The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Messaoudi, I.
Right arrow Articles by Nikolich-Zugich, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Messaoudi, I.
Right arrow Articles by Nikolich-Zugich, J.
The Journal of Immunology, 2001, 167: 836-843.
Copyright © 2001 by The American Association of Immunologists

Functional Evidence That Conserved TCR CDR{alpha}3 Loop Docking Governs the Cross-Recognition of Closely Related Peptide:Class I Complexes1

Ilhem Messaoudi*,{dagger}, Joel LeMaoult*, Beatrix M. Metzner*, Michael J. Miley{ddagger}, Daved H. Fremont{ddagger} and Janko Nikolich-Zugich2,*,{dagger}

* Immunology Program, Memorial Sloan-Kettering Cancer Center, New York, NY 10021; {dagger} Weill Graduate School of Medical Sciences, Cornell University, New York, NY 10021; and {ddagger} Department of Pathology, School of Medicine, Washington University, St. Louis, MO 63130


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The TCR recognizes its peptide:MHC (pMHC) ligand by assuming a diagonal orientation relative to the MHC helices, but it is unclear whether and to what degree individual TCRs exhibit docking variations when contacting similar pMHC complexes. We analyzed monospecific and cross-reactive recognition by diverse TCRs of an immunodominant HVH-1 glycoprotein B epitope (HSV-8p) bound to two closely related MHC class I molecules, H-2Kb and H-2Kbm8. Previous studies indicated that the pMHC portion likely to vary in conformation between the two complexes resided at the N-terminal part of the complex, adjacent to peptide residues 2–4 and the neighboring MHC side chains. We found that CTL clones sharing TCR {beta}-chains exhibited disparate recognition patterns, whereas those with drastically different TCR{beta}-chains but sharing identical TCR{alpha} CDR3 loops displayed identical functional specificity. This suggested that the CDR{alpha}3 loop determines the TCR specificity in our model, the conclusion supported by modeling of the TCR over the actual HSV-8:Kb crystal structure. Importantly, these results indicate a remarkable conservation in CDR{alpha}3 positioning, and, therefore, in docking of diverse TCR{alpha}{beta} heterodimers onto variant peptide:class I complexes, implying a high degree of determinism in thymic selection and T cell activation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
T cell receptors recognize peptide:MHC (pMHC)3 complexes by assuming a diagonal orientation with regard to the MHC helices, with V{beta} covering the C terminus and the V{alpha} covering the N terminus of the peptide (reviewed in Refs. 1, 2, 3). In this manner, the TCR avoids the two high points at the N termini of the MHC {alpha} helices, descending between them to sense the peptide. Functional data strongly suggest that the TCR evolved to recognize MHC molecules (4, 5, 6). However, within the above general docking orientation, variations in the angle between the peptide long axis and the TCR ranging between 45 and 80 degrees were observed (7, 8). At present, it is not known whether a single TCR molecule can recognize similar pMHC complexes with different docking strategies.

Specific recognition of a pMHC complex by some, but not other, TCRs and the consequent activation of only a small subset of available T cells lies at the heart of adaptive immunity. This specificity stands in contrast to the results of numerous studies documenting promiscuous cross-recognition of different pMHC complexes by individual TCRs, including recognition of different peptides bound to the same MHC molecule, of the same peptide presented by different MHC molecules and even of fully disparate pMHC complexes (9, 10, 11, 12, 13, 14). Moreover, TCR recognition of altered peptide ligands (APLs) is a form of cross-reactivity: to recognize APLs, TCRs make adjustments in their pMHC contacts, resulting in activation, partial activation, or antagonism (reviewed in Ref. 15). These and other observations suggest that a high level of TCR cross-reactivity is an inherent and essential characteristic of TCR recognition (reviewed in Ref. 16).

In accord with this view, TCR cross-reactivity lies at the heart of a number of important immunological phenomena. From their ontogenetic outset, TCRs are selected for cross-recognition during positive intrathymic selection, when the TCR must interact with self-pMHC complexes with low, but sufficient, avidity to be positively selected. This self-complex is different from the antigenic complex that the selected TCR will recognize in the periphery (reviewed in Ref. 17), meaning that every TCR is selected to respond (albeit in different ways) to at least two different complexes during its lifetime. Moreover, cross-reactivity was implicated in the onset and propagation of autoimmune disorders (18, 19, 20), in enhancing anti-viral memory (21), and in maintaining naive T cells by persistent, low-intensity contact with pMHC complexes (reviewed in Ref. 22). Finally, it is clear that alloreactivity is the result of cross-reactive recognition by self MHC-restricted T cells and not a function of a distinct, specialized population of T cells (23, 24).

Crystal structures of TCRs engaged with their MHC class I:peptide complexes provided an insight into the potential nature of TCR cross-recognition. Although the TCR makes extensive contacts with MHC, it only interacts with a few key amino acids of the bound peptide (reviewed in Refs. 1, 2 , and 25). Consequently, approximately two-thirds of the TCR:pMHC binding energy is attributable to the TCR:MHC contacts (reviewed in Ref. 26). Those peptides that contribute a sufficient number of favorable contacts with the TCR will enable optimal off-rates and the consequent productive signaling. Therefore, the peptide essentially and critically modulates the kinetics of interaction between the TCR and its MHC ligand, establishing the threshold for T cell activation. As multiple peptides have the potential to initiate T cell activation, a built-in degeneracy exists in TCR recognition. However, neither the exact extent of degeneracy of TCR recognition nor the molecular mechanisms that allow one TCR and not another to cross-recognize specific ligands are presently understood.

Here, we identify the TCR elements that allow TCR cross-recognition of an immunodominant Herpesvirus hominis 1 (HVH-1, HSV-1) gB495–502 peptide, HSV-8p, bound to two closely related MHC class I molecules, H-2Kb and H-2Kbm8. We show that cross-reactivity in this model is mediated by TCRs bearing specific CDR{alpha}3 sequences. Superimposition of the TCR model over the recently solved HSV-8p:Kb structure shows that the CDR{alpha}3 would sit directly atop the parts of the complex likely to vary between Kb and Kbm8. Together, these results suggest a remarkable conservation in CDR{alpha}3 positioning, and, therefore, in docking of the diverse {alpha}{beta}TCR onto closely related pMHC complexes.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

C57BL/6 (B6) (National Cancer Institute, Frederick, MD) and B6.C-H-2bm8 (bm8) mice (the Memorial Sloan-Kettering Cancer Center vivarium, from the stock of The Jackson Laboratory (Bar Harbor, ME), via Dr. J. Sprent, The Scripps Research Institute, La Jolla, CA) were used at 8–12 wk of age.

HSV-8p-specific CTL lines and clones and proliferation assay

Mice were immunized in the footpad with a complex of HSV-8 peptide (HVH-1 gB495–502, SSIEFARL, Research Genetics, Huntsville, AL) and TiterMax (CytRx, Norcross, GA) emulsion or i.p. with 107 PFU of HVH-1 virus strain 17, as previously described (27). Seven days later, splenocytes from immunized mice were cocultured with irradiated, HSV-8p-coated syngeneic splenocytes and peptide-specific CTL activity determined in a standard 51Cr assay 5 days later. For the proliferation assay, 104 CTLs were incubated with 4 x 105 irradiated B6 or bm8 splenocytes untreated or coated with 10 nM HSV-8p. After 72 h, cultures were pulsed for 8 h with [3H]TdR, and radioactivity was determined by scintillation counting (Top Count; Packard Instruments, Downers Grove, IL). The CTL lines and clones were maintained in vitro by weekly restimulations in the presence of IL-2-rich ConA supernatant. Cloning was performed by limiting dilution from tertiary in vitro cultures.

Flow cytofluorometry (FCM) analysis

On day 5 of tertiary cultures, B6 and bm8 CTL bulk lines were costained with PE-conjugated anti-CD8 mAb (Caltag Laboratories, South San Francisco, CA) and the available panel of FITC-conjugated anti V{beta} and V{alpha} mAbs (BD PharMingen, San Diego, CA). A total of 104 cells/sample were analyzed on a FACScan instrument with CellQuest 3.1 software (BD Biosciences, Mountain View, CA), with dead cells excluded by selective gating.

RNA extraction, cDNA synthesis, and PCR

Cytoplasmic RNA was extracted from 1–3 x 106 CTLs with the RNAisolator kit (Genosys, The Woodlands, TX) and cDNA synthesized (Avian MLV reverse transcriptase, Life Technologies, Gaithersburg, MD; and oligo(dT)15 as a primer). PCR amplification was conducted on 1 µl of cDNA with a consensus C{alpha}2 (GTC TCA GGA CAG CAC CCT TC) reverse primer, and the following V{alpha}-specific sense primers: AV1, CTCTCTCAACTGCACTT; AV2, CAGCAGGAGAAACGTGACCAG; AV3, GCTGAGATGCAACTATTCCTA; AV4-A, TAATAAAYTGCACKTATTCARCC; AV4-B, CGATACACTGCAACTACTCAG; AV4-C, CTGTGAACTGTTCCTATGAA; AV5, ACCTACACAGACGTAACAGTT; AV6, TTGTAGCCACGCCACAATCAG; AV8; GCACCTATCAGACTACTTACT; AV9, GGAGCCTCYCTGGAGCTC; AV10, CAGGAGGGGGAGAACGCAGA; AV11, GGAACCAGTTCTGCTCTGAG; AV12, CTGCAGCCATACAAACATTGC; AV13, TATGAGAACAGTGCCTCCAAC; AV14, TGCGTCCTTCAATGTAATTACAG; AV15, GAGAAGGTCGAGCAACACGAG; AV17, ACGGTGACAATGGACTGTGTG; AV18, TAGTTACAMGACATCCATAACTG; AV19, GGAACCTTTGCTCGGGTC; AV20, GGATATTGATCCTGAATTGTG; AC1, GTCTCAGGACAGCACCCTCT; and AC0.9, GGAGTCAAAGTCGGTGAACAG. Tcr-b primers were as in Ref. 28 . PCR amplification conditions were described previously (29).

Sequencing

TCR {beta} and {alpha} PCR products were purified with the QIAquick PCR purification kit (Qiagen, Valencia, CA). They then were directly sequenced with the internal primers C{beta}2 (GCT CAG CTC CAC GTG GTC AGG GA) or C{alpha}1 (GGA GTC AAA GTC GGT GAA CAG) and the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer, Foster City, CA) using the ABI Prism 377 DNA sequencer (PerkinElmer).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Cross-reactive and monospecific TCR recognition of HSV-8p:Kb and HSV-8p:Kbm8 complexes

The coisogenic mouse strains C57BL/B6 (B6) and B6.C.H-2Kbm8 (bm8) express the H-2K MHC class I locus allelic variants Kb and Kbm8. Kbm8 differs from Kb at four amino acids (Y22->F, M23->I, E24->S, and D30->N), confined to the floor of the peptide binding site (30, 31). None of these residues are positioned to contact the TCR directly and are known to affect TCR recognition indirectly, by altering peptide binding and conformation (32, 33, 34). Both B6 and bm8 mice mount a vigorous and comparable CTL response against the immunodominant HVH-1 epitope HSV-8p (Fig. 1Go and Ref. 34). However, the fine specificity of the B6- and bm8-derived CTLs was different. B6-derived CTLs recognized HSV-8p on Kb, but not on Kbm8 (Fig. 1Go, A and B and Refs. 34 and 35), indicating that the B6-derived HSV-8p-specific CTLs are monospecific. By contrast, the bm8-derived CTLs readily recognized both HSV-8p:Kbm8 and HSV-8p:Kb (Fig. 1Go, A and B and 35). Therefore, consistent with other reports (32, 34, 36), TCR could detect changes in the TCR-accessible surface of the pMHC complex caused by the change in TCR-inaccessible parts of the MHC. These differences are analogous to observed changes in the MHC as a consequence of peptide variation (31, 37).



View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 1. Recognition of HSV-8p:Kb and HSV-8p:Kbm8 by B6 and bm8 CTLs. Mice were immunized with HSV-8p in adjuvant (TiterMax) and the CTL response tested by 51Cr-release assay after three in vitro stimulations, as described in Materials and Methods. Results obtained after a single in vitro restimulation were qualitatively similar, except that the higher E:T ratios were needed to obtain maximal lysis. In all assays, Kb- and Kbm8-expressing targets were coated with 10 nM HSV-8p. A, B6 and bm8 response against HSV-8p:Kb targets. B, B6 and bm8 response against HSV-8p:Kbm8. C, B6 and bm8 recognition of HSV-8p-coated (Kb x Kbm8) F1 targets shows no evidence of APL-type recognition. Results are shown as averaged 51Cr release data from 5 B6 and bm8 lines, representative of >25 independent CTL lines. Background lysis values obtained with peptide-negative targets (<7% lysis) were subtracted. Superimposable results were obtained by priming with HVH-1.

 
These differences were not caused by differential peptide binding, because HSV-8p bound to both molecules with indistinguishable kinetics (34) and the two CTL populations exhibited the same lysis pattern at a variety of peptide concentrations. For example, B6 CTLs recognized Kb targets coated with a range of concentrations of HSV-8p from 10-4 to 10-14 M, but could not recognize Kbm8 targets under the same concentration range. Likewise, with the same concentration range, we found that cross-reactivity and monospecificity of certain bm8 CTLs were equally absolute; in other words, we saw no quantitative peptide effects where a CTL that was cross-reactive would become monospecific at a certain peptide concentration. These results decisively argue against differences in functional pMHC stability (Ref. 35 and data not shown). Moreover, differential recognition was not attributable to the APL type of recognition, in which one of the ligands (HSV-8p:Kbm8) would invoke a partial agonistic or antagonistic B6 response. This was ruled out because B6 CTLs lysed HSV-8p-coated (Kb x Kbm8)F1 target cells as vigorously as those expressing HSV-8p:Kb only (Fig. 1GoC). Therefore, B6 CTLs were not inhibited by the presence of the HSV-8p:Kbm8 complexes.

Two subsets of bm8 HSV-8p-specific CTLs

Specific lysis of HSV-8p:Kb-expressing targets by the bm8 CTLs was consistently lower (by 10- 25%) than that of HSV-8p:Kbm8 targets at all E:T and peptide titration ratios tested. Lower levels of lysis of HSV-8p:Kb-bearing targets by bm8 CTLs (Fig. 1Go) suggested that bm8 CTLs either exhibit lower affinity for HSV-8p:Kb than for HSV-8p:Kbm8 or that some bm8 CTLs fail to recognize the HSV-8p:Kb complex (i.e., are monospecific for HSV-8p:Kbm8). To distinguish between these alternatives, we carried out "cold" target inhibition assay. In this assay, CTL are mixed with the cognate, "hot" 51Cr-labeled targets, known to be specifically lysed by the CTLs, and the unlabeled, cold competitor targets are added to test the TCR specificity. In such an assay (Fig. 2Go) lysis of 51Cr-labeled HSV-8p:Kb targets by B6 CTLs was gradually inhibited by unlabeled (cold) HSV-8p:Kb targets up to a near complete inhibition (~92%; Fig. 2GoA, squares). By contrast, lysis of labeled HSV-8p:Kbm8 targets by bm8 CTLs was inhibited by cold HSV-8p:Kb targets only by 61% (maximal inhibition at a cold:hot ratio of 20:1; Fig. 2GoA, circles). This suggested that only a fraction of the bm8 CTLs were cross-reactive to HSV-8p:Kb, with the remaining CTLs being monospecific for HSV-8p:Kbm8. Control experiments showed that the bm8 CTL response was fully inhibited in the presence of cold HSV-8p:Kbm8 and that cold HSV-8p:Kbm8 targets could not decrease HSV-8p:Kb target lysis by B6 CTLs at any ratio tested (Fig. 2GoB), as expected from Fig. 1Go. Analysis of HSV-8p-specific CTL clones confirmed and extended the above results. Three groups of clones were observed: all B6 derived clones were Kb-restricted, approximately one-third (34/95) of analyzed bm8 clones were Kbm8-restricted, and two-thirds (61/95) were cross-reactive (Ref. 35 , Tables IGo and IIGo, and data not shown). The specificity of each clone was established by 51Cr release (Fig. 3GoA), proliferation (Fig. 3GoB), and intracellular IFN-{gamma} expression (not shown), with the full concordance between all three tests. These results, along with those from Fig. 1Go, demonstrate that the TCR specificity in this model is absolute and further rule out the APL-type recognition as an explanation for the observed reactivity.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 2. Cold-target inhibition testing of HSV-8-specific CTL line specificities. A, B6 ({blacksquare}) or bm8 (•) CTLs were incubated at a constant E:T ratio with 51Cr-labeled HSV-8p:Kb or HSV-8p:Kbm8-expressing targets, respectively. At the beginning of the 51Cr release assay, unlabeled cold HSV-8:Kb expressing targets were added at the indicated ratios to the labeled targets and kept for the duration of the assay. B, B6 or bm8 CTLs were assayed as described above, but in the presence of cold HSV-8p:Kbm8 expressing targets.

 

View this table:
[in this window]
[in a new window]
  		Table I. CTL clones that use the same {beta}-chain display different specificities1

 

View this table:
[in this window]
[in a new window]
  		Table II. CTL clones using different {beta}-chain but the same {alpha}-chain display the same specificity1

 


View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 3. Functional reactivity of HSV-8p-specific CTL clones derived from B6 and bm8p. A, CTL clones were tested as in Fig. 1Go. B, Proliferative capacity of HSV-8p specific B6- and bm8-derived CTL clones tested in A. Proliferation was monitored by [3H]TdR incorporation, as described in Materials and Methods. Results are expressed as mean ± SD (n = 3). {square}, HSV-8p:Kb reactivity; {blacksquare}, HSV-8p:Kbm8 reactivity.

 
The bm8 CTL repertoire against HSV-8 is more diverse than that of B6 mice

To examine the TCR structural elements that allow bm8-derived CTLs to be cross-reactive, we compared by FCM the V{beta} and V{alpha} usage of B6 and bm8 CTLs. We found that bm8 mice mobilized a more diverse CTL repertoire in response to HSV-8p than B6. As reported (38), the B6 response exhibited a dominant V{beta}10 and a subdominant V{beta}8 usage (Fig. 4Go). By contrast, the bm8 response showed no such dominance: in addition to V{beta}8 and -10, it used V{beta}4, -5, -9, and -13 (Fig. 4Go) and, less often, of other families (Ref. 35 and data not shown). Even more strikingly, nearly 70% of the B6-derived CTLs used V{alpha}2, as compared with ~20% in bm8 CTLs (Fig. 4Go). Therefore, the HSV-8p-specific bm8 CTL repertoire diversification occurred at both the V{alpha} and V{beta} usage levels. We hypothesized that the increase in functional diversity (the appearance of cross-reactive TCRs) in the HSV-8-specific bm8 repertoire reflected the recruitment of TCRs not present in the B6 repertoire, some or all of which could be responsible for cross-recognition.



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 4. The CTL repertoire of bm8 derived, HSV-8p specific CTLs is more diverse than that of B6 CTLs. B6 and bm8 CTL line V{beta} usage was determined after the tertiary in vitro restimulation by costaining with anti-CD8 and a panel of V-specific mAbs. For the TCR {alpha} analysis, only V{alpha}2 staining is shown, as no detectable staining was obtained with the anti-V{alpha}3.1, V{alpha}3.2, V{alpha}8, or V{alpha}11 mAbs. Results are represented as mean ± SD (individual mouse, n = 6).

 
Decisive involvement of the TCR{alpha}CDR3 loop in cross-reactive recognition by bm8 TCRs

To examine which of the newly recruited TCR structural elements may mediate the cross-reactive recognition by bm8 TCRs, we first determined whether TCR cross-reactivity was linked to TCR-V usage. For example, because most B6 anti HSV-8p CTLs use V{beta} 8 and 10, it was possible that these two segments imprint monospecificity. If so, V{beta}8+ and V{beta}10+ CTLs from bm8 mice may be monospecific for HSV-8p:Kbm8, whereas one or more of the other V{beta} elements used by bm8 anti HSV-8 CTLs would imprint cross-reactivity. We sorted bm8 CTLs on the basis of their V{beta} (V{beta}4, -5, -8, -9, -10, and -13) or V{alpha} (V{alpha}2) usage and assayed their specificity. Each of the sorted CTL populations was able to recognize both the HSV-8p:Kb and the HSV-8p:Kbm8 complexes, regardless of the V{beta} or V{alpha} usage (Fig. 5Go). Therefore, the TCR {alpha} or {beta} CDRs 1 and 2, encoded within the germline V{beta} and V{alpha} segments, did not determine bm8 TCR cross-reactivity. We next investigated the potential role of CDR3 loops in mediating bm8 TCR cross-reactivity by generating bm8 and B6 CTL clones. The clones were divided into functional groups based on their fine specificity (see examples in Fig. 3Go) and analyzed for the TCR {alpha}{beta} makeup by FCM and sequence analysis within each group. We searched for correlations between CDR{beta}3 or CDR{alpha}3 element usage and the functional reactivity of groups of clones. All CDR{beta}3 analyzed were 10–12 aa long, with an apparently random distribution among the functional groups. Numerous TCRs of all three specificities shared CDR{beta}3 sequences (Table IGo, top, and data not shown). This indicated that CDR{beta}3 does not determine TCR cross-reactivity. Together with data from the previous section, it follows that TCR {beta}-chain does not govern the bm8 TCR cross-reactivity.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 5. TCR V{beta} usage does not determine bm8 TCR cross-reactivity against HSV-8p:Kb. HSV-8p-specific bm8-derived CTLs were sorted based on their V{beta} expression, subjected to one cycle of restimulation, and assayed as in Fig. 1Go.

 
TCR{alpha} analysis revealed no correlation between CDR{alpha}3 length (data not shown and Table IIGo) and functional reactivity. By contrast, a strong correlation between CDR{alpha}3 sequence and functional reactivity was observed. We identified six groups of bm8 CTL clones (16 clones in all) that expressed very different {beta}-chains but shared the same {alpha}-chain. In each of these cases, CTL clones sharing the same TCR{alpha}-chain displayed the same TCR specificity (Table IIGo). For example, the first group encompasses two clones that use the same V{beta} (BV6) but different J{beta} (BJ2S7 and BJ2S6, respectively), differing at three CDR{beta}3 residues, and the third clone bearing an entirely different {beta}-chain (BV10S1-BJ2S7), differing from the first two at CDR{beta}1, CDR{beta}2, and CDR{beta}3. All three clones shared the TCR{alpha}-chain amino acid (although not nucleotide; data not shown) sequences, including CDR{alpha}3, and exhibited the same reactivity. An even more striking example can be found in the sixth group, where extreme differences in all three CDR{beta} were found (only two of the four clones shared the BJ segment, but their BV and CDR{beta}3 sequences were vastly different). But these clones shared the CDR{alpha}3 amino acid (but not nucleotide; data not shown) sequences, as well as functional reactivity. Moreover, the {alpha}-chain sequences associated with cross-reactivity in bm8 CTLs were never found in any of the B6 CTL clones sequenced (17 of 17 clones, 11 different sequences). Thus, the protein identity at the TCR{alpha}-chain CDR3 was necessary and sufficient to establish the fine TCR{alpha}{beta} specificity in our model, despite the fact that TCRs examined carried drastically different CDR{beta} loops. Based on these observations and the finding that CDR{alpha}1 and CDR{alpha}2 do not imprint specificity in this model as judged by the functional reactivity of sorted bm8 V{alpha}2+ CTLs (data not shown), we conclude that the CDR{alpha}3 is the critical loop determining ligand specificity in our model. These data establish a direct link between cross-reactive recognition of HSV-8p and the Ag-recruited TCR{alpha}-chain CDR3 usage and strongly suggests that these {alpha}-chains are exclusively present in the positively selected bm8 CTL repertoire (Ref. 35 and this article).

It is pertinent to note here that a previous study (38) failed to find significant conservation in the CDR3{alpha} regions of HSV-8p:Kb-specific CTLs. Likewise, within the limited number of B6 clones analyzed here (10 different clones, as opposed to >90 clones for bm8), we did not observe major conservation of this region among B6 clones. However, the analysis of Cose et al. (38) focused on Ag recognition, whereas ours was focused on cross-reactivity of closely related complexes, the variation of which was likely positioned under the TCR{alpha} CDR3 footprint (see Fig. 6Go). Therefore, it would be of interest to test a larger panel of B6 clones for structural and sequence conservation.



View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 6. Kb presentation of HSV-8. A, Top view of the pMHC complex. The six hypervariable loops of the 2C TCR are shown here, as in A, docked in the same orientation relative to Kb as determined by Garcia et al. (39 ). Each CDR loop is labeled at its N-terminal side. Depicted in black is CDR{alpha}3, which is located above the central peptide core in all peptide:class I:TCR structures determined to date (39 43 51 54 ). Also shown are residues Lys66 and Asn70, which form a shelf above the B pocket. Therefore, CDR{alpha}3 is well situated to detect alterations in the B pocket region of pMHC complex. B, Side view of the pMHC complex. The HSV-8p represented as a CPK model buries the hydrophobic residues P3, P5, and P8 into the D, C, and F pockets, respectively, whereas the P2 Ser is accommodated by the B pocket (details of this structure will be reported separately; Metzner et al., manuscript in preparation). Represented in black are the residues in Kb that are substituted in Kbm8 (Tyr22->Phe, Met23->Ile, Glu24->Ser, Asp30->Asn). Two of these substitutions, Glu24->Ser and Tyr22->Phe, form the base of the B pocket. For clarity, the {alpha}2 domain has been omitted.

 
Modeling of TCR (2C) over the actual HSV-8pp:Kb crystal structure

The recently solved crystal structure of the HSV-8p:Kb complex (B. M. Metzner, M. J. Miley, J. Nikolich-Zugich, manuscript in preparation) provided further support for the above biological findings. Fig. 6Go shows the orientation of the residues of the HSV-8p peptide bound to Kb, as well as the adjacent Kb residues (residues differing between Kb and Kbm8 are highlighted) and the superimposed TCR CDR loops modeled from the complex of the 2C TCR with dEV-8:Kb (39). The CDR{alpha}3 of 2C, as modeled over the HSV-8p:Kb structure (dark band), is positioned precisely above the backbone of the peptide at the N terminus of the complex, corresponding to the buried residues P2 and P3, and the MHC side chains 66 and 70 (Fig. 6GoB), the parts of the pMHC expected to vary between the two complexes (34). These results strongly support our conclusions on the critical importance of CDR{alpha}3 in determining TCR specificity in the above model, precisely because the bm8 mutations sit directly below the presumptive CDR{alpha}3 contact position on both the Kb {alpha}1 helix and HSV-8p (Fig. 6GoA). Moreover, positioning of CDR{alpha}3 of a large set of diverse TCRs to read subtle conformational differences between related pMHC complexes provides further evidence for a highly conserved TCR docking topology over similar ligands, implying a high degree of determinism in T cell recognition.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Results presented in this paper bear on the specific causes of TCR cross-reactivity in the HSV-8p:Kb/Kbm8 model, as well as on the general issues of TCR:pMHC interaction. It is generally accepted that T cell recognition of pMHC ligands has to be specific, based on findings that any given pMHC complex activates only a minority (< 0.1–0.01%) of all T cells (reviewed in Ref. 40). These findings implied that T cells cover the vast universe of potential antigenic epitopes primarily by virtue of an enormous diversity of clonally distributed TCRs, with most T cells responding to a limited number of ligands. However, more recent evidence argues that TCR cross-reactivity is an intrinsic characteristic of T cell recognition, essential if the immune system is to be effective against the universe of pathogens. This process plays a key role in many phenomena of fundamental and clinical importance (4, 16, 17, 41).

Structural studies of cross-reactivity have emphasized the role of receptor and/or ligand flexibility. In certain cases, the TCR can be flexible and adjust to the ligand. Thus, the 2C TCR, with a high glycine content in both CDR3 loops and the small V{alpha}:V{beta} interface, can undergo considerable adaptation to one, and likely more, ligand(s) (reviewed in Ref. 3). 2C flexibility was implicated in cross-reactive recognition of dEV-8:Kb and QL9:Ld (42). In the case of the A6 TCR, it is the pMHC that undergoes conformational adaptation on TCR binding (43). Moreover, peptides exhibiting flexibility when bound to MHC (i.e., because of the lack of optimal anchor residues) can affect T cell recognition (44, 45). For example, in a prominent case of cross-reactivity in the absence of any structural homology between the two recognized complexes (13), the peptide in one of the complexes exhibited unusual flexibility in the central portion owing to the absence of the central anchor. It was argued that such peptides, which bind well to the MHC, but have "floppy" portions, may attract a more promiscuous array of TCRs, prone to cross-reactivity (46).

How is this cross-reactive recognition in the HSV-8p:Kb/Kbm8 model achieved at the molecular level? One possibility is that the two pMHC complexes inherently differ in flexibility and perhaps assume a different number of discrete conformational states. This could cause the TCR to focus on different parts of the pMHC complex. We found that specific CDR{alpha}3 usage determines the ability of the TCR to recognize HSV-8p presented by Kb and Kbm8 in a monospecific or cross-reactive fashion. This is because: 1) CDR{alpha}3 sequence usage strictly correlated to the reactivity pattern; 2) the usage of the other five CDRs (CDR{beta}1–3, CDR{alpha}1, 2) failed to correlate with reactivity; and 3) the {alpha}-chains capable of conferring cross-reactivity were never detected in B6 anti-HSV-8p CTLs, explaining their exclusive monospecificity. The N-terminal half of the peptide, contacted by the TCR{alpha}-chain, encompasses the P1-P4 segment, the solvent-accessible surface of which consists of the P1 and P4 side chains and of the peptide backbone connecting the buried P2 and P3 residues. The B pocket, which varies between Kb and Kbm8, is located directly below the residue P2 and under the area likely to be contacted by CDR{alpha}3 (Fig. 6Go). We propose that the CDR{alpha}3 loop of the cross-reactive TCRs either does not interact with the conformationally distinct pMHC surface above the B pocket or interacts with it in a manner to accommodate its variation. One way to achieve the latter would be for the CDR{alpha}3 to rearrange its focal contacts to the conserved parts of the complex, shared between HSV-8p:Kb and HSV-8p:Kbm8 (e.g., residue P1 and/or the backbone of the MHC{alpha}1 helix), thus allowing cross-reactive recognition. By contrast, monospecific TCRs could potentially make intimate contact with the pMHC region above the B pocket, including the P2-P3 peptide backbone and the residues MHC66 and 70 (Fig. 6Go), known to conformationally adjust to different peptide content of the groove (47, 48). TCR contact refocusing was reported in one case of cross-reactivity (42). In light of the general predisposition of TCR to interact with MHC (4, 5, 6), molecular refocusing of TCR contacts proposed above would provide the mechanism to balance TCR specificity and promiscuity. It also is worth noting that the cross-reactive TCRs that share TCR{alpha} CDR3 sequences differ in nucleotide sequence (data not shown), illustrating the power of Ag-recruitment of diverse CTLs with similar or identical TCR sequences.

Both the functional (49, 50) and structural (reviewed in Refs. 2, 25 and 46 ; see also Refs. 7 and 8) studies stressed the common TCR:pMHC interaction pattern, with the {alpha}- and {beta}-chains contacting the peptide N- and C-terminal regions of the pMHC complex, respectively. Moreover, a combination of functional and structural studies demonstrated that CDR{alpha}1 and CDR{alpha}2 play a role in orienting the TCR over the pMHC, and in simultaneously determining the class I/II preference (7, 8, 51, 52, 53). It was argued previously that TCRs can dock onto the pMHC complex at various angles and with considerable flexibility and that CDR{alpha}3 exhibits high positional variability over pMHC (54). Although variation may exist between TCRs specific for different pMHC complexes, our results argue that TCR recognition of the same or closely related pMHC complexes must be governed by strict rules. Indeed, if the CDR{alpha}3 loop consistently determines whether a TCR will be monospecific or cross-reactive in the HSV-8p:Kb/Kbm8 model, then in monospecific TCRs this loop would consistently interact with the parts of the pMHC complex that vary between the HSV-8p:Kb and HSV-8p:Kbm8. Thus, the most important conclusion of this work is that in the monospecific TCRs the CDR{alpha}3 must assume a highly conserved position over pMHC whenever even very different TCRs are complexed to HSV-8p:Kb or Kbm8, to sense the differences between the two. In cross-reactive TCRs, the docking of the CDR{alpha}3 loop also is likely to be conserved, but with the loop focused on invariant parts of the two pMHC complexes. In light of the strictly conserved points of contact for CDR{alpha}1 and CDR{alpha}2 on pMHC complexes crystallized so far (reviewed in Ref. 2 ; see also Ref. 25), these results argue that much of the TCR{alpha} docking onto the pMHC complex is highly regulated and conserved. This is consistent with conserved positioning of CDR{alpha}3 observed for two human TCRs binding to the same peptide:class I ligand (51); and with studies where the CDR{alpha}3 residues fully controlled intrathymic negative selection in class II-restricted TCR{beta} Tg mice (55). Conserved positioning of CDR{beta}3 of different {alpha}{beta}TCRs over the VSV-8:Kb complex also was inferred recently from functional results (56), arguing that similar restrictions could exist for TCR{beta}. Of note, this conservation does not preclude the use of different and unique residues to achieve molecular contacts (51).

Teleological advantages of such conservation are obvious: should the similar pMHC complexes be read out by the same TCR with variable docking strategies or variable movement along the general diagonal docking axis, then TCR binding may have unpredictable and inconsistent biological outcomes. This would include leaky negative selection and inefficient positive intrathymic selection and peripheral response to pathogens. Thus, a fixed readout of the same or structurally similar pMHC surfaces, strongly supported by our data, is the only scenario that allows predictable positive and negative selection and T cell activation while reducing the chance of autoimmunity.


   Acknowledgments
 
We thank Dr. S. Silverstein (Columbia University, New York, NY) for HVH-1, Dr. A. Singer (National Institutes of Health, Bethesda, MD) for helpful suggestions, Dr. R. Germain (National Institutes of Health) for insightful discussion, Dr. D. Sant’Angelo (Memorial Sloan-Kettering Cancer Center) for helpful suggestions and critical perusal of the manuscript, D. Nikolich-Zugich for expert technical assistance, and G. Lemmerhirt and CytRx (Norcross, GA) for supplying TiterMax.


   Footnotes
 
1 This work was supported by U.S. Public Health Service National Institutes of Health Award CA 86803 (to J.N.-Z.) from the National Cancer Institute. I.M. was a predoctoral fellow of the Cancer Research Institute. Back

2 Address correspondence and reprint requests to Dr. Janko Nikolich-Zugich at the current address: Vaccine and Gene Therapy Institute, Oregon Health and Science University, West Campus, 505 Northwest 185th Street, Beaverton, OR 97006. E-mail address: nikolich{at}OHSU.edu Back

3 Abbreviations used in this paper: pMHC, peptide:MHC complex; APL, altered peptide ligand; FCM, flow cytofluorometry; HSV-8p, peptide from HVH-1 gB495–502, SSIEFARL. Back

Received for publication February 16, 2001. Accepted for publication May 9, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mazza, G., L. L. Houston, H.-P. Pircher, C. Gregoire, R. M. Steinman, S.-Y. Lin, J. C. Fontecilla-Camps, B. Malissen. 1998. Glimpses at the recognition of peptide/MHC complexes by T-cell antigen receptors. Immunol. Rev. 163:187.[Medline]
  2. Garboczi, D. N., W. E. Biddison. 1999. Shapes of MHC restriction. Immunity 10:1.[Medline]
  3. Garcia, K. C., L. Teyton, I. A. Wilson. 1999. Structural basis of T cell recognition. Annu. Rev. Immunol. 17:369.[Medline]
  4. Ignatowicz, L., J. Kappler, P. Marrack. 1996. The repertoire of T cells shaped by a single MHC/peptide ligand. Cell 84:521.[Medline]
  5. Miyazaki, T., P. Wolf, S. Tourne, C. Waltzinger, A. Dierich, N. Barois, H. Ploegh, C. Benoist, D. Mathis. 1996. Mice lacking H2-M complexes, enigmatic elements of the MHC class II peptide-loading pathway. Cell 84:531.[Medline]
  6. Zerrahn, J., W. Held, D. H. Raulet. 1997. The MHC reactivity of the T cell repertoire prior to positive and negative selection. Cell 88:627.[Medline]
  7. Hennecke, J., A. Carfi, D. C. Wiley. 2000. Structure of a covalently stabilized complex of a human {alpha}{beta} T-cell receptor, influenza HA peptide and MHC class II molecule, HLA-DR1. EMBO J. 19:5611.[Medline]
  8. Reinherz, E. L., K. Tan, L. Tang, P. Kern, J. Liu, Y. Xiong, R. E. Hussey, A. Smolyar, B. Hare, R. Zhang, et al 1999. The crystal structure of a T cell receptor in complex with peptide and MHC class II. Science 286:1913.[Abstract/Free Full Text]
  9. Wilson, C. S., J. M. Moser, J. D. Altman, P. E. Jensen, A. E. Lukacher. 1999. Cross-recognition of two middle T protein epitopes by immunodominant polyoma virus-specific CTL. J. Immunol. 162:3933.[Abstract/Free Full Text]
  10. Hemmer, B., M. Vergelli, B. Gran, N. Ling, P. Conlon, C. Pinilla, R. Houghten, H. F. McFarland, R. Martin. 1998. Predictable TCR antigen recognition based on peptide scans leads to the identification of agonist ligands with no sequence homology. J. Immunol. 160:3631.[Abstract/Free Full Text]
  11. Hemmer, B., M. Vergelli, C. Pinilla, R. Houghten, and R. Martin. 1998. Probing degeneracy in T-cell recognition using peptide combinatorial libraries. Immunol. Today 168.
  12. Loftus, C., E. Huseby, P. Gopaul, C. Beeson, J. Goverman. 1999. Highly cross-reactive T cell responses to myelin basic protein epitopes reveal a nonpredictable form of TCR degeneracy. J. Immunol. 162:6451.[Abstract/Free Full Text]
  13. Zhao, R., D. J. Loftus, E. Appella, E. J. Collins. 1999. Structural evidence of T cell xeno-reactivity in the absence of molecular mimicry. J. Exp. Med. 189:359.[Abstract/Free Full Text]
  14. Evavold, B. D., J. Sloan-Lancaster, K. J. Wilson, J. B. Rothbard, P. M. Allen. 1995. Specific T cell recognition of minimally homologous peptides: evidence for multiple endogenous ligands. Immunity 2:655.[Medline]
  15. Evavold, B. D., J. Sloan-Lancaster, P. M. Allen. 1993. Tickling the TCR: selective T-cell functions stimulated by altered peptide ligands. Immunol. Today 14:602.[Medline]
  16. Mason, D.. 1998. A very high level of crossreactivity is an essential feature of the T-cell receptor. Immunol. Today 19:395.[Medline]
  17. Fink, P. J., M. J. Bevan. 1995. Positive selection of thymocytes. Adv. Immunol 59:99.[Medline]
  18. Wraith, D. C., B. Brunn, P. J. Fairchild. 1992. Cross-reactive antigen recognition by an encephalitogenic T cell receptor: implications for T cell biology and autoimmunity. J. Immunol. 149:3765.[Abstract]
  19. Wucherpfennig, K. W., J. L. Strominger. 1995. Molecular mimicry in T cell-mediated autoimmunity: viral peptides activate human T cell clones specific for myelin basic protein. Cell 80:695.[Medline]
  20. Bachmaier, K., N. Neu, L. M. de la Maza, S. Pal, A. Hessel, J. M. Penninger. 1999. Chlamydia infections and heart disease linked through antigenic mimicry. Science 283:1335.[Abstract/Free Full Text]
  21. Nahil, S. R., R. M. Welsh. 1993. High frequency of cross-reactive cytotoxic T lymphocytes elicited during virus induced polyclonal cytotoxic T lymphocyte response. J. Exp. Med. 177:317.[Abstract/Free Full Text]
  22. Freitas, A. A., B. Rocha. 1999. Peripheral T cell survival. Curr. Opin. Immunol. 11:152.[Medline]
  23. Bevan, M. J., T. Hunig. 1981. T cells respond preferentially to antigens that are similar to self H-2. Proc. Natl. Acad. Sci. USA 78:1843.[Abstract/Free Full Text]
  24. Kaye, J., S. M. Hedrick. 1988. Analysis of specificity for antigen, Mls, and allogenic MHC by transfer of T-cell receptor {alpha}- and {beta}-chain genes. Nature 336:580.[Medline]
  25. Garcia, K. C., L. Teyton, I. A. Wilson. 1999. Structural basis of T cell recognition. Annu. Rev. Immunol. 17:369.
  26. Manning, T. C., D. M. Kranz. 1999. Binding energetics of T-cell receptors: correlation with immunological consequences. Immunol. Today 20:417.[Medline]
  27. Dyall, R., L. V. Vasovic, A. Molano, J. Nikolich-Zugich. 1995. CD4-independent in vivo priming of murine CTLs by optimal MHC class I-restricted peptides derived from HIV and other pathogens. Int. Immunol. 7:1205.[Abstract/Free Full Text]
  28. LeMaoult, J., I. Messaoudi, J. S. Manavalan, H. Potvin, D. Nikolich-Zugich, R. Dyall, P. Szabo, M. E. Weksler, J. Nikolich-Zugich. 2000. Age-related dysregulation in CD8 T cell homeostasis: kinetics of a diversity loss. J. Immunol. 165:2367.[Abstract/Free Full Text]
  29. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zoller, P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor {beta}-chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.[Abstract/Free Full Text]
  30. Nathenson, S. G., J. Geliebter, G. M. Pfaffenbach, R. A. Zeff. 1986. Murine major histocompatibility complex class I mutants. Annu. Rev. Immunol. 4:471.[Medline]
  31. Fremont, D. H., P. A. Peterson, E. A. Stura. 1992. Crystal structures of 2 viral peptides in complex with murine MHC class-I H-2Kb. Science 257:919.[Abstract/Free Full Text]
  32. Chattopadhyay, S., T. Matthias, J. Biggs, L. A. Sherman. 1994. Conformational differences in major histocompatibility complex-peptide complexes can result in alloreactivity. J. Exp. Med. 179:213.[Abstract/Free Full Text]
  33. Rohren, E. M., L. R. Pease, H. L. Ploegh, T. N. Schumacher. 1993. Polymorphisms in pockets of major histocompatibility complex class I molecules influence peptide preference. J. Exp. Med. 177:1713.[Abstract/Free Full Text]
  34. Dyall, R., D. H. Fremont, S. C. Jameson, J. Nikolich-Zugich. 1996. T cell receptor (TCR) recognition of MHC class I variants: intermolecular second-site reversion of an MHC mutation by substituted peptides provides evidence for peptide/MHC conformational variation. J. Exp. Med. 184:253.[Abstract/Free Full Text]
  35. Dyall, R., I. Messaoudi, S. Janetzki, J. Nikolich-Zugich. 2000. MHC polymorphism can enrich the cell repertoire of the species by shifts in intrathymic selection. J. Immunol. 164:1695.[Abstract/Free Full Text]
  36. Messaoudi, I., J. LeMaoult, J. Nikolich-Zugich. 1999. The mode of ligand recognition by two peptide:MHC class I-specific monoclonal antibodies. J. Immunol. 163:3286.[Abstract/Free Full Text]
  37. Reid, S. W., S. McAdam, K. J. Smith, P. Klenerman, C. A. O’Callaghan, K. Harlos, B. K. Jakobsen, A. J. McMichael, J. I. Bell, D. I. Stuart, E. Y. Jones. 1996. Antagonist HIV-1 Gag peptides induce structural changes in HLA B8. J. Exp. Med. 184:2279.[Abstract/Free Full Text]
  38. Cose, S. C., J. M. Kelly, F. R. Carbone. 1995. Characterization of a diverse primary herpes simplex virus type 1 gB-specific cytotoxic T-cell response showing a preferential V{beta} bias. J. Virol. 69:5849.[Abstract]
  39. Garcia, K. C., M. D. Tallquist, L. R. Pease, A. Brunmark, C. A. Scott, M. Degano, E. A. Stura, P. A. Peterson, I. A. Wilson, L. Teyton. 1997. {alpha}{beta} T cell receptor interactions with synbeneic and allogeneic ligands: affinity measurement and crystallization. Proc. Natl. Acad. Sci. USA 94:13838.[Abstract/Free Full Text]
  40. Bevan, M. J.. 1984. High determinant density may explain the phenomenon of alloreactivity. Immunol. Today 5:128.
  41. Gould, D. S., Jr H. Auchincloss. 1999. Direct and indirect recognition: the role of MHC antigens in graft rejection. Immunol. Today 20:77.[Medline]
  42. Speir, J. A., K. C. Garcia, A. Brunmark, M. Degano, P. A. Peterson, L. Teyton, I. A. Wilson. 1998. Structural basis of 2C TCR allorecognition of H-2Ld peptide complexes. Immunity 8:553.[Medline]
  43. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, D. C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134.[Medline]
  44. Kuhns, J. J., M. A. Batalia, S. Yan, E. J. Collins. 1999. Poor binding of a HER-2/neu epitope (GP2) to HLA-A2.1 is due to a lack of interactions with the center of the peptide. J. Biol. Chem. 274:36422.[Abstract/Free Full Text]
  45. Willcox, B. E., G. F. Gao, J. R. Wyer, J. E. Ladbury, J. I. Bell, B. K. Jakobsen, P. A. van der Merwe. 1999. TCR binding to peptide-MHC stabilizes a flexible recognition interface. Immunity 10:357.[Medline]
  46. Maenaka, K., E. Y. Jones. 1999. MHC superfamily structure and the immune system. Curr. Opin. Struct. Biol. 9:745.[Medline]
  47. Fremont, D. H., E. A. Stura, M. Masazumi, P. A. Peterson, I. A. Wilson. 1995. Crystal structure of an H-2Kb-ovalbumin peptide complex reveals the interplay of primary and secondary anchor positions in the major histocompatibility complex binding groove. Proc. Natl. Acad. Sci. USA 92:2479.[Abstract/Free Full Text]
  48. Ghendler, Y., M. K. Teng, J. H. Liu, J. Witte, J. Liu, K. S. Kim, P. Kern, H. C. Chang, J. H. Wang, E. L. Reinherz. 1998. Differential thymic selection outcomes stimulated by focal structural alteration in peptide/major histocompatibility complex ligands. Proc. Natl. Acad. Sci. USA 95:12734.[Free Full Text]
  49. Sun, R., S. E. Shepherd, S. S. Geier, C. T. Thomson, J. M. Sheil, S. G. Nathenson. 1995. Evidence that the antigen receptors of cytotoxic T lymphocytes interact with a common recognition pattern on the H-2Kb molecule. Immunity 3:573.[Medline]
  50. Sant’Angelo, D. B., G. Waterbury, P. Preston-Hurlburt, S. T. Yoon, R. Medzhitov, S.-C. Hong, Jr C. A. Janeway. 1996. The specificity and orientation of a TCR to its peptide-MHC class II ligands. Immunity 4:367.[Medline]
  51. Ding, Y.-H., K. J. Smith, D. N. Garboczi, U. Ultz, W. E. Biddison, D. C. Wiley. 1998. Two human T cell receptors bind in a similar diagonal mode to the HLA-A2/Tax peptide complex using different TCR amino acids. Immunity 8:403.[Medline]
  52. Degano, M., K. C. Garcia, V. Apostolopoulos, M. G. Rudolph, L. Teyton, I. A. Wilson. 2000. A functional hot spot for antigen recognition in a superagonist TCR/MHC complex. Immunity 12:251.[Medline]
  53. Sim, B. C., L. Zerva, M. I. Greene, N. R. Gascoigne. 1996. Control of MHC restriction by TCR V{alpha} CDR1 and CDR2. Science 273:963.[Abstract]
  54. Teng, M.-K., A. Smolyar, A. G. D. Tse, J.-H. Liu, J. Liu, R. E. Hussey, S. G. Nathenson, H.-C. Chang, E. L. Reinherz, J.-H. Wang. 1998. Identification of a common docking topology with substantial variation among different TCR-peptide-MHC complexes. Curr. Biol. 8:409.[Medline]
  55. Sant’Angelo, D. B., P. G. Waterbury, B. E. Cohan, W. D. Martin, L. Van Kaer, A. C. Hayday, Jr C. A. Janeway. 1997. The imprint of intrathymic self-peptides on the mature T cell receptor repertoire. Immunity 7:517.[Medline]
  56. Kalergis, A. M., S. G. Nathenson. 2000. Altered peptide ligand-mediated TCR antagonism can be modulated by a change in a single amino acid residue within the CDR3{beta} of an MHC class I-restricted TCR. J. Immunol. 165:280.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
A. Lang, J. D. Brien, I. Messaoudi, and J. Nikolich-Zugich
Age-Related Dysregulation of CD8+ T Cell Memory Specific for a Persistent Virus Is Independent of Viral Replication
J. Immunol., April 1, 2008; 180(7): 4848 - 4857.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. J. Miles, N. A. Borg, R. M. Brennan, F. E. Tynan, L. Kjer-Nielsen, S. L. Silins, M. J. Bell, J. M. Burrows, J. McCluskey, J. Rossjohn, et al.
TCR{alpha} Genes Direct MHC Restriction in the Potent Human T Cell Response to a Class I-Bound Viral Epitope
J. Immunol., November 15, 2006; 177(10): 6804 - 6814.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Messaoudi, J. Warner, D. Nikolich-Zugich, M. Fischer, and J. Nikolich-Zugich
Molecular, Cellular, and Antigen Requirements for Development of Age-Associated T Cell Clonal Expansions In Vivo
J. Immunol., January 1, 2006; 176(1): 301 - 308.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
M. J. Miley, I. Messaoudi, B. M. Metzner, Y. Wu, J. Nikolich-Zugich, and D. H. Fremont
Structural Basis for the Restoration of TCR Recognition of an MHC Allelic Variant by Peptide Secondary Anchor Substitution
J. Exp. Med., December 6, 2004; 200(11): 1445 - 1454.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. I. Webb, N. A. Borg, M. A. Dunstone, L. Kjer-Nielsen, T. Beddoe, J. McCluskey, F. R. Carbone, S. P. Bottomley, M.-I. Aguilar, A. W. Purcell, et al.
The Structure of H-2Kb and Kbm8 Complexed to a Herpes Simplex Virus Determinant: Evidence for a Conformational Switch That Governs T Cell Repertoire Selection and Viral Resistance
J. Immunol., July 1, 2004; 173(1): 402 - 409.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Messaoudi, I.
Right arrow Articles by Nikolich-Zugich, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Messaoudi, I.
Right arrow Articles by Nikolich-Zugich, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS