peroxide substrate (Kirkegaard & Perry
Laboratories, Gaithersburg MD). Instead of IL-4, IL-13 was assayed as a
prototypical Th2 cytokine due to limitations in the detection of IL-4
in culture supernatants of human T cells likely due to its consumption
and the fact that these assays were set up with very low numbers of T
cells per well.
IL-2 mRNA analyses by reverse transcription-semiquantitative PCR
Sixty wells of cultured CD4+CD25-, CD4+CD25high, or cocultured cells were stimulated with soluble anti-CD3/anti-CD28 (and T cell-depleted accessory cells) as before. After 5 days, RNA was isolated from the collected cells by solubilization in TRIzol reagent and converted into cDNA via the Superscript II Reverse Transcriptase protocol using oligo(dT)1218 (all reagents purchased from Life Technologies). Actin and IL-2 messages were amplified using the actin primers: 5': AACCCCAAGGCCAACCGCGAGAAGATGACC and 3': GGTGATGACCTGGCCGTCAGGCAGCTCGTA and the IL-2 primers: 5': TACAGGATGCAACTCCTGTCTTGCATTGCA, and 3': GTTGCTGTCTCATCAGCATATTCACAC ATG. PCR (100 µl) was performed using 2.5 U Taq DNA polymerase, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.5 µM primers, and cycling parameters of 94°C for 2 s, then the indicated number of cycles of: 94°C for 20 s, 60°C for 30 s, 72°C for 1 s. On combining all reagents, the initial PCR was split into five wells, one for removal every three cycles within the desired range. (Additional PCR controls (not shown), and past work demonstrated that a three-cycle delay in the appearance of a PCR product under these conditions were indicative of a 4-fold difference in input template (18).) Reaction products were analyzed on 2% agarose, Tris-buffered EDTA TBE gels.
| Results |
|---|
|
|
|---|
12% of
CD+ T cells in human peripheral blood
Approximately one-half of the circulating human peripheral blood
lymphocytes express CD4, and of these roughly 10% express the IL-2
growth factor receptor
-chain, CD25. Peripheral blood lymphocytes do
not stain very strongly for CD25. Unlike what is seen in the mouse, the
CD25+ population in the human is not as clearly
discernable (Fig. 1
a)
(11, 14). Rather, the CD4+ T cells
with the highest level of CD25
(CD4+CD25high) appear as a
tail to the right from the major population containing both
CD4+CD25low and
CD4+CD25- cells. The
CD25high cells represent 12% of the total
CD4+ T cell population, whereas the
CD25low cells can represent up to 16% of
CD+ T cells.
|
Human CD4+CD25high cells express CD45RO and MHC class II (HLA-DR)
The
CD4+CD25negative/low/high T
cells were analyzed for expression of surface Ags to gain insight into
their mechanism of action and to more fully characterize this
regulatory population in humans. The different levels of surface Ag
expression were compared among the
CD4+CD25negative,
CD4+CD25low, and
CD4+CD25high cell subsets
(Fig. 2
). CD45RO, which can be associated
with proliferative responses to recall Ags, was expressed at
significantly higher levels by the
CD4+CD25high population
(99%) than the CD4+CD25low
(89%) or CD4+CD25- (33%)
subset. This high expression of CD45RO on human
CD4+CD25high T cells is
akin to the expression of CD45RBlow on the
CD4+CD25+ regulatory cells
in mice (9). In contrast, the expression of CD45RA,
considered a marker for naive T cells, showed the opposite expression
profile. Greater than 50% of the
CD4+CD25- subset and 25%
of the CD4+CD25low subset
expressed CD45RA in contrast to only 4% of the
CD4+CD25high T cells.
|
-chain
(CD122) and LFA-3 (CD58) compared with the other T cell subsets. The
IL-2R
-chain was expressed by only 6% of
CD4+CD25- cells, by 28%
of the CD4+CD25low cell
subset, and by >85% of the
CD4+CD25high cells. Unlike
mouse T cells, activated human T cells express HLA class II molecules
on their surface allowing them to assume the role of APC
(20). Importantly, the low level of HLA-DR
expression observed in human blood was found to be limited to the
CD4+CD25high cells
(
20%) compared with <2% of the
CD4+CD25- and
CD4+CD25low populations.
The CD4+CD25high subset
also exhibited preferential expression of the transferrin receptor
(CD71, 46%), which is usually expressed on the surface of activated
lymphocytes and all cells entering proliferation (21).
Thus, the CD4+CD25high
regulatory cells express a number of surface Ags associated with
activation, migration, and Ag presentation. Increasing the TCR strength of signal for CD4+CD25high T cells induces proliferation and loss of regulatory function
We next examined whether alterations in the TCR strength of signal
could overcome either the nonresponsiveness or the suppression mediated
by CD4+CD25high cells.
Cultures were stimulated with two different doses of plate-bound
anti-CD3 to compare the effect of varying the quantity of the same
quality of TCR signal (i.e., that delivered by plate-bound
anti-CD3). TCR stimulation through plate-bound anti-CD3 at 5
µg/ml (maximal response) or 0.05 µg/ml (submaximal) alone (Fig. 3
) did not reverse the nonresponsive
state of the CD4+CD25high
cells. Stimulation of cocultures with maximal plate-bound anti-CD3
stimulation resulted in only 69% inhibition at a 1:1 ratio of
CD4+CD25high to
CD4+CD25- cells. In
contrast, cocultures stimulated with the submaximal dose of plate-bound
anti-CD3 exhibited >99% inhibition of proliferation. Increasing
the strength of signal by providing either costimulation with CD28
cross-linking or the addition of IL-2 to the maximal anti-CD3 (5
µg/ml) stimulus resulted in both
CD4+CD25high proliferation
(albeit at a low level) and the complete loss of regulation. Thus,
signaling through the TCR with a strong stimulus caused either the
target cell population to become refractory to inhibition or the
regulatory cell population to lose its effector function.
Interestingly, the ability of IL-2 to break the nonresponsiveness of
the CD4+CD25high population
was strongest if the cells were stimulated with submaximal
anti-CD3.
|
The effect of the
CD4+CD25high T cells on
cytokine secretion in the coculture conditions was next examined (Fig. 4
). We analyzed supernatants taken from
the cultures depicted in Fig. 3
for levels of IFN-
(Th1 cytokine)
and IL-13 (Th2 cytokine). We also measured secretion of the suppressive
cytokine, IL-10 as it is known to inhibit T cell proliferation and is
secreted by other types of regulatory T cells such as Tr1 cells as well
as non-T cell populations (22, 23). The samples were
diluted and analyzed by ELISA as described. The level of IFN-
secretion mirrored the level of proliferation with each stimulus (Fig. 4
a). In general, when the proliferation was inhibited by
coculture with the
CD4+CD25high cells, the
secretion of IFN-
was also decreased. However, the soluble
anti-CD3 alone coculture condition was an exception because there
was no decrease in IFN-
secretion in light of a striking inhibition
of proliferation.
|
secretion or proliferation to the
effects of coculture with regulatory cells under conditions of
different strengths of signal.
As discussed above, it was important mechanistically to further examine
whether IL-10 was secreted by the
CD4+CD25high regulatory
cells in coculture assays, because this cytokine is inhibitory to T
cell activation (24, 25). No culture stimulated with
soluble anti-CD3 secreted IL-10, even though these cultures
exhibited marked suppression (Fig. 4
b). In addition,
although IL-10 was produced in all the cultures of
CD4+CD25-cells alone and
cocultures stimulated with plate-bound anti-CD3 supplemented
with IL-2 or anti-CD28, it was not secreted by stimulation of the
CD4+CD25high cells (alone)
under any condition. There also was no correlation between suppression
and the secretion of IL-10, suggesting that regulation by
CD4+CD25high cells was
independent of IL-10. This interpretation was further supported by
Transwell analysis (Fig. 5
) which
demonstrated that contact is required for the
CD4+CD25high cells to exert
their regulatory function on
CD4+CD25- T cells.
Stimulation of CD4+CD25high
cells in the upper chamber had little effect on the growth of the
CD4+CD25- cells in the
lower chamber. In contrast, when the two populations were cocultured in
the same lower well, there was a marked inhibition of proliferation.
|
A series of experiments were performed to examine both the
kinetics and the degree of suppression mediated by
CD4+CD25high T cells. Using
soluble anti-CD3/anti-CD28 stimulation, different numbers of
CD4+CD25high cells (serial
3-fold dilutions) were cocultured with a constant number of
CD4+CD25- responder cells.
Proliferation was monitored at days 3, 5, and 7 (Fig. 6
a). Although there was almost
no detectable proliferation on day 3, by day 5 there were barely
detectable levels of proliferation which showed little inhibition. In
contrast, the inhibitory effect of the
CD4+CD25high T cells was
striking by day 7. The
CD4+CD25high T cells
inhibited the proliferative response of the cocultured
CD4+CD25- cells in a
dose-dependent manner (Fig. 6
a). These data show that 93 and
80% suppression occurs at the 1:1 and at the 0.3:1 cell ratios
(CD4+CD25high regulatory
cells to CD4+CD25-
responder cells) respectively. Although the suppression dropped to only
31% when the cells were cocultured at a ratio of 1:9, this is similar
to what is seen on titration of the murine
CD4+CD25+ regulatory cells.
|
, IL-10, or IL-13, whereas
CD4+CD25- responder cells
secreted only IFN-
. On titrating the regulatory cells into the
coculture, there was a dose-dependent inhibition of IFN-
secretion
(Fig. 6
secretion was
observable well before suppression of proliferation. CD4+CD25high cells inhibit IL-2 mRNA levels in cocultures
We addressed whether coculture with human
CD4+CD25high cells resulted
in a decrease in the levels of IL-2 mRNA as has been shown in the
analysis of mouse CD4+CD25+
cells (11). RNA samples of
anti-CD3/anti-CD28 (soluble)-stimulated cultures of
CD4+CD25negative,
CD4+CD25high,
or cocultures, were analyzed for their levels of
actin and IL-2 message by semiquantitative RT-PCR (18). As
shown in Fig. 7
, the levels of IL-2
message were significantly decreased in the cocultures, even though the
coculture sample contained twice the amount of cDNA as in the
CD4+CD25- only sample, as
indicated by the levels of actin product.
|
We then tried to identify a receptor-ligand interaction important
for CD4+CD25high-mediated
suppression of CD4+ T cells. We chose to examine
the PD-1, PD-L1, and CTLA-4 receptors on
CD4+CD25high T cells,
because their engagement is known to induce cell cycle arrest.
Specifically, PD-1 was identified as a receptor that is induced on
activated T cells and involved in programmed cell death (26, 27). The ligand for PD-1, PD-L1, was recently shown to deliver a
negative signal through the PD-1 receptor, which down-regulates T cell
proliferation and cytokine production in response to suboptimal TCR
stimulation (28, 29). Furthermore, both PD-L1 and PD-1 are
expressed by subsets of activated T cells (27, 28). CTLA-4
is similarly expressed by activated T cells and can deliver a negative
signal that results in down-regulation of T cell activation
(30). Thus, we asked whether inhibitory anti-PD-L1 or
anti-CTLA-4 mAbs could reverse the suppression induced by
CD4+CD25high T cells (Fig. 8
). When analyzed directly from the
blood, CD4+CD25high T cells
did not express CTLA-4 or PD-L1 on the cell surface (data not shown).
This is similar to the mouse system, in which CTLA-4 is constitutively
expressed in the cytoplasm of murine
CD4+CD25+ regulatory T
cells but is not detected on the cell surface (9, 14).
However, due to the longer kinetics of suppression and the fact that
peak levels of CTLA-4, PD1, and PD-L1 expression can be induced on T
cells by 23 days postactivation (27, 30, 31), it was
still possible that these regulatory molecules could be involved in the
suppression mediated by the
CD4+CD25high regulatory
cells. Adding anti-CTLA-4 Fab mAb to
CD4+CD25high/CD4+CD25-
cocultures did not alter the functional suppression of proliferation
(Fig. 8
a). Similarly, anti-CTLA-4 Fab mAb had no effect
on IFN-
secretion (Fig. 8
b) while inducing a paradoxical
decrease in the secretion of IL-13 by
CD4+CD25- T cells, as
previously described (17) (Fig. 8
c).
|
and IL-13, which were both inhibited by the
CD4+CD25high regulatory T
cells in a dose-dependent manner. The addition of both anti-CTLA-4
and anti-PD-L1 together mirrored that of anti-PD-L1 cultures
alone for proliferation and IFN-
secretion. Again, the blocking
CTLA-4 enhanced the secretion of IL-13 (Fig. 8| Discussion |
|---|
|
|
|---|
, IL-13, or IL-10 with any stimulation
condition but rather were able to inhibit the secretion of IFN-
and
IL-13 by cocultured, activated CD4+ T cells.
The mechanism of suppression by these
CD4+CD25high regulatory
cells appears to be independent of the inhibitory cytokines, IL-10 and
TGF-
. Although IL-10 was secreted by
CD4+CD25- cells, the
presence or absence of IL-10 did not correlate with suppression in
cocultures. To rule out the possibilities that IL-10 was consumed or
was in very low abundance, additional experiments demonstrated that the
addition of blocking anti-TGF-
or anti-IL-10 Abs had no
effect on the ability of
CD4+CD25high cells to
suppress the proliferation of cocultured
CD4+CD25- cells (data not
shown). Thus, the cytokine-independent suppression by
CD4+CD25high cells is an
important distinction given that secretion of these two cytokines has
been found to be integral to the function of other types of regulatory
T cells (23).
Immune regulation is highly complex, and the mechanisms of suppression is not as yet understood. The identification of two major CD4 T cell subsets by Mosmann and Coffman (32) was a major advance, providing the insight that cytokines secreted by CD4 T cells may regulate immune responses. However, it was clear that populations of T cells could also mediate immune responses by cell contact in the absence of cytokine secretion. Experiments demonstrating that CD4+CD25+ T cells function as key regulatory effectors in mice have provided important information about a specific cellular population that performs immune regulation through suppression of self responses (6). In those studies, it was demonstrated that thymectomy on neonatal day 3 that resulted in a multiorgan autoimmune disease (gastritis, thyroiditis, and insulitis) was associated with the loss of this CD4+CD25+ population (4, 10, 33). Mason et al. (34) have also demonstrated the existence of similar regulatory T cells in the rat, further suggesting the importance of CD4+CD25+ T cells across species in regulating immune responses.
The mechanism of action by which CD4+CD25+ T cells so effectively inhibit proliferation of CD4 T cells remains unknown. The work by Thornton and Shevach (11) establishing an in vitro model system that mimics the function of CD4+CD25+ T cells in in vivo models was critical in directing the investigation of regulatory T cells in humans . Those experiments demonstrated that although murine CD4+CD25+ cells failed to proliferate after TCR stimulation alone, they could proliferate quite well if exogenous IL-2 was also provided. Yet this addition of IL-2 or anti-CD28 abolished the suppression of the proliferation of the cocultured cells. Interestingly, in humans, we found that although anti-CD28 costimulation also inhibited suppression, it did so only in the context of certain TCR signals. Yet suppression by both murine and human CD4+CD25+ regulatory cells has been shown to require cell contact. Thus, because the features of the murine CD4+CD25+ and the human CD4+CD25high regulatory cell populations are essentially identical, we conclude that they represent homologous populations.
Human CD4 regulatory function was observed only when the cells expressed high levels of CD25 and were isolated apart from the CD25low T cells. The mouse CD4+CD25+ regulatory subset is isolated from all CD25-expressing cells regardless of their level of CD25 expression (7, 11, 12). If similar criteria are followed to isolate these cells from human blood, the resulting CD25+ cells (high and low together) did not exhibit a hyporesponsive phenotype or significant suppressive function. CD4 T cells expressing low levels of the IL-2 receptor (CD25) strongly proliferated to submaximal TCR stimulation and showed no suppressive ability. Furthermore, CD25high cells derived from in vitro stimulation of CD4+CD25- cells, and large activated CD4+CD25+ T cells isolated directly ex vivo also did not demonstrate suppressor activity (data not shown). Thus, as suggested by Thornton and Shevach (11), these data together support the concept that the CD4+CD25+ T cells may represent a distinct lineage of professional suppressor cells. Moreover, our experiments indicate the need to re-evaluate data on IL-2 receptor expression on CD4 T cells in the peripheral blood and inflammatory compartments of human diseases, as CD4+CD25+ T cells may represent either activated or regulatory T cells.
The CD4+CD25high cells may
exist in a semiactivated state in vivo, expressing a number of surface
Ags that are usually associated with activated T cells. Interestingly,
the CD4+CD25high T cells we
identified expressed high levels of both IL-2 receptor
-chain, and
(CD122) IL-2 receptor
-chain, making up the high affinity IL-2R.
Thus, these regulatory T cells may be poised for a quick response or
alternatively, constantly turned on and performing continual low level
regulatory activity.
The mechanism of suppression mediated by CD4+CD25high cells appears to be linked in part to the strength of signal delivered through the TCR. Our data demonstrate that the addition of costimulatory signals did not abrogate regulatory function if the coincident TCR signal strength was low, thus linking the mechanism of suppression to TCR strength of signal. In contrast, the addition of IL-2 to cocultures ablated suppression in all cases regardless of the strength of the TCR stimulus. This suggests that suppression by regulatory cells at the initiation of significant inflammatory responses in vivo would be kept in check by the secretion of IL-2 by Ag-responsive T cells. With time, as activated T cells no longer secrete IL-2, the CD4+CD25high cells can manifest their function. Conversely, it appears that the regulatory CD4+CD25high cells require their own activation signal to then feed back the suppression of Ag-activated T cells. The mechanism underlying these initial signaling event are not as yet elucidated.
Whereas IL-2 ablated the suppressor function of CD4+CD25high cells under all stimulatory conditions, regulatory cells could function in the presence of CD28 costimulation depending on the strength of the TCR signal. This may be of importance in relationship to the nature of T cell-stimulatory signals delivered in association with responses to self Ag (low strength of signal) in which suppression of T cell responses is desirable as compared with responses to foreign microbial Ags (stronger strength of signals) where suppression could be detrimental. It is also possible that either B7-1 or B7-2 expressed on the surface of activated human T cells with activation may provided important costimulatory signals that ablate the suppression by CD4+CD25high cells (30, 35). We are currently determining whether the strength of the TCR signal alters the sensitivity of the responder cell to suppression or whether it inactivates the regulatory cell.
In our experiments, blocking engagement of CTLA-4 did not alter the functional suppression by regulatory CD4+CD25high T cells. In the mouse model, differing results were obtained with blocking CTLA-4 in in vitro cultures stimulated with soluble anti-CD3 mAb (11, 14). Sakaguchi et al. demonstrated that anti-CTLA-4 at 300 µg/ml was able to completely inhibit suppression. Because both the regulatory and responder T cells could express CTLA-4 in the coculture, it was important that they demonstrated that the ability of CTLA-4 Fab to inhibit regulatory cell function did not require CTLA-4 expression on the responder T cell. In contrast, Shevach et al. found no effect on inhibition of coculture proliferation with anti-CTLA-4 mAb when added at 10 µg/ml. Yet blocking CTLA-4 in vivo via anti-CTLA-4 treatment as well as blocking signaling through CTLA-4/CD28/B7 pathways with CTLA-4Ig abrogated any protection offered by cotransfer of the CD4+CD25+ population in the in vivo models of autoimmunity of diabetes (NOD) and intestinal inflammation (8, 9).
Somewhat expected as a result of its inhibitory effect on proliferation (29), blocking PD-1 engagement by anti-PD-L1 increased [3H]thymidine incorporation by target CD4 T cells. In this situation, significantly more regulatory CD4+CD25high T cells were required to suppress the proliferative response, although with a high enough ratio, the proliferative response could still be totally abolished. However, because a second receptor for PD-1 has just been identified, PD-L2, combined blockade of both PD-1 ligands might have a more pronounced effect (16). We interpret these data to imply that regulation is a complex phenomenon where the relative activation states of the different T cell populations are critical in determining the outcome of TCR engagement.
It has been long known that a subpopulation of human T cells from normal adult subjects express class II MHC (20). A unique and perhaps important aspect of this work is the observation that the CD4+CD25high subset expressed HLA-DR. T cell expression of class II MHC allows T-T presentation of Ag, and this results in a profound state of anergy (36). The suppression resulting from T-T cell presentation of Ag is similarly not blocked by inhibiting the B7/CTLA-4 pathway (36). Because we found that it is the CD4+CD25high and not the CD4+CD25low population that expresses class II MHC ex vivo, it is tempting to speculate that presentation of some as yet undefined Ag or even invariant TCR to the target CD4 cell is responsible for suppression of proliferation. Experiments to test this hypothesis are in progress.
In summary, we report the identification of a CD4+CD25+ population of regulatory T cells in the circulation of humans that exhibit practically identical in vitro characteristics to the CD4+CD25+ regulatory cells isolated in mice. With TCR cross-linking, CD4+CD25high cells did not proliferate but instead totally inhibited proliferation and cytokine secretion by activated CD4+CD25- responder T cells in a contact-dependent manner. Thus, regulatory CD4 T cells expressing high levels of the IL-2 receptor and class II MHC are present in humans, providing the opportunity to determine whether alterations of these populations of T cells are involved in the induction of human autoimmune disorders.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Clare Baecher-Allan, 77 Avenue Louis Pasteur, Harvard Medical School, Boston, MA 02115. E-mail address: callan{at}rics.bwh.harvard.edu ![]()
3 Abbreviation used in this paper: NOD, nonobese diabetic. ![]()
Received for publication January 26, 2001. Accepted for publication May 23, 2001.
| References |
|---|
|
|
|---|
-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155:1151.[Abstract]
chain, resistance to clonal deletion and IL-2 dependency. Int. Immunol. 10:371.This article has been cited by other articles:
![]() |
J. Mjosberg, J. Svensson, E. Johansson, L. Hellstrom, R. Casas, M. C. Jenmalm, R. Boij, L. Matthiesen, J.-I. Jonsson, G. Berg, et al. Systemic Reduction of Functionally Suppressive CD4dimCD25highFoxp3+ Tregs in Human Second Trimester Pregnancy Is Induced by Progesterone and 17{beta}-Estradiol J. Immunol., July 1, 2009; 183(1): 759 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kivisakk, B. C. Healy, V. Viglietta, F. J. Quintana, M. A. Hootstein, H. L. Weiner, and S. J. Khoury Natalizumab treatment is associated with peripheral sequestration of proinflammatory T cells Neurology, June 2, 2009; 72(22): 1922 - 1930. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Hendrikx, E. A. F. J. van Gurp, W. M. Mol, W. Schoordijk, V. D. K. D. Sewgobind, J. N. M. IJzermans, W. Weimar, and C. C. Baan End-stage renal failure and regulatory activities of CD4+CD25bright+FoxP3+ T-cells Nephrol. Dial. Transplant., June 1, 2009; 24(6): 1969 - 1978. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Mack, A. M. Lanham, B. E. Palmer, L. A. Maier, and A. P. Fontenot CD27 Expression on CD4+ T Cells Differentiates Effector from Regulatory T Cell Subsets in the Lung J. Immunol., June 1, 2009; 182(11): 7317 - 7324. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Meier, D. Golshayan, E. Blanc, M. Pascual, and M. Burnier Oxidized LDL Modulates Apoptosis of Regulatory T Cells in Patients with ESRD J. Am. Soc. Nephrol., June 1, 2009; 20(6): 1368 - 1384. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Q. Tran, J. Andersson, D. Hardwick, L. Bebris, G. G. Illei, and E. M. Shevach Selective expression of latency-associated peptide (LAP) and IL-1 receptor type I/II (CD121a/CD121b) on activated human FOXP3+ regulatory T cells allows for their purification from expansion cultures Blood, May 21, 2009; 113(21): 5125 - 5133. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Francois, S. Ottaviani, N. Renkvist, J. Stockis, G. Schuler, K. Thielemans, D. Colau, M. Marchand, T. Boon, S. Lucas, et al. The CD4+ T-Cell Response of Melanoma Patients to a MAGE-A3 Peptide Vaccine Involves Potential Regulatory T Cells Cancer Res., May 15, 2009; 69(10): 4335 - 4345. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Beriou, C. M. Costantino, C. W. Ashley, L. Yang, V. K. Kuchroo, C. Baecher-Allan, and D. A. Hafler IL-17-producing human peripheral regulatory T cells retain suppressive function Blood, April 30, 2009; 113(18): 4240 - 4249. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Oh, G. Blevins, C. Griffith, N. Richert, D. Maric, C. R. Lee, H. McFarland, and S. Jacobson Regulatory T Cells Are Reduced During Anti-CD25 Antibody Treatment of Multiple Sclerosis Arch Neurol, April 1, 2009; 66(4): 471 - 479. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. O. Mouk, P. N. M. Mwinzi, C. L. Black, J. M. Carter, Z. W. Ng'ang'a, M. M. Gicheru, W. E. Secor, D. M. S. Karanja, and D. G. Colley Childhood Coinfections with Plasmodium falciparum and Schistosoma mansoni Result in Lower Percentages of Activated T Cells and T Regulatory Memory Cells than Schistosomiasis Only Am J Trop Med Hyg, March 1, 2009; 80(3): 475 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ji and M. W. Cloyd HIV-1 binding to CD4 on CD4+CD25+ regulatory T cells enhances their suppressive function and induces them to home to, and accumulate in, peripheral and mucosal lymphoid tissues: an additional mechanism of immunosuppression Int. Immunol., March 1, 2009; 21(3): 283 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. WADA, H. SUZUKI, R. FUCHINO, A. YAMASAKI, S. NAGAI, K. YANAI, K. KOGA, M. NAKAMURA, M. TANAKA, T. MORISAKI, et al. The Contribution of Vascular Endothelial Growth Factor to the Induction of Regulatory T-Cells in Malignant Effusions Anticancer Res, March 1, 2009; 29(3): 881 - 888. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Putnam, T. M. Brusko, M. R. Lee, W. Liu, G. L. Szot, T. Ghosh, M. A. Atkinson, and J. A. Bluestone Expansion of Human Regulatory T-Cells From Patients With Type 1 Diabetes Diabetes, March 1, 2009; 58(3): 652 - 662. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sattler, U. Wagner, M. Rossol, J. Sieper, P. Wu, A. Krause, W. A. Schmidt, S. Radmer, S. Kohler, C. Romagnani, et al. Cytokine-induced human IFN-{gamma}-secreting effector-memory Th cells in chronic autoimmune inflammation Blood, February 26, 2009; 113(9): 1948 - 1956. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Strauss, C. Bergmann, and T. L. Whiteside Human Circulating CD4+CD25highFoxp3+ Regulatory T Cells Kill Autologous CD8+ but Not CD4+ Responder Cells by Fas-Mediated Apoptosis J. Immunol., February 1, 2009; 182(3): 1469 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bonelli, A. Savitskaya, C.-W. Steiner, E. Rath, J. S. Smolen, and C. Scheinecker Phenotypic and Functional Analysis of CD4+CD25-Foxp3+ T Cells in Patients with Systemic Lupus Erythematosus J. Immunol., February 1, 2009; 182(3): 1689 - 1695. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Taflin, M. Miyara, D. Nochy, D. Valeyre, J.-M. Naccache, F. Altare, P. Salek-Peyron, C. Badoual, P. Bruneval, J. Haroche, et al. FoxP3+ Regulatory T Cells Suppress Early Stages of Granuloma Formation but Have Little Impact on Sarcoidosis Lesions Am. J. Pathol., February 1, 2009; 174(2): 497 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kleinewietfeld, M. Starke, D. Di Mitri, G. Borsellino, L. Battistini, O. Rotzschke, and K. Falk CD49d provides access to "untouched" human Foxp3+ Treg free of contaminating effector cells Blood, January 22, 2009; 113(4): 827 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wilde, S. Dolff, X. Cai, C. Specker, J. Becker, M. Totsch, U. Costabel, J. Durig, A. Kribben, J. W. C. Tervaert, et al. CD4+CD25+ T-cell populations expressing CD134 and GITR are associated with disease activity in patients with Wegener's granulomatosis Nephrol. Dial. Transplant., January 1, 2009; 24(1): 161 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ahmadzadeh, A. Felipe-Silva, B. Heemskerk, D. J. Powell Jr, J. R. Wunderlich, M. J. Merino, and S. A. Rosenberg FOXP3 expression accurately defines the population of intratumoral regulatory T cells that selectively accumulate in metastatic melanoma lesions Blood, December 15, 2008; 112(13): 4953 - 4960. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tretter, R. K. C. Venigalla, V. Eckstein, R. Saffrich, S. Sertel, A. D. Ho, and H.-M. Lorenz Induction of CD4+ T-cell anergy and apoptosis by activated human B cells Blood, December 1, 2008; 112(12): 4555 - 4564. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Hippen, P. Harker-Murray, S. B. Porter, S. C. Merkel, A. Londer, D. K. Taylor, M. Bina, A. Panoskaltsis-Mortari, P. Rubinstein, N. Van Rooijen, et al. Umbilical cord blood regulatory T-cell expansion and functional effects of tumor necrosis factor receptor family members OX40 and 4-1BB expressed on artificial antigen-presenting cells Blood, October 1, 2008; 112(7): 2847 - 2857. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Chase, H.-C. Yang, H. Zhang, J. N. Blankson, and R. F. Siliciano Preservation of FoxP3+ Regulatory T Cells in the Peripheral Blood of Human Immunodeficiency Virus Type 1-Infected Elite Suppressors Correlates with Low CD4+ T-Cell Activation J. Virol., September 1, 2008; 82(17): 8307 - 8315. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yu, S. Heck, V. Patel, J. Levan, Y. Yu, J. B. Bussel, and K. Yazdanbakhsh Defective circulating CD25 regulatory T cells in patients with chronic immune thrombocytopenic purpura Blood, August 15, 2008; 112(4): 1325 - 1328. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, P. Yang, H. Zhou, H. He, X. Ren, W. Chi, L. Wang, and A. Kijlstra Diminished Frequency and Function of CD4+CD25high Regulatory T Cells Associated with Active Uveitis in Vogt-Koyanagi-Harada Syndrome Invest. Ophthalmol. Vis. Sci., August 1, 2008; 49(8): 3475 - 3482. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Cardoso, G. P. Garlet, A. P. Moreira, W. M. Junior, M. A. Rossi, and J. S. Silva Characterization of CD4+CD25+ natural regulatory T cells in the inflammatory infiltrate of human chronic periodontitis J. Leukoc. Biol., July 1, 2008; 84(1): 311 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Vasir, Z. Wu, K. Crawford, J. Rosenblatt, C. Zarwan, A. Bissonnette, D. Kufe, and D. Avigan Fusions of Dendritic Cells with Breast Carcinoma Stimulate the Expansion of Regulatory T Cells while Concomitant Exposure to IL-12, CpG Oligodeoxynucleotides, and Anti-CD3/CD28 Promotes the Expansion of Activated Tumor Reactive Cells J. Immunol., July 1, 2008; 181(1): 808 - 821. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bonelli, A. Savitskaya, K. von Dalwigk, C. W. Steiner, D. Aletaha, J. S. Smolen, and C. Scheinecker Quantitative and qualitative deficiencies of regulatory T cells in patients with systemic lupus erythematosus (SLE) Int. Immunol., July 1, 2008; 20(7): 861 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Forger, N Marcoli, S Gadola, B Moller, P M Villiger, and M Ostensen Pregnancy induces numerical and functional changes of CD4+CD25high regulatory T cells in patients with rheumatoid arthritis Ann Rheum Dis, July 1, 2008; 67(7): 984 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ebinuma, N. Nakamoto, Y. Li, D. A. Price, E. Gostick, B. L. Levine, J. Tobias, W. W. Kwok, and K.-M. Chang Identification and In Vitro Expansion of Functional Antigen-Specific CD25+ FoxP3+ Regulatory T Cells in Hepatitis C Virus Infection J. Virol., May 15, 2008; 82(10): 5043 - 5053. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Kimball, M. Flattery, F. McDougan, and V. Kasirajan Cellular Immunity Impaired Among Patients on Left Ventricular Assist Device for 6 Months Ann. Thorac. Surg., May 1, 2008; 85(5): 1656 - 1661. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Bonelli, K von Dalwigk, A Savitskaya, J S Smolen, and C Scheinecker Foxp3 expression in CD4+ T cells of patients with systemic lupus erythematosus: a comparative phenotypic analysis Ann Rheum Dis, May 1, 2008; 67(5): 664 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vargas-Rojas, J. Crispin, Y Richaud-Patin, and J Alcocer-Varela Quantitative and qualitative normal regulatory T cells are not capable of inducing suppression in SLE patients due to T-cell resistance Lupus, April 1, 2008; 17(4): 289 - 294. [Abstract] [PDF] |
||||
![]() |
B. Santner-Nanan, N. Seddiki, E. Zhu, V. Quent, A. Kelleher, B. F. de St Groth, and R. Nanan Accelerated age-dependent transition of human regulatory T cells to effector memory phenotype Int. Immunol., March 1, 2008; 20(3): 375 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Antons, R. Wang, K. Oswald-Richter, M. Tseng, C. W. Arendt, S. A. Kalams, and D. Unutmaz Naive Precursors of Human Regulatory T Cells Require FoxP3 for Suppression and Are Susceptible to HIV Infection J. Immunol., January 15, 2008; 180(2): 764 - 773. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tritt, E. Sgouroudis, E. d'Hennezel, A. Albanese, and C. A. Piccirillo Functional Waning of Naturally Occurring CD4+ Regulatory T-Cells Contributes to the Onset of Autoimmune Diabetes Diabetes, January 1, 2008; 57(1): 113 - 123. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Karlsson, B. Malleret, P. Brochard, B. Delache, J. Calvo, R. Le Grand, and B. Vaslin FoxP3+ CD25+ CD8+ T-Cell Induction during Primary Simian Immunodeficiency Virus Infection in Cynomolgus Macaques Correlates with Low CD4+ T-Cell Activation and High Viral Load J. Virol., December 15, 2007; 81(24): 13444 - 13455. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Hombach, D. Kofler, A. Hombach, G. Rappl, and H. Abken Effective Proliferation of Human Regulatory T Cells Requires a Strong Costimulatory CD28 Signal That Cannot Be Substituted by IL-2 J. Immunol., December 1, 2007; 179(11): 7924 - 7931. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. J. Lee, T. J. Creed, L. P. Schewitz, P. V. Newcomb, L. B. Nicholson, A. D. Dick, and C. M. Dayan CD4+CD25int T Cells in Inflammatory Diseases Refractory to Treatment with Glucocorticoids J. Immunol., December 1, 2007; 179(11): 7941 - 7948. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Litzinger, R. Fernando, T. J. Curiel, D. W. Grosenbach, J. Schlom, and C. Palena IL-2 immunotoxin denileukin diftitox reduces regulatory T cells and enhances vaccine-mediated T-cell immunity Blood, November 1, 2007; 110(9): 3192 - 3201. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Habicht, S. Dada, M. Jurewicz, B. T. Fife, H. Yagita, M. Azuma, M. H. Sayegh, and I. Guleria A Link between PDL1 and T Regulatory Cells in Fetomaternal Tolerance J. Immunol., October 15, 2007; 179(8): 5211 - 5219. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Watanabe, P. N. M. Mwinzi, C. L. Black, E. M. O. Muok, D. M. S. Karanja, W. E. Secor, and D. G. Colley T Regulatory Cell Levels Decrease in People Infected With Schistosoma mansoni on Effective Treatment Am J Trop Med Hyg, October 1, 2007; 77(4): 676 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-Z. Yang, A. J. Novak, S. C. Ziesmer, T. E. Witzig, and S. M. Ansell CD70+ non-Hodgkin lymphoma B cells induce Foxp3 expression and regulatory function in intratumoral CD4+CD25 T cells Blood, October 1, 2007; 110(7): 2537 - 2544. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Oberle, N. Eberhardt, C. S. Falk, P. H. Krammer, and E. Suri-Payer Rapid Suppression of Cytokine Transcription in Human CD4+CD25 T Cells by CD4+Foxp3+ Regulatory T Cells: Independence of IL-2 Consumption, TGF-beta, and Various Inhibitors of TCR Signaling J. Immunol., September 15, 2007; 179(6): 3578 - 3587. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. J. de Boer, C. M. van der Loos, P. Teeling, A. C. van der Wal, and M. B.M. Teunissen Immunohistochemical Analysis of Regulatory T Cell Markers FOXP3 and GITR on CD4+CD25+ T Cells in Normal Skin and Inflammatory Dermatoses J. Histochem. Cytochem., September 1, 2007; 55(9): 891 - 898. [Abstract] [Full Text] [PDF] |
||||
![]() |
The International Multiple Sclerosis Genetics Cons Risk Alleles for Multiple Sclerosis Identified by a Genomewide Study N. Engl. J. Med., August 30, 2007; 357(9): 851 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Haas, B. Fritzsching, P. Trubswetter, M. Korporal, L. Milkova, B. Fritz, D. Vobis, P. H. Krammer, E. Suri-Payer, and B. Wildemann Prevalence of Newly Generated Naive Regulatory T Cells (Treg) Is Critical for Treg Suppressive Function and Determines Treg Dysfunction in Multiple Sclerosis J. Immunol., July 15, 2007; 179(2): 1322 - 1330. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yates, F. Rovis, P. Mitchell, B. Afzali, J.-S Tsang, M. Garin, R. Lechler, G. Lombardi, and O. Garden The maintenance of human CD4+CD25+ regulatory T cell function: IL-2, IL-4, IL-7 and IL-15 preserve optimal suppressive potency in vitro Int. Immunol., June 1, 2007; 19(6): 785 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Luhn, C. P. Simmons, E. Moran, N. T. P. Dung, T. N. B. Chau, N. T. H. Quyen, L. T. T. Thao, T. Van Ngoc, N. M. Dung, B. Wills, et al. Increased frequencies of CD4+CD25high regulatory T cells in acute dengue infection J. Exp. Med., May 14, 2007; 204(5): 979 - 985. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Pereira, F. Villinger, N. Onlamoon, P. Bryan, A. Cardona, K. Pattanapanysat, K. Mori, S. Hagen, L. Picker, and A. A. Ansari Simian Immunodeficiency Virus (SIV) Infection Influences the Level and Function of Regulatory T Cells in SIV-Infected Rhesus Macaques but Not SIV-Infected Sooty Mangabeys J. Virol., May 1, 2007; 81(9): 4445 - 4456. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schmidt-Lucke, A. Aicher, P. Romagnani, B. Gareis, S. Romagnani, A. M. Zeiher, and S. Dimmeler Specific recruitment of CD4+CD25++ regulatory T cells into the allograft in heart transplant recipients Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2425 - H2431. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Hilchey, A. De, L. M. Rimsza, R. B. Bankert, and S. H. Bernstein Follicular Lymphoma Intratumoral CD4+CD25+GITR+ Regulatory T Cells Potently Suppress CD3/CD28-Costimulated Autologous and Allogeneic CD8+CD25- and CD4+CD25- T Cells J. Immunol., April 1, 2007; 178(7): 4051 - 4061. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bayry, F. Triebel, S. V. Kaveri, and D. F. Tough Human Dendritic Cells Acquire a Semimature Phenotype and Lymph Node Homing Potential through Interaction with CD4+CD25+ Regulatory T Cells J. Immunol., April 1, 2007; 178(7): 4184 - 4193. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mor, D. Planer, G. Luboshits, A. Afek, S. Metzger, T. Chajek-Shaul, G. Keren, and J. George Role of Naturally Occurring CD4+CD25+ Regulatory T Cells in Experimental Atherosclerosis Arterioscler. Thromb. Vasc. Biol., April 1, 2007; 27(4): 893 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Siddiqui, X. Frigola, S. Bonne-Annee, M. Mercader, S. M. Kuntz, A. E. Krambeck, S. Sengupta, H. Dong, J. C. Cheville, C. M. Lohse, et al. Tumor-Infiltrating Foxp3-CD4+CD25+ T Cells Predict Poor Survival in Renal Cell Carcinoma Clin. Cancer Res., April 1, 2007; 13(7): 2075 - 2081. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Noris, F. Casiraghi, M. Todeschini, P. Cravedi, D. Cugini, G. Monteferrante, S. Aiello, L. Cassis, E. Gotti, F. Gaspari, et al. Regulatory T Cells and T Cell Depletion: Role of Immunosuppressive Drugs J. Am. Soc. Nephrol., March 1, 2007; 18(3): 1007 - 1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Garin, C.-C. Chu, D. Golshayan, E. Cernuda-Morollon, R. Wait, and R. I. Lechler Galectin-1: a key effector of regulation mediated by CD4+CD25+ T cells Blood, March 1, 2007; 109(5): 2058 - 2065. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kinter, J. McNally, L. Riggin, R. Jackson, G. Roby, and A. S. Fauci Suppression of HIV-specific T cell activity by lymph node CD25+ regulatory T cells from HIV-infected individuals PNAS, February 27, 2007; 104(9): 3390 - 3395. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Valencia, C. Yarboro, G. Illei, and P. E. Lipsky Deficient CD4+CD25high T Regulatory Cell Function in Patients with Active Systemic Lupus Erythematosus J. Immunol., February 15, 2007; 178(4): 2579 - 2588. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kekalainen, H. Tuovinen, J. Joensuu, M. Gylling, R. Franssila, N. Pontynen, K. Talvensaari, J. Perheentupa, A. Miettinen, and T. P. Arstila A Defect of Regulatory T Cells in Patients with Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy J. Immunol., January 15, 2007; 178(2): 1208 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Keino, M Takeuchi, Y Usui, T Hattori, N Yamakawa, T Kezuka, J-I Sakai, and M Usui Supplementation of CD4+CD25+ regulatory T cells suppresses experimental autoimmune uveoretinitis Br. J. Ophthalmol., January 1, 2007; 91(1): 105 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Battaglia, A. Stabilini, B. Migliavacca, J. Horejs-Hoeck, T. Kaupper, and M.-G. Roncarolo Rapamycin Promotes Expansion of Functional CD4+CD25+FOXP3+ Regulatory T Cells of Both Healthy Subjects and Type 1 Diabetic Patients J. Immunol., December 15, 2006; 177(12): 8338 - 8347. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hoffmann, R. Eder, T. J. Boeld, K. Doser, B. Piseshka, R. Andreesen, and M. Edinger Only the CD45RA+ subpopulation of CD4+CD25high T cells gives rise to homogeneous regulatory T-cell lines upon in vitro expansion Blood, December 15, 2006; 108(13): 4260 - 4267. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tuovinen, J. T. Salminen, and T. P. Arstila Most human thymic and peripheral-blood CD4+CD25+ regulatory T cells express 2 T-cell receptors Blood, December 15, 2006; 108(13): 4063 - 4070. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang In Reply J. Clin. Oncol., December 1, 2006; 24(34): 5470 - 5471. [Full Text] [PDF] |
||||
![]() |
L. Zhu, F. Ji, Y. Wang, Y. Zhang, Q. Liu, J. Z. Zhang, K. Matsushima, Q. Cao, and Y. Zhang Synovial Autoreactive T Cells in Rheumatoid Arthritis Resist IDO-Mediated Inhibition J. Immunol., December 1, 2006; 177(11): 8226 - 8233. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Miller, K. Lundberg, V. Ozenci, A. H. Banham, M. Hellstrom, L. Egevad, and P. Pisa CD4+CD25high T Cells Are Enriched in the Tumor and Peripheral Blood of Prostate Cancer Patients J. Immunol., November 15, 2006; 177(10): 7398 - 7405. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mor, G. Luboshits, D. Planer, G. Keren, and J. George Altered status of CD4+CD25+ regulatory T cells in patients with acute coronary syndromes Eur. Heart J., November 1, 2006; 27(21): 2530 - 2537. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Cavassani, A. P. Campanelli, A. P. Moreira, J. O. Vancim, L. H. Vitali, R. C. Mamede, R. Martinez, and J. S. Silva Systemic and Local Characterization of Regulatory T Cells in a Chronic Fungal Infection in Humans J. Immunol., November 1, 2006; 177(9): 5811 - 5818. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-W. Xia, W.-W. Zhong, L.-Q. Xu, J.-L. Sun, Q.-X. Shen, J.-G. Wang, J. Shao, Y.-Z. Li, and S.-C. Yu Heme Oxygenase-1-Mediated CD4+CD25high Regulatory T Cells Suppress Allergic Airway Inflammation J. Immunol., November 1, 2006; 177(9): 5936 - 5945. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Suarez, P Lopez, J Gomez, and C Gutierrez Enrichment of CD4+ CD25high T cell population in patients with systemic lupus erythematosus treated with glucocorticoids Ann Rheum Dis, November 1, 2006; 65(11): 1512 - 1517. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bernasconi, R. Marino, A. Ribas, J. Rossi, M. Ciaccio, M. Oleastro, A. Ornani, R. Paz, M. A. Rivarola, M. Zelazko, et al. Characterization of Immunodeficiency in a Patient With Growth Hormone Insensitivity Secondary to a Novel STAT5b Gene Mutation Pediatrics, November 1, 2006; 118(5): e1584 - e1592. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hirahara, L. Liu, R. A. Clark, K.-i. Yamanaka, R. C. Fuhlbrigge, and T. S. Kupper The Majority of Human Peripheral Blood CD4+CD25highFoxp3+ Regulatory T Cells Bear Functional Skin-Homing Receptors J. Immunol., October 1, 2006; 177(7): 4488 - 4494. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lopez, M. R. Clarkson, M. Albin, M. H. Sayegh, and N. Najafian A Novel Mechanism of Action for Anti-Thymocyte Globulin: Induction of CD4+CD25+Foxp3+ Regulatory T Cells J. Am. Soc. Nephrol., October 1, 2006; 17(10): 2844 - 2853. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Lawson, A. K. Brown, V. Bejarano, S. H. Douglas, C. H. Burgoyne, A. S. Greenstein, A. W. Boylston, P. Emery, F. Ponchel, and J. D. Isaacs Early rheumatoid arthritis is associated with a deficit in the CD4+CD25high regulatory T cell population in peripheral blood Rheumatology, October 1, 2006; 45(10): 1210 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lizee, L. G. Radvanyi, W. W. Overwijk, and P. Hwu Improving Antitumor Immune Responses by Circumventing Immunoregulatory Cells and Mechanisms. Clin. Cancer Res., August 15, 2006; 12(16): 4794 - 4803. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Rezvani, S. Mielke, M. Ahmadzadeh, Y. Kilical, B. N. Savani, J. Zeilah, K. Keyvanfar, A. Montero, N. Hensel, R. Kurlander, et al. High donor FOXP3-positive regulatory T-cell (Treg) content is associated with a low risk of GVHD following HLA-matched allogeneic SCT Blood, August 15, 2006; 108(4): 1291 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Nardelli, T. F. Warner, S. M. Callister, and R. F. Schell Anti-CD25 Antibody Treatment of Mice Vaccinated and Challenged with Borrelia spp. Does Not Exacerbate Arthritis but Inhibits Borreliacidal Antibody Production. Clin. Vaccine Immunol., August 1, 2006; 13(8): 884 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. W. Lim, H. E. Broxmeyer, and C. H. Kim Regulation of Trafficking Receptor Expression in Human Forkhead Box P3+ Regulatory T Cells J. Immunol., July 15, 2006; 177(2): 840 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Valmori, V. Tosello, N. E. Souleimanian, E. Godefroy, L. Scotto, Y. Wang, and M. Ayyoub Rapamycin-Mediated Enrichment of T Cells with Regulatory Activity in Stimulated CD4+ T Cell Cultures Is Not Due to the Selective Expansion of Naturally Occurring Regulatory T Cells but to the Induction of Regulatory Functions in Conventional CD4+ T Cells J. Immunol., July 15, 2006; 177(2): 944 - 949. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Seddiki, B. Santner-Nanan, J. Martinson, J. Zaunders, S. Sasson, A. Landay, M. Solomon, W. Selby, S. I. Alexander, R. Nanan, et al. Expression of interleukin (IL)-2 and IL-7 receptors discriminates between human regulatory and activated T cells J. Exp. Med., July 10, 2006; 203(7): 1693 - 1700. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, A. L. Putnam, Z. Xu-yu, G. L. Szot, M. R. Lee, S. Zhu, P. A. Gottlieb, P. Kapranov, T. R. Gingeras, B. F. de St. Groth, et al. CD127 expression inversely correlates with FoxP3 and suppressive function of human CD4+ T reg cells J. Exp. Med., July 10, 2006; 203(7): 1701 - 1711. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zheng, S. Liu, P. Wang, Y. Xu, and A. Chen Arming Tumor-Reactive T Cells with Costimulator B7-1 Enhances Therapeutic Efficacy of the T Cells. Cancer Res., July 1, 2006; 66(13): 6793 - 6799. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kryczek, S. Wei, L. Zou, G. Zhu, P. Mottram, H. Xu, L. Chen, and W. Zou Cutting Edge: Induction of B7-H4 on APCs through IL-10: Novel Suppressive Mode for Regulatory T Cells J. Immunol., July 1, 2006; 177(1): 40 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Xu, J. Fu, L. Jin, H. Zhang, C. Zhou, Z. Zou, J.-M. Zhao, B. Zhang, M. Shi, X. Ding, et al. Circulating and Liver Resident CD4+CD25+ Regulatory T Cells Actively Influence the Antiviral Immune Response and Disease Progression in Patients with Hepatitis B J. Immunol., July 1, 2006; 177(1): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wing, Z. Fehervari, and S. Sakaguchi Emerging possibilities in the development and function of regulatory T cells Int. Immunol., July 1, 2006; 18(7): 991 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Valencia, G. Stephens, R. Goldbach-Mansky, M. Wilson, E. M. Shevach, and P. E. Lipsky TNF downmodulates the function of human CD4+CD25hi T-regulatory cells Blood, July 1, 2006; 108(1): 253 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nishioka, J. Shimizu, R. Iida, S. Yamazaki, and S. Sakaguchi CD4+CD25+Foxp3+ T Cells and CD4+CD25-Foxp3+ T Cells in Aged Mice. J. Immunol., June 1, 2006; 176(11): 6586 - 6593. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |