The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, H.
Right arrow Articles by Murphy, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, H.
Right arrow Articles by Murphy, K. M.
The Journal of Immunology, 2001, 167: 855-865.
Copyright © 2001 by The American Association of Immunologists

Unexpected Characteristics of the IFN-{gamma} Reporters in Nontransformed T Cells1

Hong Zhu2,*, Jianfei Yang2,*, Theresa L. Murphy*, Wenjun Ouyang*, Fred Wagner{dagger}, Arman Saparov{dagger}, Casey T. Weaver{dagger} and Kenneth M. Murphy3,*

* Department of Pathology and Immunology, Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO 63110; {dagger} Department of Pathology, University of Alabama, Birmingham, AL 35294


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of the IFN-{gamma} promoter has primarily been conducted by transient expression of reporter constructs in transformed cells. However, the activity of cis elements may differ when expressed transiently compared with their activity within native chromatin. Furthermore, the transcription factors and signaling mechanisms in transformed cells may differ from those in normal T cells. To analyze IFN-{gamma} promoter regulation in normal T cells, we developed a novel retroviral bottom-strand reporter system to allow the chromatin integration of promoter regions in primary developing T cells. As controls, both the IL-2 and IL-4 promoters were inducible in this system, with the IL-4 reporter having Th2-specific activity. Strikingly, the IFN-{gamma} promoter exhibited constitutive activity in both Th1 and Th2 subsets, in contrast to the behavior of the endogenous IFN-{gamma} gene, which is inducible only in Th1 cells. In mapping this activity, we found that the AP-1/GM-CSF site in the distal promoter element is the most critical element for the constitutive activity. Transgenic reporter lines for the IFN-{gamma} promoter confirmed the constitutive behavior of the isolated IFN-{gamma} promoter. This constitutive activity was resistant to inhibition by cyclosporin A and was independent of Stat4 and p38 mitogen-activated protein kinase. These results suggest that IFN-{gamma} promoter regulation may require cis elements residing either downstream or >3.4 kb upstream of the transcriptional start site, involving repression of constitutive activity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The regulation of IFN-{gamma} in Th1 cells is important in protective immunity. Macrophages activated by IFN-{gamma} show enhanced killing of intracellular pathogens (1). Mice lacking IFN-{gamma} receptors show increased susceptibility to Listeria monocytogenes (2), and mice from a genetically resistant background but lacking the IFN-{gamma} receptor become susceptible to infection with Leishmania major (3). IFN-{gamma}-deficient mice had impaired production of macrophage antimicrobial products and reduced expression of MHC class II and were killed by a sublethal dose of Mycobacterium bovis bacillus Calmette-Guérin (4). IFN-{gamma}-deficient mice failed to control a normally sublethal dose of Mycobacterium tuberculosis in vivo (5, 6).

IFN-{gamma} gene regulation has been intensively studied by transient transfection assays and transgenic mice. Young et al. (7, 8) demonstrated that an 8.6-kb genomic region of human IFN-{gamma} directed tissue-specific expression in transient transfection and transgenic mice. A 500-bp 5' region of the human IFN-{gamma} promoter has PMA-inducible enhancer-like activity (9). In that region, two elements were identified: a distal region containing a GATA consensus and proximal region homologous to NFIL-2A of the IL-2 promoter (10). Flavell and colleagues analyzed the proximal and distal elements in transgenic reporter mice, in which the individual elements were used in isolation to direct expression of a minimal promoter/reporter cassette. Both proximal and distal elements directed reporter expression in CD4+ T cells, and the transcriptional activity was inhibited by cyclosporin A (CsA)4 (11). Importantly, this study did not use these elements together in a construct containing the intact native IFN-{gamma} promoter, and to our knowledge, no study of the intact IFN-{gamma} promoter in transgenic mice has been reported.

NF-{kappa}B and NF-AT have been proposed to act directly at cis elements of the IFN-{gamma} promoter. In Jurkat cells, NF-{kappa}B and NF-AT proteins independently bind the C3–3P site of the IFN-{gamma} promoter (12). Wilson and colleagues argued that c-Jun is essential for activation-induced reporter transcription and binds preferably as a heterodimer with activating transcription factor-2 (13). NF-ATp bound independently to the two NF-AT sites between -280 and -155 of human IFN-{gamma} and was required to form a composite element with AP-1 spanning the region -163 to -147. Point mutations within either NF-AT site or AP-1 sites decreased the expression of IFN-{gamma} reporter constructs (14) in transient transfections of transformed cells.

CREB-activating transcription factor-1 may inhibit transcription by interactions with the proximal promoter element (13, 15, 16). Overexpression of CREB inhibited transcription directed by either the proximal or distal promoter elements of the IFN-{gamma} gene in Jurkat cells (16). A silencer activity has been described within a region between -251 and -215 of the human IFN-{gamma} promoter (17). Young and colleagues demonstrated that transcription factor YY1 can directly inhibit the activity of IFN-{gamma} promoter by interacting with multiple sites in the promoter (18, 19). Overexpression of YY1 inhibited IFN-{gamma} promoter activity, and mutation of the YY1 binding site increased IFN-{gamma} reporter activity (18).

The transcription factor Stat4 is required for Th1 development and is at least indirectly involved in IFN-{gamma} gene expression (20, 21, 22). However, it is unclear how Stat4 regulates IFN-{gamma} expression. Sites binding Stat4 as well as several other Stat factors were identified within the IFN-{gamma} gene (23), but functional analysis of their role in IFN-{gamma} regulation is required. Also, Stat4 may not be required for IFN-{gamma} expression in all cells (24). CD8+ T cells deficient in Stat4 can produce IFN-{gamma} at levels similar to those of wild-type CD8+ T cells, whereas CD4+ T cells deficient in Stat4 do not produce IFN-{gamma} (24). Recently, the transcription factor T-bet was reported to enhance IFN-{gamma} production (25), although its target sites have not yet been functionally mapped.

Despite the numerous studies based on transient transfection in transformed cells, the cis elements responsible for tissue-specific and subset-restricted expression of IFN-{gamma} are still debated and may indeed differ between various cell lineages (24) and modes of cellular stimulation (26). To analyze the native IFN-{gamma} promoter in nontransformed CD4+ T cells, we developed a novel system to facilitate reporter analysis in normal T cells based on bottom strand placement of promoter cassettes in a recombinant retrovirus. At the same time, we generated transgenic reporter mice from a 3.4-kb region of the IFN-{gamma} promoter. The results show that the 3.4-kb IFN-{gamma} promoter region is constitutively active in both Th1 and Th2 cells, suggesting that the inducible nature of the IFN-{gamma} promoter may involve elements outside the 5' regulatory region that has been traditionally considered the IFN-{gamma} promoter.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice, reagents, cytokines, and Abs

DO11.10 {alpha}{beta} TCR-transgenic mice on wild-type and Stat4-deficient backgrounds have been described previously (27, 28). Female BALB/c mice were bred in our facility. CsA, PMA, and ionomycin were purchased from Sigma (St. Louis, MO). Recombinant human IL-2 was obtained from Takeda (Osaka, Japan), murine rIL-12 was purchased from Genetics Institute (Cambridge, MA), and murine rIFN-{gamma} was obtained from Genentech (South San Francisco, CA). Murine rIL-4 was generated from transfected P815 mastocytoma cells as high titer culture supernatant. Monoclonal anti-mIFN-{gamma} (H22) was obtained from Dr. R. D. Schreiber (Washington University, St. Louis, MO); monoclonal anti-IL-4 (11B11) (29) and anti-IL-12 (Tosh) (30) were previously described.

Retroviral constructs and retroviral transfection

A 3.5-kb murine IFN-{gamma} promoter was provided by Dr. H. Fox (The Scripps Institute, La Jolla, CA) (31). A retrovirus-based reporter, hCD4-pA-GFP-RV, which uses a cytoplasmic truncated human CD4 (hCD4) to mark viral infection and green fluorescence protein (GFP) to report promoter activity, was constructed as follows. First, a polyadenylation site generated by PCR from the murine MHC class I Kb gene using EcoRI- and SalI-tailed oligonucleotides (5'pA-R1, GGAAATCGATTGAGAATGCTTAGAGGT; 3'pA-SalI, ACGCGTCGACCTGTTCACACTCAGCTG) was digested with EcoRI and SalI. A GFP cDNA was isolated from GFP-RV by NcoI digestion, blunting using Vent polymerase, and EcoRI digestion (32). GFP cDNA and the polyadenylation site were ligated, in a trimolecular reaction, into SmaI/SalI-digested pBSSK to produce the plasmid GFP-pA-BSSK. Next, CD4-RV, previously described (33), was modified by removing the internal ribosomal entry site located upstream of CD4 by digestion with BglII and NcoI, followed by blunting with Klenow and religation to produce the vector hCD4-only-RV. Then, the GFP/poly(A) cassette was removed from GFP-pA-BSSK by XbaI/XhoI, blunted with Klenow, and ligated into the Klenow-blunted BamHI site of CD4-only RV to generate the vector hCD4-pA-GFP-RV. The proper orientation of the vector was confirmed by restriction mapping, PCR, and sequencing (Fig. 3Go).



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 3. Integrated IFN-{gamma} reporters show constitutive activity at the single-cell level in Th1 and Th2 cells. A, Map of the hCD4-pA-GFP-RVreporter construct. Human CD4 was used for the infection marker, while GFP expression is under the control of the IFN-{gamma}, IL-2, or IL-4 promoter. B, The retroviral constructs were transiently transfected into Phoenix E packaging cells. The viral supernatants were used to infect DO11.10 cell under Th1- or Th2-polarizing conditions. On day 7, human CD4 and murine CD4 double-positive cells were sorted and restimulated with OVA/APC for another week under the initial activation conditions. Cells were then harvested and stimulated with PMA/ionomycin. After 24 h of stimulation, supernatants were collected to determine IFN-{gamma} and IL-4 titers by ELISA. C and D, hCD4-pA-GFP-RVretrovirus infected Th1 (C) or Th2 (D) cells were stimulated with PMA/ionomycin for 6 h, and the cells were stained with hCD4-PE. Numbers in the upper right quadrant represent the percentage of hCD4-positive/GFP-positive cells in the live cell gate.

 
Cytokine promoters were cloned as blunt fragments into the blunted HindIII site of hCD4-pA-GFP-RV as follows. To generate IFN-{gamma} promoter regions by PCR, the oligonucleotide 3A-SalI, annealing to the IFN-{gamma} promoter at +36 to +17, and the following oligonucleotides, annealing to indicated upstream IFN-{gamma} promoter regions, were used as primers with the genomic IFN-{gamma} template (31): 3A-SalI, ACGCGTCGACTGTCTTCTCTAGGTCAGCCG; -586 (D), GCGAAGCTTCACGTTGACCCTGAGT; -350, CCTGTGCTGTGCTCTGTGGATG; -247, TGCTTTCAGAGAATCCCACAAG; -194, CATCGTCAGAGAGCCCAAGGAG; -134, TAATGCAAAGTAACTTAGCTCC; -115, TCCCCCCACCTATCTGTCACCATCTTAA; -80, AAACCAAAAAAAAACTTGTGAAAATACGTAATCCCG; and -59 (H), GCGAAGCTTAAAATACGTAATCCCGAG. The distal element reporter was generated using the following primer sets: -134, TAATGCAAAGTAACTTAGCTCC; and distal-AS, TTTTTTTTTTTTTAAGATGGTGACAGATAGG.

The internal deletion of the GATA and AP-1 cis elements of hCD4-pA-GFP-RV-(-134) was generated using the QuickChange PCR-based strategy (Stratagene, La Jolla, CA) with the following oligonucleotides: distal-GATA-del-S, ATGCAAAGTAACTTAGCTCCCATCTGTCACCATCTTAAAAAAA; distal-GATA-del-AS, TTTTTTTAAGATGGTGACAGATGGGAGCTAAGTTACTTTGCAT; distal-AP-1-del-S, CTTAGCTCCCCCCACCTATCAAACCAAAAAAAAACTTGTGAAAATACGTA; and distal-AP-1-del-AS, TACGTATTTTCACAAGTTTTTTTTTGGTTTGATAGGTGGGGGGAGCTAAG. The 2.1-kb IL-2 promoter region was excised from IL-2-Luc (34) as a PstI fragment, Klenow-bunted, and cloned into the Klenow-blunted HindIII site of hCD4-pA-GFP-RV. The IL-4 promoter (34) was generated by PCR with the following primers: -742, CGCGGATCCGTGAATTCTCCACACTGATGCTG; and +66, CCCAAGCTTTAGCTCTGTGCCG. The oligonucleotide GFP-5'-AS internal to the GFP-coding region was used to sequence all promoter constructs: GFP-5'-AS, GTGAACAGCTCCTCGCCCTTGC.

The retroviral-based reporter, GFP-pA-rLuc-RV (Fig. 1GoB), was constructed as follows. First the vector GFP-RV (32) was digested with BglII and NcoI to release the internal ribosomal entry site upstream of GFP, Vent-blunted, and religated to produce the intermediate GFP-only RV. The pRL-Null vector (Promega) was next modified by removing the SV40 late polyadenylation signal (which operates on both strands) by digestion with XbaI/BamHI and replacing it with the single-sided polyadenylation signal from the murine class I MHC Kb gene amplified by PCR from the genomic template with primers tailed with XbaI and BamHI sites to create the plasmid rLN-Kb-A. A BamHI fragment from rLN-Kb-A containing the Renilla luciferase-poly(A) cassette was inserted at the unique BamHI site downstream of GFP in GFP-only RV to produce GFP-pA-rLuc-RV. IFN-{gamma} promoter regions made by PCR as described above were cloned as blunt fragments into the blunted ClaI site of GFP-pA-rLuc-RV. This vector uses GFP to mark retroviral infection and Renilla luciferase to report promoter activity.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 1. IFN-{gamma} promoter is inducible by PMA/ionomycin in EL-4 lymphoma cells. EL-4 cells were transiently transfected with IFN-{gamma} or IL-2 promoter reporter vectors inserted into pBS-Luc (A) as described previously (34 ) or GFP-pA-rLuc-RV (B) as described in Materials and Methods. After 12 h, cells were left untreated (None) or were stimulated with PMA/ionomycin (P/I) for 4 h, and luciferase activity was determined. CMV promoter-driven Renilla luciferase (A) or firefly luciferase (B) activity was used for normalization. Results were similar in three independent experiments.

 
Transient transfection and luciferase analysis

The pBS-Luc firefly luciferase-based reporter has been described previously (34). For transient transfections (Fig. 1Go), EL-4 cells (107) were electroporated with 20 µg IFN-{gamma} reporter construct and 1 µg CMV-Renilla (32) luciferase construct or with 20 µg GFP-pA-rLuc-RV and 10 µg CMV-firefly luciferase (34) in 1.2 ml Iscove’s modified DMEM at (960 µF, 280 V) as described. At 12 h, cells were left untreated or were activated by 50 ng/ml PMA and 1 µM ionomycin as indicated for 4 h, and luciferase activity was measured as previously described (34). Firefly luciferase activity was normalized using the activity of Renilla luciferase of each determination as previously described (32).

Cell culture, cell sorting, ELISA, and FACS analysis

DO11.10 T cells were differentiated to Th1 and Th2 phenotypes, and retroviral infections were conducted as previously described (28, 35). Infected T cells were purified by cell sorting on day 7 after primary activation by expression of murine CD4 and either GFP (Fig. 2Go) or human CD4 (hCD4). Cells infected with GFP-pA-rLuc-RV-base retroviral reporter constructs (Fig. 2Go) were stained with PE-conjugated anti-murine CD4 (BD PharMingen, San Diego, CA) on ice for 30 min, washed twice, and purified by sorting for GFP and murine CD4 expression (Cytomation, Fort Collins, CO). Cells infected with hCD4-pA-GFP-RV retroviral reporters were stained with PE-conjugated anti-human CD4 (Caltag, Burlingame, CA) and CyChrome-conjugated anti-murine CD4 (BD PharMingen), purified by sorting for human and murine CD4 expression. Sorted T cells were expanded by weekly stimulation with OVA peptide (0.3 µM) at 2.5 x 105 cell/ml and irradiated BALB/c splenocytes (2000 rad; 5 x 106 cells/ml). Cells were harvested 7 days after the last activation, washed, and counted. To analyze cytokine production by T cells, cells were stimulated with PMA (50 ng/ml) and ionomycin (1 µM) for 24 h, and the supernatants were harvested to determine IFN-{gamma} and IL-4 titers by sandwich ELISA as described previously (36). To analyze reporter expression in sort-purified T cells, cells were stimulated with PMA and ionomycin for 6 h and then stained with PE-conjugated anti-human CD4. After 30 min on ice, cells were washed twice with PBS, suspended in 500 µl PBS, and analyzed on a FACSCalibur (BD Biosciences, Franklin Lakes, NJ).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Integrated IFN-{gamma} reporters show constitutive activity in Th1 and Th2 cells. A, Map of GFP-pA-rLuc-RV vector and constructs containing the -59 (GFP-pA-rLuc-RV-H) or -586 (GFP-pA-rLuc-RV-D) regions of the IFN-{gamma} promoter in GFP-pA-rLuc-RV. B, DO11.10 T cells were activated with OVA and IL-12/11B11 (anti-IL-4) for Th1 or with IL-4/TOSH (anti-IL-12) for Th2 cell development for 2 days and were infected with either GFP-pA-rLuc-RV-H or GFP-pA-rLuc-RV-D retrovirus as indicated. GFP- and murine CD4-positive cells were sorted on day 7 and restimulated with OVA/APC for another 1 wk in the initial activation condition. Cells were left untreated ({square}, -) or were treated with PMA/ionomycin ({blacksquare}, +), and luciferase activity was measured after 4 h. Data are the relative light units from 1 x 106 cells. Similar results were obtained in two similar experiments.

 
EMSA

Nuclear extracts were prepared and EMSA was performed as previously described (26). Binding reactions consisted of 2 µg nuclear extract, 1 µg poly(dI-dC), 10 mM Tris-Cl (pH 7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% (v/v) glycerol, and 5 x 104 cpm 32P-labeled probe in 20-µl reaction volumes. After incubation on ice for 30 min, the reactions were resolved by nondenaturing 4.5% PAGE for 2 h at 150 V, followed by autoradiography. The following double-stranded oligonucleotides were used: MN3, which is from -134 to -88 of the IFN-{gamma} promoter, TAATGCAAAGTAACTTAGCTCCCCCCACCTATCTGTCACCATCTTAA; and E{alpha} Y-box, TCGACATTTTTCTGATTGGTTAAAAGTC.

Generation of transgenic mice

The transgenic reporter construct contains a 3.4-kb IFN-{gamma} promoter fragment cloned from a BALB/c genomic library. It contains the endogenous TATA box with the S65T-GFP cDNA inserted at the start site of translation of the first exon of IFN-{gamma}, but with a modified Kozak consensus sequence, as previously described (37). Transgenic mice were generated as previously described, founders were identified by Southern analysis, and three independent lines were established, essentially as previously described (37). Founders were crossed onto the BALB/c background and bred with DO11.10 TCR-transgenic mice (27).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inducible IFN-{gamma} reporters during transient expression in transformed cells

To begin, we wished to test whether IFN-{gamma} promoter fragments were active in transient transfection assays using standard firefly luciferase reporter pBS-Luc. Thus, we analyzed the expression of various IFN-{gamma} reporters by transient transfection in EL-4 cells (Fig. 1GoA). Transfected cells were stimulated with PMA/ionomycin for 4 h, and luciferase activity was determined (Fig. 1GoA). Consistent with previous studies (10, 13), various IFN-{gamma} promoter constructs ranging from -59 to -3489 of the transcription start site were inducible by PMA/ionomycin stimulation, with various constructs showing only slight differences in the levels of inducibility or expression. As a positive control, the IL-2 promoter-driven luciferase reporter was highly inducible by PMA/ionomycin stimulation (Fig. 1GoA).

To allow for analysis of the IFN-{gamma} promoter in primary T cells, we developed a bottom-strand reporter system based on delivery by recombinant retrovirus (Fig. 1GoB). This retrovirus expresses GFP under the control of the murine stem cell virus long terminal repeat (LTR), while luciferase expression is controlled by the promoter inserted onto the retroviral bottom strand. We first tested these new retroviral report constructs in transient transfections of EL-4 cells to determine whether the promoters behave in the same manner as when contained in the pBS-Luc based luciferase vectors described above. When used in transient transfections, the retroviral IFN-{gamma} promoter reporters were inducible by PMA/ionomycin and had generally similar levels of inducibility as in the pBS-Luc reporters. As a positive control, the IL-2 promoter was also highly inducible by PMA/ionomycin (Fig. 1GoB). This indicates that the -59 to -1976 IFN-{gamma} promoter regions in this novel retroviral construct function as expected when used in transient transfection of a transformed cell line.

Constitutive IFN-{gamma} reporter activity in stably integrated nontransformed T cells

Next we asked how this retroviral reporter system would behave when stably integrated in primary CD4+ T cells. DO11.10 splenocytes were stimulated with OVA under Th1- or Th2-inducing conditions and infected with the GFP-pA-rLuc-RV based reporter viruses (Fig. 2GoA) on day 2 after primary activation. On day 7, cells infected with reporter viruses were purified by cell sorting based on GFP and murine CD4 expression to >95% purity. Cells were restimulated with OVA and APC for 7 days, harvested, washed, and counted. Equal numbers of cells were stimulated with PMA/ionomycin for 4 h, and luciferase activity was measured. Surprisingly, cells infected with GFP-pA-rLuc-RV-D retrovirus showed a high constitutive luciferase activity (Fig. 2GoB), which was not increased by PMA/ionomycin. In addition, the constitutive activation of the -586 IFN-{gamma} promoter was not Th1 specific, but was expressed highly in both Th1 and Th2 cells (Fig. 2GoB). Finally, the -59 IFN-{gamma} promoter construct (GFP-pA-rLuc-RV-H) was not active in either Th1 or Th2 cells (Fig. 2GoB), although it was inducible to the same level as the -586 construct in EL-4 cells (Fig. 1GoB).

The retroviral reporter described in Fig. 2Go allows purification of retrovirally infected cells on the basis of GFP expression, but requires lysis of these cells to determine the activity of integrated promoter constructs. To generate a second, more convenient retroviral-based reporter system that could allow analysis at the single-cell level by FACS, we modified the retroviral reporter system, generating hCD4-pA-GFP-RV (Fig. 3GoA). In this reporter system retroviral infection and purification are based on expression of the hCD4 extracellular and transmembrane domain lacking the cytoplasmic signaling domain. The activity of the test promoter within the reporter construct is determined from expression of GFP. Furthermore, because the -586 IFN-{gamma} promoter regions behaved with unexpected constitutive expression, we also included analysis of IL-2 and IL-4 promoter constructs in this new retroviral reporter system as a verification of its capacity to permit normal inducible promoter activation.

Empty vector, various IFN-{gamma}, IL-2, and IL-4 promoter regions placed into hCD4-pA-GFP-RV were used to generate infectious retrovirus as described previously (28) and were used to infect naive DO11.10 T cells activated under Th1- or Th2-inducing conditions. On day 7, retrovirally infected cells were purified by cell sorting on the basis of expression of hCD4 and murine CD4 and were re-expanded in culture for an additional 7 days. To verify that polarization of these populations had occurred as desired, T cells were stimulated on day 7 with PMA/ionomycin, and supernatants were examined by ELISA for IFN-{gamma} and IL-4 production (Fig. 3GoB). As expected, infection by these reporter constructs did not interfere with the cytokine-induced polarization of these cells, with all Th1-inducing conditions achieving high IFN-{gamma} and low IL-4 production and, similarly, all Th2-inducing conditions leading to high IL-4, but low IFN-{gamma} production (Fig. 3GoB).

Next we analyzed the reporter activities of these various promoter regions in the purified Th1 or Th2 populations (Fig. 3Go, C and D). Again, we analyzed two regions of the IFN-{gamma} promoter extending to -59 (H) or -586 (D) as well as a 2.1-kb region of the IL-2 promoter and an 800-bp IL-4 promoter region. In this novel reporter system, activity is measured by expression of GFP, and infection is monitored by expression of hCD4. In Th1 cells, the IL-2 promoter was highly inducible by PMA/ionomycin treatment (Fig. 3GoC, panels G and H), whereas the IL-4 promoter construct was not inducible (Fig. 3GoC, panels I and J). Furthermore, the empty vector hCD4-pA-GFP-RV was inactive in expressing GFP (Fig. 3GoC, panels A and B), as we expected. The -59 IFN-{gamma} promoter region was inactive, driving <2% GFP-positive cells (Fig. 3GoC, panels C and D), and consistent with the low luciferase activity observed previously in the luciferase-based retroviral reporter (Fig. 2GoB). Furthermore, the longer IFN-{gamma} promoter region extending to -586 bp was constitutively active, driving GFP expression in hCD4+ cells in both cells stimulated with PMA/ionomycin as well as cells left untreated (Fig. 3GoC, panels E and F).

Furthermore, the activity of this -596 IFN-{gamma} promoter region was equally active in cells driven toward the Th2 phenotype (Fig. 3GoD, panels E and F). As controls, we found that the IL-4-containing promoter construct was significantly more active in Th2 cells (Fig. 3GoD, panels I and J) than in Th1 cells (Fig. 3GoC, panels I and J), indicating that this reporter system can be sensitive to subset-specific regulation of cytokine promoters. These results confirm the observations of constitutive reporter activity in the luciferase-based retroviral vector.

The first intron of the gene is also thought to contain regulatory sequences (38). We have analyzed large reporter constructs that contain the proximal promoter, first exon and intron, and part of the second exon fused to GFP, requiring splicing to generate the mature GFP reporter. To date, such constructs do not generate inducible reporter activity, perhaps due to their size or the added complexity of their splicing requirements, but they have prevented analysis of intronic sequences arranged in the native configuration with the promoter (data not shown).

Constitutive IFN-{gamma} promoter activity in a transgenic reporter system

The constitutive activity seen here for the IFN-{gamma} promoter, but not other cytokine promoters, could be due to a selective activation of the IFN-{gamma} promoter by some component of the retroviral system. To test this possibility, we turned to the use of a transgenic reporter system (Fig. 4Go). A 3.4-kb region of the murine IFN-{gamma} promoter was used to drive a GFP reporter construct. In this construct, splicing and polyadenylation were provided by the SV40 intron and polyadenylation site, and T cell-specific expression was provided by inclusion of a downstream cassette containing the human CD2 locus control region (39) (Fig. 4GoA). This construct is similar to our previous IL-2 reporter construct used in a transgenic study (37), which exhibited inducible GFP expression upon activation of transgenic T cells, indicating that this construct is capable of providing for T cell-specific reporter expression with appropriately inducible, rather than constitutive, activity in the context of transgenic mice.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Transgenic IFN-{gamma} reporters show constitutive activity in naive, Th1, and Th2 cells. A, Map of the IFN-{gamma}P/GFP/CD2 transgene. B, Constitutive expression of the GFP reporter in DO11.10 x IFN-{gamma}P/GFP/CD2 double-transgenic mice. Spleen and lymph node CD4+ T cells isolated from Ag-naive DO11.10 IFN-{gamma}P/GFP or DO11.10 littermate control mice were stimulated with 10 µg/ml OVA peptide presented on RT11.B7-1 artificial APCs for 24 h and analyzed for expression of CD4 and GFP (Naive). Th1- and Th2-polarized cells were generated by culture for 7 days with irradiated BALB/c spleen-adherent cells and 10 µg/ml OVA peptide supplemented with 20 U/ml IL-12 and 10 µg/ml anti-IL-4 (Th1) or 1000 U/ml IL-4 and 10 µg/ml anti-IL-12 (Th2). T cells were recovered and restimulated for 18 h with 10 µg/ml OVA peptide presented on RT11.B7-1 fibroblasts and analyzed for expression of CD4 and GFP. The flow cytometric data are gated on lymphocytes, and the numbers in the upper right quadrants are percentages of CD4- and GFP-positive T cells. The data are from one of two similar experiments. Comparable results were obtained with three distinct IFN-{gamma}P/GFP/CD2 founder lines (data not shown). C, Lymph node cells isolated from DO11.10 IFN-{gamma}P/GFP mice were stained for murine CD4 and CD8 Abs. The CD4+, CD8+, and CD4/CD8-negative cells were gated and analyzed for GFP expression. The right panel is from the gated cells of the left panel. The number in the right panel is the percentage of GFP-positive cells.

 
Several transgenic lines were derived, propagated, and analyzed for reporter expression in T cells undergoing differentiation toward the Th1 or Th2 phenotype (Fig. 4GoB). First, GFP expression is absent in nontransgenic littermate controls, as expected (Fig. 4GoB, panels A and B). Interestingly, in the IFN-{gamma} reporter transgenic, we observed GFP expression in even naive T cells of transgenic mice, suggesting a relaxed requirement for reporter expression. Moreover, GFP expression in naive cells was observed even in the absence of Ag-induced activation (Fig. 4GoB, panel C) and was not significantly increased upon activation of these T cells with Ag (Fig. 4GoB, panel D). Furthermore, when these cells were differentiated toward the Th1 phenotype, no substantial increase in the level of GFP reporter expression was observed, which was seen both in stimulated (Fig. 4GoB, panel F) as well as unstimulated (Fig. 4GoB, panel E) cells. Finally, similar levels of reporter expression were observed even in T cells driven toward the Th2 phenotype, in which, once again, reporter expression was constitutive rather than inducible by Ag (Fig. 4GoB, panels G and H). Similar promoter behavior was seen in the other reporter lines as well. This constitutive and non-subset-specific expression of the IFN-{gamma} promoter contrasts with the inducible behavior of the IL-2 promoter expressed using the same cassette (37). Furthermore, this constitutive behavior is contrasted with a previous IL-4 promoter construct analyzed in transgenic mice, in which the IL-4 promoter driving luciferase demonstrated highly inducible activity, rather than constitutive activity (40). Finally, we asked whether the GFP expression is T cell specific. Lymph node cells were stained for CD4 and CD8 expression by FACS (Fig. 4GoC, left panel). Both CD4- and CD8-positive lymphocytes constitutively expressed GFP (Fig. 4GoC, right panel, R2 and R3), while CD4- and CD8-negative lymphocytes were GFP negative (Fig. 4GoC, right panel, R4). Similar results were found in splenocytes (data not shown). GFP expression was also negative in fibroblasts (data not shown).

Constitutive promoter activity resides in the distal IFN-{gamma} promoter element, and the AP-1/GM-CSF site is critical for the activity

Based on the similarity with the results in the transgenic reporter system, we considered that the observed constitutive activity of the IFN-{gamma} promoter regions in stable expression systems was not necessarily an artifact of the retroviral system. Therefore, we wished to identify the specific promoter regions responsible for this constitutive and non-subset-specific activity (Fig. 5Go). To this end, we generated a series of IFN-{gamma} promoter truncations using the hCD4-pA-GFP-RV retroviral reporter system (Fig. 3GoA). In the first series, four additional constructs of intermediate length between D (-586) and H (-59) were used to infect CD4+ T cells undergoing Th1 differentiation. Retrovirally infected T cells were left untreated or were treated with PMA/ionomycin and analyzed for expression of hCD4 (to identify retrovirally infected cells) and GFP as an indication of reporter activity. Once again, each truncation including -350, -247, -194, and -134 showed activity similar to that of the original IFN-{gamma} reporter construct (-586, D), which were all similar whether they were stimulated with PMA/ionomycin or left untreated.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 5. The distal IFN-{gamma} promoter element is required for constitutive activity. Human CD4-pA-GFP-RV retrovirus-infected Th1 cells were stimulated with PMA/ionomycin for 6 h, and the cells were stained with hCD4-PE. Numbers in the upper right quadrant represent the percentage of hCD4-positive/GFP-positive cells in the live cell gate.

 
Therefore, the constitutive activity appeared to reside between -59 and -134 of the IFN-{gamma} promoter. We tested an additional intermediate deletion, -80 (Fig. 5GoB). Here, truncation of the region between -134 and -80 led to a complete loss of both induced and uninduced reporter activities, similar to the -59 promoter construct (H). As before, the IL-2 promoter as a control retained inducible activity as expected (Fig. 5GoB, panel P). These results indicated that the constitutive activity of the IFN-{gamma} promoter constructs in these retroviral reporters was due to an ~50-bp region between -134 and -80 relative to the start site of transcription.

The region between -134 and -80 contains the previously described distal IFN-{gamma} promoter element (10). To confirm whether this region could interact with nuclear factors, we isolated nuclear extracts from Th1 and Th2 cells, either left untreated or treated with PMA/ionomycin, and conducted EMSA (Fig. 6Go). Consistent with the constitutive activity resulting from this region, we observed a constitutive complex in EMSA binding the region spanned by the MN3 probe (Fig. 6Go). This complex was present in both Th1 and Th2 cells and was slightly augmented upon treatment with PMA/ionomycin. An inducible band of relatively high mobility was seen.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 6. The distal promoter element binds similar factors in Th1 and Th2 cells. Nuclear extracts were prepared after Th1 and Th2 cells were stimulated with PMA/ionomycin for 3 h. EMSA was performed with the MN3 probe containing distal IFN-{gamma} promoter element probe or with the E{alpha} probe as a control for the quality and quantity of the extract.

 
The distal IFN-{gamma} promoter element contains three cis elements reported to bind Oct1, GATA, and AP-1/GM-CSF (10, 41). To test which of these cis elements is required for constitutive promoter activity, we generated several internal deletions affecting these sites. Deletion of Oct1 or GATA site did not significantly change the constitutive activity, while the deletion of AP-1/GM-CSF site significantly reduced the promoter activity (Fig. 7Go). Finally, the distal element in isolation did not contain constitutive activity (Fig. 7Go), implying that it requires cooperation with other downstream promoter elements. As a control, the -134 IFN-{gamma} promoter containing both proximal and distal elements was constitutively active, and the -80 IFN-{gamma} promoter, lacking the distal element, was inactive. By comparison, the IL-2 promoter was inducible by PMA and ionomycin, but did not show constitutive activity.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 7. The AP-1/GM-CSF binding site in the distal promoter element is critical for the constitutive activity. The internal deletion of cis elements was generated by the QuickChange PCR-based strategy using specific primers. Th1 cells were infected and stimulated with PMA/ionomycin as described in Fig. 3Go. The left panel is the diagram of the constructs, and the right panel represents the percentage of hCD4- and GFP-positive cells after stimulation with or without PMA/ionomycin.

 
CsA-resistant, Stat4- and p38 mitogen-activated protein kinase (MAPK)-independent activity of the IFN-{gamma} promoter

Because CsA inhibits TCR or PMA/ionomycin-induced IFN-{gamma} production, we asked whether it could inhibit the constitutive activity of the IFN-{gamma} promoter. Th1 cells were infected with different retrovirus constructs, sorted, and restimulated as described above. Some cells were incubated with CsA on day 5 after restimulation. On day 7, T cells were harvested and were either left untreated or were treated with PMA/ionomycin in the presence or the absence of CsA. The empty vector hCD4-pA-GFP-RV-infected T cells did not express GFP (Fig. 8GoA, panels A–D), as expected. As the positive control, IL-2 promoter was inducible (Fig. 8GoA, panels E and F), whereas the inducibility of the IL-2 promoter was inhibited by CsA (Fig. 8GoA, compare panels F and H). However, the constitutive activity of the IFN-{gamma} promoter was not inhibited by CsA (Fig. 8GoA, compare panels I and J with K and L).



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 8. Constitutive activity of IFN-{gamma} reporter activity is CsA resistant and Stat4- and p38 MAPK-independent. DO11.10 Th1 (A and C) or Stat4-/- Th1 (B) cells were infected with the indicated retrovirus reporter constructs and sorted for hCD4 and murine CD4 expression. On day 5 after restimulation, CsA or SB 203580 was added to the culture as indicated for another 2 days. On day 7, cells were harvested and stimulated with PMA/ionomycin or IL-12/IL-18 for 6 h in the presence or the absence of CsA or SB 203580 as indicated before staining for human CD4+ T cells or ELISA. Data in the upper right quadrants are percentages of hCD4- and GFP-positive cells (A and B). A, DO11.10 Th1 cells; B, Stat4-/- DO11.10 Th1 cells; C, DO11.10 Th1 cells: left panel, hCD4- and GFP-positive cells; right panel, IFN-{gamma} titers in the supernatants.

 
To address whether the observed activity of the IFN-{gamma} promoter was dependent upon Stat4 activation and regulated by the TCR signaling pathway, we tested the -134 IFN-{gamma} retroviral reporter construct in Stat4-deficient mice and in the absence or the presence of CsA (Fig. 8GoB). The -134 IFN-{gamma} reporter was unaffected by the absence of Stat4, because it was expressed at similar levels and in both the presence and the absence of PMA/ionomycin stimulation (Fig. 8GoB, panels I and J) compared with wild-type T cells (Fig. 8GoA). We also tested whether this constitutive activity was inhibited by CsA. As a positive control, we demonstrated that the IL-2 promoter activity was completely inhibited by CsA treatment (Fig. 8GoB, compare panels H and F). In contrast, the activity of the IFN-{gamma} construct was unaffected by CsA, both the constitutive activity (Fig. 8GoB, panel K) as well as activity after treatment with PMA/ionomycin (L).

IFN-{gamma} production can be induced by treatment with IL-12/IL-18 and inhibited by the p38 MAPK inhibitor SB 203580 (26, 42). We asked whether these same treatments could regulate the constitutive reporter activity. Th1 cells were infected with various reporters, sorted, and restimulated. For this, we measured both the reporter activity and the production of endogenous IFN-{gamma} as an internal control. Native IFN-{gamma} was strongly induced by PMA/ionomycin and was not inhibited by SB 203580 (Fig. 8GoC, compare lanes 3 and 4, 9 and 10, and 15 and 16, right panel). IFN-{gamma} was also induced by IL-12/IL-18, but this was completely inhibited by SB 203580 (Fig. 8Go C, compare lanes 5 and 6, 11 and 12, and 17 and 18, right panel). IL-12/IL-18 did not activate the IL-2 promoter. In contrast, the -134 IFN-{gamma} reporter was not augmented by IL-12/IL-18 and was not inhibited by SB 203580 (Fig. 8GoC, lanes 7–10, left panel). In summary, the activity of the IFN-{gamma} reporter shows constitutive activity that is unaffected by CsA, and independent of both Stat4 activation and p38 MAPK activation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent evidence suggested that IFN-{gamma} gene regulation can involve at least two distinct signaling pathways (26) and may involve different mechanisms in distinct lineages (24). First, although the TCR signaling pathway has long been considered the primary means of activating IFN-{gamma} production in T cells, more recently it was recognized that cytokine-driven IFN-{gamma} production could generate equal levels of IFN-{gamma} (26, 43). In particular, the simultaneous treatment of Th1 cells with IL-12 and IL-18 leads to IFN-{gamma} production of greater duration than that occurring with TCR signaling (26). A number of different transcription factors have been suggested to participate in IFN-{gamma} gene regulation (44). The inducible transcription factors NF-{kappa}B and NF-AT have been suggested to act at sites both within the IFN-{gamma} promoter as well as in intragenic regions. Conceivably, NF-AT could mediate the TCR-induced pathway leading to IFN-{gamma} production, because TCR-induced IFN-{gamma} is CsA sensitive (26). In contrast, distinct factors may mediate cytokine-induced IFN-{gamma} production, because this pathway is completely resistant to inhibition by CsA. The transcription factors mediating IL-12/IL-18-induced IFN-{gamma} have not been determined, but this pathway is sensitive to protein synthesis inhibition by cycloheximide, implying that Stat4 and NF-{kappa}B activation are not alone sufficient to induce transcription (26). Finally, the regulation of IFN-{gamma} appears to be different in distinct lineages, because CD8+ T cells show a Stat4-independent capacity to produce IFN-{gamma}, whereas CD4+ T cells require Stat4 activation to allow IFN-{gamma} production (24). In summary, there appear to be multiple components to IFN-{gamma} gene regulation acting in distinct lineages and through distinct pathways. At the present time, it is not clear which cis-acting elements defined in the IFN-{gamma} promoter mediate activity in various lineages or pathways.

Much of the description of the IFN-{gamma} promoter has been based upon transient transfections of reporter constructs in tumor lines (44). Also, the published analysis involving transgenic reporter constructs has used isolated multimerized elements of the IFN-{gamma} gene to derive activity of heterologous promoters (11). Because this analysis of elements in isolation may not reflect native promoter activity, we wished to analyze the IFN-{gamma} promoter in the context of normal nontransformed CD4+ T cells. Similar to our previous approach with transgenic reporter constructs involving the IL-2 promoter (37), we made transgenic lines driving a GFP promoter with a large region of the IFN-{gamma} promoter ~3.4 kb of 5' upstream regulatory sequence. To our surprise, and distinct from our observation of inducible IL-2 promoter activity in this system, we observed constitutive reporter activity using the IFN-{gamma} promoter. Furthermore, this constitutive activity was equally expressed in cells driven toward the Th1 and the Th2 subset, a feature unlike the native IFN-{gamma} gene.

Because of the time required for deriving transgenic lines, we sought to develop an alternate methodology for analyzing IFN-{gamma} promoter constructs in the context of nontransformed CD4+ T cells. To this end, we considered the possibility of generating reporter constructs based upon retroviral vectors. Because retroviral vectors are largely dependent upon the activity of a LTR to drive gene expression, we initially considered this approach unsuitable for promoter analysis. However, we found that it is possible to encode a promoter/reporter cassette on the lower strand of the retrovirus and that this arrangement allows for inducible and subset-specific promoter activity of IL-2 and IL-4 promoters. Thus, the IL-4 promoter in this system is inducible by PMA and ionomycin as expected, but also is expressed significantly more highly in Th2 cells relative to Th1 cells. This indicates that there is no general activation of the lower strand promoter in such a system caused by its proximity to the downstream LTR. However, it is possible that inadvertent promoter activation occurs for the IFN-{gamma} promoter, but not for the IL-2 and IL-4 promoters. However, this constitutive activity observed for the IFN-{gamma} promoter was also observed in a transgenic reporter construct in which no adjacent LTR was present. Therefore, we consider the finding of constitutive IFN-{gamma} promoter activity to be a valid experimental result despite its unexpected nature.

We were able to map the cis element responsible for this constitutive promoter activity to a region between -134 and -80 of the transcriptional start site. This region corresponds to the previously defined distal element (10) and binds factors present in both Th1 and Th2 cells, either with or without activation (Fig. 6Go). This result is consistent with previous reports showing that proximal and distal elements of the IFN-{gamma} promoter bind nuclear extracts from both Th1 and Th2 cells in a similar pattern (16, 45). Also, internal deletion of the AP-1/GM-CSF site significantly reduced the promoter activity (Fig. 7Go), consistent with a role for AP-1 as previously reported (10, 15). Furthermore, the activity conferred by this constitutive promoter element is insensitive to inhibition by CsA and is independent of Stat4 and p38 MAPK. Thus, the activity of the distal IFN-{gamma} promoter reported here does not reflect the transcriptional activity of the native IFN-{gamma} gene. Possibilities to reconcile this finding with the known inducibility of the IFN-{gamma} gene include mechanisms of repression of transcription that could involve distant cis-acting elements repressing the capacity of the promoter to initiate transcription or, alternately, causing early transcriptional attenuation of nascent transcripts. Although repressor activity within the IFN-{gamma} promoter has been described, with the factor YY1 interacting with several elements, we do not consider YY1 to be the mechanism responsible for the necessary inhibition, because several of the IFN-{gamma} reporter constructs showing constitutive activity have included sites for YY1 repressor.

Chromatin remodeling and DNA methylation may play important roles in IFN-{gamma} gene expression, and our current methods may not accurately reflect these aspects of regulation. Differences in hypersensitivity sites between Th1 and Th2 cells have been observed (46). An inducible DNase I-hypersensitive site 3' of the IL-4 gene binds GATA3, which acts as an enhancer for IL-4 gene expression (47). However, the role of chromatin remodeling in IFN-{gamma} expression is unclear. Furthermore, different methylation at IFN-{gamma} proximal element was found between Th1 and Th2 cells, but that difference did not lead to inducible promoter activity (45). In both retrovirus and transgenic systems, the retroviral or transgenic promoter reporters are randomly integrated into the chromatin. Thus, the locus of the integrated promoter might already be opened because of the LTR, possibly explaining the constitutive activity in both Th1 and Th2 cells. It is conceivable that the chromatin containing the native IFN-{gamma} promoter might be closed in resting Th1 and Th2 cells, and Th1-specific chromatin remodeling of the IFN-{gamma} locus allows for regulated IFN-{gamma} expression.

Finally, this study shows that the 3.4-kb IFN-{gamma} promoter region is constitutively active in primary T cells using both a transgenic reporter system as well as a novel retroviral reporter system, suggesting that IFN-{gamma} promoter activity from transformed cells should be reconsidered. Our results suggest that IFN-{gamma} promoter regulation may require cis elements residing either downstream or >3.4 kb upstream of the transcriptional start that repress constitutive activity. This study introduces a novel retroviral reporter system that can provide reporter analysis in primary T cells, which should prove generally useful for understanding IFN-{gamma} as well as other cytokine regulation.


    Acknowledgments
 
We thank Dominic Fenoglio for help with cell sorting and Kathy Fredrick for animal husbandry.


    Footnotes
 
1 This work was supported by grants from the National Institutes of Health and the Juvenile Diabetes Foundation. K.M.M. is an Associate Investigator with the Howard Hughes Medical Institute. Back

2 H.Z. and J.Y. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Kenneth M. Murphy, Department of Pathology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. E-mail address: murphy{at}immunology.wustl.edu Back

4 Abbreviations used in this paper: CsA, cyclosporin A; hCD4, human CD4; GFP, green fluorescence protein; LTR, long terminal repeat; MAPK, mitogen-activated protein kinase. Back

Received for publication July 6, 2000. Accepted for publication May 10, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bach, E. A., M. Aguet, R. D. Schreiber. 1997. The IFN{gamma} receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15:563.[Medline]
  2. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, J. Vilcek, R. M. Zinkernagel, M. Aguet. 1993. Immune response in mice that lack the interferon-{gamma} receptor. Science 259:1742.[Abstract/Free Full Text]
  3. Swihart, K., U. Fruth, N. Messmer, K. Hug, R. Behin, S. Huang, G. Del, M. Aguet, J. A. Louis. 1995. Mice from a genetically resistant background lacking the interferon {gamma} receptor are susceptible to infection with Leishmania major but mount a polarized T helper cell 1-type CD4+ T cell response. J. Exp. Med. 181:961.[Abstract/Free Full Text]
  4. Dalton, D. K., S. Pitts-Meek, S. Keshav, I. S. Figari, A. Bradley, T. A. Stewart. 1993. Multiple defects of immune cell function in mice with disrupted interferon-{gamma} genes. Science 259:1739.[Abstract/Free Full Text]
  5. Cooper, A. M., D. K. Dalton, T. A. Stewart, J. P. Griffin, D. G. Russell, I. M. Orme. 1993. Disseminated tuberculosis in interferon {gamma} gene-disrupted mice. J. Exp. Med. 178:2243.[Abstract/Free Full Text]
  6. Flynn, J. L., J. Chan, K. J. Triebold, D. K. Dalton, T. A. Stewart, B. R. Bloom. 1993. An essential role for interferon {gamma} in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249.[Abstract/Free Full Text]
  7. Young, H. A., J. F. Dray, W. L. Farrar. 1986. Expression of transfected human interferon-{gamma} DNA: evidence for cell-specific regulation. J. Immunol. 136:4700.[Abstract]
  8. Young, H. A., K. L. Komschlies, V. Ciccarone, M. Beckwith, M. Rosenberg, N. A. Jenkins, N. G. Copeland, S. K. Durum. 1989. Expression of human IFN-{gamma} genomic DNA in transgenic mice. J. Immunol. 143:2389.[Abstract]
  9. Ciccarone, V. C., J. Chrivia, K. J. Hardy, H. A. Young. 1990. Identification of enhancer-like elements in human IFN-{gamma} genomic DNA. J. Immunol. 144:725.[Abstract]
  10. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, C. B. Wilson. 1993. Two essential regulatory elements in the human interferon {gamma} promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.[Abstract/Free Full Text]
  11. Aune, T. M., R. A. Flavell. 1997. Differential expression of transcription directed by a discrete NF-AT binding element from the IL-4 promoter in naive and effector CD4 T cells. J. Immunol. 159:36.[Abstract]
  12. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NF-{kappa}B and NF-AT with the interferon-{gamma} promoter. J. Biol. Chem. 272:30412.[Abstract/Free Full Text]
  13. Penix, L. A., M. T. Sweetser, W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, C. B. Wilson. 1996. The proximal regulatory element of the interferon-{gamma} promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.[Abstract/Free Full Text]
  14. Sweetser, M. T., T. Hoey, Y. L. Sun, W. M. Weaver, G. A. Price, C. B. Wilson. 1998. The roles of nuclear factor of activated T cells and ying-yang 1 in activation-induced expression of the interferon-{gamma} promoter in T cells. J. Biol. Chem. 273:34775.[Abstract/Free Full Text]
  15. Cippitelli, M., A. Sica, V. Viggiano, J. Ye, P. Ghosh, M. J. Birrer, H. A. Young. 1995. Negative transcriptional regulation of the interferon-{gamma} promoter by glucocorticoids and dominant negative mutants of c-Jun. J. Biol. Chem. 270:12548.[Abstract/Free Full Text]
  16. Zhang, F., D. Z. Wang, M. Boothby, L. Penix, R. A. Flavell, T. M. Aune, and T. M. 1998. Regulation of the activity of IFN-{gamma} promoter elements during Th cell differentiation. J. Immunol. 161:6105.
  17. Chrivia, J. C., T. Wedrychowicz, H. A. Young, K. J. Hardy. 1990. A model of human cytokine regulation based on transfection of {gamma} interferon gene fragments directly into isolated peripheral blood T lymphocytes. J. Exp. Med. 172:661.[Abstract/Free Full Text]
  18. Ye, J., M. Cippitelli, L. Dorman, J. R. Ortaldo, H. A. Young. 1996. The nuclear factor YY1 suppresses the human {gamma} interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol. Cell. Biol. 16:4744.[Abstract]
  19. Ye, J., H. A. Young. 1997. Negative regulation of cytokine gene transcription. FASEB J. 11:825.[Abstract]
  20. Jacobson, N. G., S. J. Szabo, R.M. Weber-Nordt, Z. Zhong, R. D. Schreiber, Jr J. E. Darnell, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  21. Thierfelder, W. E., J.M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, et al 1996. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  22. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  23. Xu, X., Y. L. Sun, T. Hoey. 1996. Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain. Science 273:794.[Abstract]
  24. Carter, L. L., K. M. Murphy. 1999. Lineage-specific requirement for signal transducer and activator of transcription (Stat)4 in interferon {gamma} production from CD4+ versus CD8+ T cells. J. Exp. Med. 189:1355.[Abstract/Free Full Text]
  25. Szabo, S. J., S. T. Kim, G. L. Costa, X. K. Zhang, C. G. Fathman, L.H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655.[Medline]
  26. Yang, J., T. L. Murphy, W. Ouyang, K. M. Murphy. 1999. Induction of interferon-{gamma} production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29:548.[Medline]
  27. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  28. Ouyang, W., S. H. Ranganath, K. Weindel, D. Bhattacharya, T. L. Murphy, W. C. Sha, K. M. Murphy. 1998. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity 9:745.[Medline]
  29. Ohara, J., W. E. Paul. 1985. Production of a monoclonal antibody to and molecular characterization of B-cell stimulatory factor-1. Nature 315:333.[Medline]
  30. Tripp, C. S., M. K. Gately, J. Hakimi, P. Ling, E. R. Unanue. 1994. Neutralization of IL-12 decreases resistance to Listeria in SCID and C.B-17 mice: reversal by IFN-{gamma}. J. Immunol. 152:1883.[Abstract]
  31. Fox, H. S., B. L. Bond, T. G. Parslow. 1991. Estrogen regulates the IFN-{gamma} promoter. J. Immunol. 146:4362.[Abstract]
  32. Ranganath, S., W. Ouyang, D. Bhattarcharya, W. C. Sha, A. Grupe, G. Peltz, K. M. Murphy. 1998. GATA-3-dependent enhancer activity in IL-4 gene regulation. J. Immunol. 161:3822.[Abstract/Free Full Text]
  33. Farrar, J. D., J. D. Smith, T. L. Murphy, K. M. Murphy. 2000. Recruitment of Stat4 to the human interferon-{alpha}/{beta} receptor requires activated Stat2. J. Biol. Chem. 275:2693.[Abstract/Free Full Text]
  34. Szabo, S. J., J. S. Gold, T. L. Murphy, K. M. Murphy. 1993. Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc. [Published erratum appears in 1993 Mol. Cell. Biol. 13:5928.]. Mol. Cell Biol. 13:4793.[Abstract/Free Full Text]
  35. Ouyang, W., M. Lohning, Z. Gao, M. Assenmacher, S. Ranganath, A. Radbruch, K. M. Murphy. 2000. Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity 12:27.[Medline]
  36. Hsieh, C. S., S. E. Macatonia, A. O’Garra, K. M. Murphy. 1993. Pathogen-induced Th1 phenotype development in CD4+ {alpha}{beta}-TCR transgenic T cells is macrophage dependent. Int. Immunol. 5:371.[Abstract/Free Full Text]
  37. Saporov, A., F. H. Wagner, R. Zheng, J. R. Oliver, H. Maeda, R. D. Hockett, C. T. Weaver. 1999. Interleukin-2 expression by a subpopulation of primary T cells is linked to enhanced memory/effector function. Immunity 11:271.[Medline]
  38. Hardy, K. J., B. M. Peterlin, R. E. Atchison, J. D. Stobo. 1985. Regulation of expression of the human interferon {gamma} gene. Proc. Natl. Acad. Sci. USA 82:8173.[Abstract/Free Full Text]
  39. Greaves, D. R., F. D. Wilson, G. Lang, D. Kioussis. 1989. Human CD2 3'-flanking sequences confer high-level, T cell-specific, position-independent gene expression in transgenic mice. Cell 56:979.[Medline]
  40. Wenner, C. A., S. J. Szabo, K. M. Murphy. 1997. Identification of IL-4 promoter elements conferring Th2-restricted expression during T helper cell subset development. J. Immunol. 158:765.[Abstract]
  41. Aune, T. M., L. A. Penix, M. R. Rincon, R. A. Flavell. 1997. Differential transcription directed by discrete gamma interferon promoter elements in naive and memory (effector) CD4 T cells and CD8 T cells. Mol. Cell. Biol. 17:199.[Abstract]
  42. Yang, J., H. Zhu, T. L. Murphy, W. Ouyang, K. M. Murphy. 2001. IL-18-stimulated GADD45 beta required in cytokine-induced, but not TCR-induced, IFN-{gamma} production. Nat. Immunol. 2:157.[Medline]
  43. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, et al 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF{kappa}B. Immunity 7:571.[Medline]
  44. Murphy, K. M., W. Ouyang, J. D. Farrar, J. Yang, S. Ranganath, H. Asnagli, M. Afkarian, T. L. Murphy. 2000. Signaling and transcription in T helper development. Annu. Rev. Immunol. 18:451.[Medline]
  45. Young, H. A., P. Ghosh, J. Ye, J. Lederer, A. Lichtman, Jr G. L. Penix, C. B. Wilson, A. J. Melvin, M. E. McGurn. 1994. Differentiation of the T helper phenotypes by analysis of the methylation state of the IFN-{gamma} gene. J. Immunol. 153:3603.[Abstract]
  46. Agarwal, S., A. Rao. 1998. Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9:765.[Medline]
  47. Agarwal, S., O. Avni, A. Rao. 2000. Cell-type-restricted binding of the transcription factor NF-AT to a distal IL-4 enhancer in vivo. Immunity 12:643.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
B. Samten, J. C. Townsend, S. E. Weis, A. Bhoumik, P. Klucar, H. Shams, and P. F. Barnes
CREB, ATF, and AP-1 Transcription Factors Regulate IFN-{gamma} Secretion by Human T Cells in Response to Mycobacterial Antigen
J. Immunol., August 1, 2008; 181(3): 2056 - 2064.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. K. Hamalainen-Laanaya, J. J. Kobie, C. Chang, and W.-p. Zeng
Temporal and Spatial Changes of Histone 3 K4 Dimethylation at the IFN-{gamma} Gene during Th1 and Th2 Cell Differentiation
J. Immunol., November 15, 2007; 179(10): 6410 - 6415.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Gutierrez, T. Nikolic, T. B. van Dijk, H. Hammad, N. Vos, M. Willart, F. Grosveld, S. Philipsen, and B. N. Lambrecht
Gata1 regulates dendritic-cell development and survival
Blood, September 15, 2007; 110(6): 1933 - 1941.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Cham and T. F. Gajewski
Glucose Availability Regulates IFN-{gamma} Production and p70S6 Kinase Activation in CD8+ Effector T Cells
J. Immunol., April 15, 2005; 174(8): 4670 - 4677.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. H. Bream, D. L. Hodge, R. Gonsky, R. Spolski, W. J. Leonard, S. Krebs, S. Targan, A. Morinobu, J. J. O'Shea, and H. A. Young
A Distal Region in the Interferon-{gamma} Gene Is a Site of Epigenetic Remodeling and Transcriptional Regulation by Interleukin-2
J. Biol. Chem., September 24, 2004; 279(39): 41249 - 41257.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Shnyreva, W. M. Weaver, M. Blanchette, S. L. Taylor, M. Tompa, D. R. Fitzpatrick, and C. B. Wilson
Evolutionarily conserved sequence elements that positively regulate IFN-{gamma} expression in T cells
PNAS, August 24, 2004; 101(34): 12622 - 12627.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Cunard, Y. Eto, J. T. Muljadi, C. K. Glass, C. J. Kelly, and M. Ricote
Repression of IFN-{gamma} Expression by Peroxisome Proliferator-Activated Receptor {gamma}
J. Immunol., June 15, 2004; 172(12): 7530 - 7536.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
J. Y. Cho, V. Grigura, T. L. Murphy, and K. Murphy
Identification of cooperative monomeric Brachyury sites conferring T-bet responsiveness to the proximal IFN-{gamma} promoter
Int. Immunol., October 1, 2003; 15(10): 1149 - 1160.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Asnagli, M. Afkarian, and K. M. Murphy
Identification of an Alternative GATA-3 Promoter Directing Tissue-Specific Gene Expression in Mouse and Human
J. Immunol., May 1, 2002; 168(9): 4268 - 4271.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Kurata, H.-J. Lee, T. McClanahan, R. L. Coffman, A. O'Garra, and N. Arai
Friend of GATA Is Expressed in Naive Th Cells and Functions As a Repressor of GATA-3-Mediated Th2 Cell Development
J. Immunol., May 1, 2002; 168(9): 4538 - 4545.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, H.
Right arrow Articles by Murphy, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, H.
Right arrow Articles by Murphy, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS