The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.
The Journal of Immunology, 2001, 167: 759-764.
Copyright © 2001 by The American Association of Immunologists

The Binding of Thymus Leukemia (TL) Antigen Tetramers to Normal Intestinal Intraepithelial Lymphocytes and Thymocytes1

Kunio Tsujimura2,*, Yuichi Obata3,*, Yasue Matsudaira*, Satoshi Ozeki*, Kazuhiro Yoshikawa{dagger}, Shinsuke Saga{dagger} and Toshitada Takahashi*

* Division of Immunology, Aichi Cancer Center Research Institute, Nagoya, Japan; and {dagger} Second Department of Pathology, Aichi Medical University, Nagakute, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thymus leukemia (TL) Ags belong to the family of nonclassical MHC class I Ags and can be recognized by both TCR{alpha}{beta} and TCR{gamma}{delta} CTL with TL, but not H-2 restriction. We previously reported that the CTL epitope is TAP independent, but the antigenic molecule(s) presented by TL has yet to be determined. In the present study, TL tetramers were prepared with T3b-TL and murine {beta}2-microglobulin, not including antigenic peptides, and binding specificity was studied. CTL clones against TL Ags were stained with the T3b-TL tetramer, and the binding shown to be CD3 and CD8 dependent. Normal lymphocytes from various origins were also studied. Surprisingly, most CD8+ intraepithelial lymphocytes derived from the small intestines (iIEL), as well as CD8+ and CD4+CD8+ thymocytes, were stained, while only very minor populations of CD8+ cells derived from other peripheral lymphoid tissues, such as spleen and lymph nodes, were positive. The binding of T3b-TL tetramers to CD8+ iIEL and thymocytes was CD8 dependent, but CD3 independent, in contrast to that to TL-restricted CTL. These results altogether showed that TL-restricted CTL can be monitored by CD3-dependent binding of T3b-TL tetramers. In addition, CD3-independent T3b-TL tetramer binding to iIEL and thymocytes may imply that TL expressed on intestinal epithelium and cortical thymocytes has a physiological function interacting with these tetramer+CD8+ T lymphocytes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice and humans have several MHC class Ib (or nonclassical MHC class I) molecules that are distinguishable from MHC class Ia (or classical MHC class I) by their limited polymorphism and unique expression patterns (1, 2). Mouse thymus leukemia (TL)4 Ags belong to the family of MHC class Ib and are restricted to the intestines in all mouse strains as well as the thymus of TL+ strains (e.g., A-strain and BALB/c mice) (3, 4, 5, 6).

In our previous studies, we showed that TL can be recognized by both TCR{alpha}{beta} and TCR{gamma}{delta} CTL (7, 8, 9). Because the cytotoxic activity of these CTL is inhibited by TL, but not by anti-H-2 Abs, it was concluded that recognition of TL is direct without any requirement for Ag presentation by H-2 molecules. Recent studies conducted by ourselves and other investigators have demonstrated that TL molecules are transported to and stably expressed on the surfaces of TAP-deficient cells (10, 11, 12, 13). We further showed that most TL-restricted CTL recognize the epitope(s), expressed on TL in a TAP-independent manner (10). However, it has not been determined whether TL can present the Ag molecule(s), as in the cases of MHC class Ia and II (14) and some MHC class Ib molecules (15).

Recent progress in molecular biology has allowed production of MHC tetramers as important tools to identify Ag-specific T lymphocytes by flow cytometry (16). The dynamics and magnitude of T cell responses in immunity against tumors and pathogens and in autoimmune diseases have thereby been characterized (17, 18, 19). Furthermore, this new tool has been shown to be useful in the search for natural ligands for MHC other than TCR (20, 21).

In the present study, we prepared TL tetramers consisting of T3b-TL and {beta}2-microglobulin ({beta}2m), not including antigenic peptides, and studied the binding specificity to TL-restricted CTL. Normal lymphocytes of various origins were also examined to identify natural ligand(s) for TL and elucidate the physiological function(s) of TL themselves and recognizing T lymphocytes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

The derivation of the transgenic mouse strains used in this study has been described previously (22, 23). Tg.Con.3-1, having a chimeric gene in which the T3b gene from C57BL/6 (B6) is driven by the H-2Kb promoter, expresses T3b-TL ubiquitously. Another strain, Tg.Tlaa-3-1, having a Tlaa-3 transgene (from A-strain) with its own promoter, expresses Tlaa-3-TL predominantly on thymocytes and intestinal epithelial cells. These transgenic mice were generated on a C3H background, without TL expression in the thymus, but with expression of T3k-TL in the intestine. C3H and B6 mice were purchased from Japan SLC (Hamamatsu, Japan), and CD8{alpha} knockout mice from The Jackson Laboratory (Bar Harbor, ME). DO11.10-TCR transgenic mice crossed with Rag2-/- mice (DO11.10/Rag2-/-; Refs. 24, 25) were kindly provided by K. Iwabuchi (Hokkaido University, Sapporo, Japan).

Cells

CTL clones against TL or H-2Kb were established as previously described (7, 8, 9, 10). Intraepithelial lymphocytes (IEL) from the small intestines (iIEL) (26) and lymphocytes from Peyer’s patches (26) and liver (27) were prepared as described.

Antibodies

Rat mAb against TL (HD168; Ref. 28) and mouse mAb to TL.2 (TT213; Ref. 7) were described previously. The following mAbs were kindly provided by other investigators, as detailed earlier (7, 8, 9, 10): hamster mAb against CD3 (145-2C11; Ref. 29), TCR{alpha}{beta} (H57-597; Ref. 30), and TCR{gamma}{delta} (3A10; Ref. 31); rat mAb against L3T4/CD4 (GK1.5; Ref. 33) and Lyt-2/CD8{alpha} (35-17-2; kindly provided by N. Shinohara, Kitasato University, Sagamihara, Japan); and mouse mAb against {beta}2m (S19.8; Ref. 33). IgG fractions were obtained from ascitic fluid-bearing hybridomas producing the mAbs described above with protein G-Sepharose (Amersham Pharmacia Biotech, Uppsala, Sweden), and used for blocking assays. The following mAbs were purchased: purified mouse mAb against V{beta}9 (MR10-2; PharMingen, San Diego, CA); FITC-labeled rat mAb against Thy-1.2 (30-H12; BD Biosciences Immunocytometry Systems, Mountain View, CA), L3T4/CD4 (GK1.5; PharMingen), and Lyt-2/CD8{alpha} (53-6.7; PharMingen); hamster mAbs against anti-CD3 (145-2C11; PharMingen), TCR{alpha}{beta} (H57-597; Cedarlane Laboratories, Hornby, Ontario, Canada), and TCR{gamma}{delta} (GL3; Cedarlane Laboratories); mouse mAb against Lyt-3.2/CD8{beta} (53-5.8; PharMingen); and CyChrome-labeled rat mAbs against Ly-5/CD45 (30-F11; PharMingen) and Lyt-2/CD8{alpha} (53-6.7; PharMingen). Biotinylated mouse mAb against DO11.10-TCR (KJ1-26; Ref. 34) was kindly provided by K. Iwabuchi.

Construction of T3b-TL tetramers

Tetrameric T3b-TL/{beta}2m complexes were constructed as recently described (16, 35). A cDNA encoding a GlySer linker and a biotin-specific peptide (BSP) was fused to the 3' end of the truncated T3b (encoding from the leader sequence to aa 279) by PCR with the 5' primer GGAATTCATGAGGATGGGGACCATG and the 3' primer GCGCAAGCTTTTAACGATGATTCCACACCATTTTCTGTGCATCCAGAATATGATGCAGGGATCCGGTCTGAGGAAGCTCCTCCCA, using the plasmid T3b-pUC19 (10) as the template. The 5' and 3' primers were tagged with EcoRI and HindIII sites, respectively. cDNA encoding murine {beta}2m was prepared by PCR with the 5' primer CGGGATCCATGGCTCGCTCGGTGACC and the 3' primer GCGCAAGCTTTCACATGTCTCGATCCCAGTA using the plasmid {beta}2m-pUC19 (10). The 5' and 3' primers were tagged with BamHI and HindIII sites, respectively.

Baculoviruses containing BSP-tagged soluble T3b or {beta}2m cDNA were prepared using Bac-to-Bac baculovirus expression systems (Life Technologies, Gaithersburg, MD), according to the manufacturer’s instructions. Briefly, BSP-tagged soluble T3b and {beta}2m cDNAs were inserted into EcoRI/HindIII and BamHI/HindIII sites, respectively, of the plasmid pFastBac1 and transferred into bacmid in DH10Bac competent cells. Sf9 cells were transfected with recombinant bacmid using CellFECTIN (Life Technologies) to prepare virus solution, and Sf9 cells were simultaneously infected with the viruses encoding BSP-tagged soluble T3b and {beta}2m.

Soluble T3b-TL/{beta}2m complexes were roughly purified from culture supernatants of infected Sf9 cells with DEAE cellulose (DE52; Whatman, Kent, U.K.) and gel filtration (Superdex 200 HR 10/30; Amersham Pharmacia Biotech). Concentrations of T3b/{beta}2m complexes were approximately determined by sandwich ELISA using anti-TL mAbs (TT213 and HD168 for capturing and developing mAb, respectively). Affinity-purified T3b/{beta}2m was used as the standards. In vitro biotinylation with BirA (Avidity, Boulder, CO), tetramerization by addition of PE-labeled streptavidin (Molecular Probes, Eugene, OR), and purification of tetrameric complexes by gel filtration (Superdex 200 HR 10/30) were performed as described (16, 35).

Flow cytometric analysis and sorting

Cells were incubated with T3b-TL tetramers (10 µg/ml) at 37°C for 30 min and then incubated with fluorescein-labeled mAb at 4°C for 30 min. Flow cytometric analysis and sorting were performed on a FACSCalibur (BD Biosciences Immunocytometry Systems) using CellQuest software.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TL-restricted CTL clones are stained with T3b-TL tetramers in a CD3-dependent manner

In a previous study, we showed most TL-restricted CTL clones to recognize TL expressed on insect cells (10). Based on this evidence, we have chosen soluble T3b-TL/{beta}2m already assembled in insect cells as the source of tetramers. To preserve the association of T3b-TL and {beta}2m (and a possibly presented antigenic molecule derived from insect cells), mild purification procedures were used, and the crude preparation of T3b-TL/{beta}2m complexes was biotinylated with BirA biotin ligase. Most proteins biotinylated in these procedures were confirmed to be T3b-TL by SDS-PAGE (data not shown). After purification with gel filtration, the soluble T3b-TL/{beta}2m complex was multimerized with PE-labeled streptavidin, and tetramerized fractions were isolated by gel filtration, as described (16, 35).

To investigate the binding specificity, TL- and H-2Kb-restricted CTL clones were stained with T3b-TL tetramers. As shown in Fig. 1Go, TL-restricted CTL clones, both TCR{alpha}{beta} and {gamma}{delta} phenotypes, were positive, whereas an H-2Kb-restricted CTL clone (2-8-2) was not. An additional five H-2Kb-restricted CTL clones were tested and found to be unstained (data not shown). Staining intensity roughly correlated with the cytotoxic activity of each CTL clone against TL+ target cells (9). Type I CTL clones that can kill any TL+ target cells were brightly stained, whereas type II CTL clones that can kill TL+ Con A blast cells, but not leukemia cells, were very weakly stained. To assess the binding specificity further, Ab-blocking tests were performed. As shown in Fig. 2Go, T3b-TL tetramer staining of TL-restricted CTL clone TC9-1 was inhibited by anti-TL, CD3, CD8{alpha}, and {beta}2m mAbs. Similar results were also obtained with other CTL clones (data not shown). Because T3b-TL tetramer staining was not clearly inhibited by a mAb against TCR, a mAb against the V{beta} chain was used for blocking experiments. T3b-TL tetramer staining of TC9-1 (expressing V{beta}9) was weakly, but significantly inhibited by anti-V{beta}9 mAb (Fig. 2Go). These results together suggested that the T3b-TL tetramer used in this study is recognizable by TCR/CD3 complexes expressed on TL-restricted CTL clones.



View larger version (69K):
[in this window]
[in a new window]
 
FIGURE 1. Binding specificity of the T3b-TL tetramer to TL-restricted CTL clones. TL (both type I and type II; Ref. 9 )- and H-2Kb-restricted CTL clones were incubated with the PE-labeled T3b-TL tetramer (10 µg/ml) at 37°C for 30 min and analyzed on a FACSCalibur.

 


View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 2. Ab-blocking test for T3b-TL tetramer binding to a TL-restricted CTL clone. The TL-restricted clone TC9-1 (1 x 105) was incubated with T3b-TL tetramer (10 µg/ml) at 37°C for 30 min in the presence or absence of various mAbs (100 µg/ml) and analyzed on a FACSCalibur.

 
Subsequently, we enriched TL-restricted CTL using the T3b-TL tetramer. MLC to generate TL-restricted CTL was conducted as described previously (7, 8, 9), and thereafter, CD8+ cells were fractionated into two groups based on the T3b-TL tetramer reactivity, and their CTL activity against TL+ cells was analyzed. As shown in Fig. 3Go, only T3b-TL tetramer+ cells killed TL+ cells, demonstrating that TL-restricted CTL can be enriched with T3b-TL tetramer.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Enrichment of TL-restricted CTL using the T3b-TL tetramer. A, Sorting. A bulk CTL culture recognizing TL was prepared by MLC, as described previously (7 8 9 ). Cells from MLC were incubated with the PE-labeled T3b-TL tetramer (10 µg/ml) at 37°C for 30 min and then incubated with a FITC-labeled anti-CD8{alpha} mAb at 4°C for 30 min. Both tetramer+CD8+ (Fr.1) and tetramer-CD8+ (Fr.2) were sorted using a FACSCalibur, and their cytotoxicity was tested. B, Cytotoxicity against TL+ cells. Each sorted cell fraction was incubated with 51Cr-labeled T3b transfectants of RMA (10 ) or RMA target cells (2 x 104) for 3 h.

 
Most CD8+ iIEL and CD8+ and CD4+CD8+ thymocytes are stained with T3b-TL tetramer in a CD3-independent manner

To investigate the tissue distribution of TL-reactive cells, T lymphocytes were prepared from various organs of C3H mice (TL- strain) and stained with T3b-TL tetramer. Unexpectedly, large populations of iIEL as well as thymocytes were stained, whereas very few (<0.1%) CD3+ T lymphocytes from the spleen and peripheral lymph nodes were positive (Fig. 4Go). Intestinal IEL and thymocytes were also prepared from other strains, such as TL- B6 and TL transgenic strains, Tg.Con.3-1 expressing T3b-TL ubiquitously, and Tg.Tlaa-3-1 expressing Tlaa-3-TL on thymocytes and intestinal epithelium, and then tested. Both iIEL and thymocytes were also positive (data not shown). When these cells were triple stained with T3b-TL tetramer/CD3/CD45, T3b-TL tetramer+ cells were almost exclusively CD3+CD45+, showing that other hemopoietic cells do not express the molecules interacting with TL (data not shown). Minor populations derived from Peyer’s patches and liver were also stained with the T3b-TL tetramer, but no further analyses were performed on these populations, because the intensity was weak (Fig. 4Go).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 4. Reactivity of the T3b-TL tetramer with T lymphocytes from various tissues. Cells were prepared as described in Materials and Methods, incubated with T3b-TL tetramer (10 µg/ml) at 37°C for 30 min, and finally incubated with CyChrome-labeled anti-CD45/leukocyte common Ag mAb or FITC-labeled anti-CD3 at 4°C for 30 min. CD45+ cells (bone marrow) and CD3+ cells (others) were gated and analyzed on a FACSCalibur. Cells from superficial cervical, axillary, superficial inguinal, or popliteal lymph nodes showed similar FACS profiles. Thus, results with the superficial inguinal lymph nodes are shown as representative.

 
Next, the surface phenotypes of the T3b-TL tetramer-reactive thymocytes and iIEL were analyzed. Both CD4+CD8+ and CD8+ populations from the thymus were stained with the T3b-TL tetramer (Fig. 5Go). As shown in Fig. 6Go, T3b-TL tetramer-reactive iIEL almost exclusively expressed CD8{alpha} molecules, and the type of TCR ({alpha}{beta} or {gamma}{delta}) and CD8 ({alpha}{beta} or {alpha}{alpha}) and the expression of Thy-1 did not seem to correlate with T3b-TL tetramer binding. To analyze the binding specificity of the T3b-TL tetramer to these lymphocyte populations, Ab-blocking tests were performed. The results showed that the binding was inhibited by anti-CD8{alpha}, TL, and {beta}2m mAb, but not by anti-CD3 mAb (Fig. 7Go), in contrast to the binding to TL-restricted CTL, suggesting that T3b-TL tetramer binding to iIEL and thymocytes is CD8 dependent, but TCR/CD3 independent.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 5. Surface phenotype of thymocytes reacting with the T3b-TL tetramer. Thymocytes obtained from C3H mouse were incubated with the T3b-TL tetramer (10 µg/ml) at 37°C for 30 min and then incubated with FITC-labeled anti-CD4 and CyChrome-labeled anti-CD8{alpha} at 4°C for 30 min. Stained cells were classified into four fractions based on CD4/CD8 expression, and their T3b-TL tetramer reactivity was analyzed on a FACS-Calibur. The percentage of each fraction is as follows: CD4CD8 double- positive (DP), 85.6%; CD4CD8 double-negative (DN), 3.9%; CD4 single- positive (SP), 8.3%; and CD8SP, 2.2%.

 


View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 6. Surface phenotype of iIEL reacting with the T3b-TL tetramer. iIEL obtained from C3H mouse were incubated with T3b-TL tetramer (10 µg/ml) at 37°C for 30 min, and then incubated with CyChrome-labeled anti-CD8{alpha} mAb, and various mAb labeled with FITC at 4°C for 30 min. T3b-TL tetramer-reactive cells were gated, and their surface phenotype was analyzed on a FACSCalibur.

 


View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 7. Ab-blocking test for the T3b-TL tetramer binding to thymocytes or iIEL. Thymocytes or iIEL (1 x 105) from C3H mouse were incubated with the T3b-TL tetramer (10 µg/ml) at 37°C for 30 min in the presence or absence of various mAbs (100 µg/ml) and analyzed on a FACS-Calibur. A mixture of mAbs against TCR{alpha}{beta} and TCR{gamma}{delta} was used for blocking and indicated as anti-TCR.

 
To analyze the binding specificity further, various mutant mice were used. First, to investigate whether the T3b-TL tetramer binds to CD8+ thymocytes and/or iIEL expressing irrelevant TCR to TL, DO11.10/Rag2-/- mice (24, 25) were used. As shown in Fig. 8Go, thymocytes and iIEL from these mice expressing a monomorphic TCR (detectable with KJ1-26 mAb) were positively stained with the T3b-TL tetramer, suggesting that the binding is TCR/CD3 independent. Next, we used CD8{alpha}-/- mice to investigate CD8 dependence of T3b-TL tetramer binding to thymocytes and iIEL, because most of them express CD8{alpha} and the binding was blocked almost completely with CD8{alpha} mAb. As shown in Fig. 9Go, thymocytes and iIEL from CD8{alpha}-/- mice were not stained with the T3b-TL tetramer, suggesting that the CD8 molecule is indispensable for T3b-TL tetramer binding.



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 8. T3b-TL tetramer binding to CD8+ thymocytes and iIEL from TCR transgenic mice. For tetramer staining, thymocytes and iIEL (1 x 105) from DO11.10 TCR transgenic mice crossed with Rag2-/- mice (DO11.10/Rag2-/- mice) were incubated with the PE-labeled T3b-TL tetramer (10 µg/ml) at 37°C for 30 min and then with an FITC-labeled anti-CD8{alpha} mAb at 4°C for 30 min. For DO11.10 TCR staining, cells were incubated with biotinylated anti-idiotype mAb (KJ1-26) at 4°C for 30 min and then with PE-labeled streptavidin at 4°C for 30 min. Cells were analyzed on a FACSCalibur, and the results obtained for CD8+ populations are shown.

 


View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 9. No binding of T3b-TL tetramer to thymocytes and iIEL from CD8{alpha}-/- mice. Thymocytes or iIEL from CD8{alpha}-/- mice were incubated with the PE-labeled T3b-TL tetramer (10 µg/ml) at 37°C for 30 min and then incubated with an FITC-labeled anti-CD3 mAb and a CyChrome-labeled anti-CD8{alpha} mAb at 4°C for 30 min. CD3+ cells were gated and analyzed.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As reported for most MHC class I and class II tetramers containing appropriate antigenic peptides, the T3b-TL tetramer used in this study also binds to TL-restricted CTL in a TCR/CD3-dependent manner. Because precise information about the nature of antigenic molecules presented by TL is not available, a soluble T3b-TL molecule was prepared from insect cells transfected with the T3b TL gene, not including the sequence encoding Ag peptides. However, the possibility still remains that T3b-TL/{beta}2m is associated with an antigenic molecule derived from insect cells. The present study demonstrated that the staining intensity of CTL clones roughly correlated with the cytotoxic activity against TL+ target cells, and that TL-restricted CTL could be enriched by selecting the tetramer-positive population. These results altogether showed that the T3b-TL tetramer prepared in this study is useful for monitoring the dynamics and magnitude of T cell responses against TL, similarly to other monitoring methods, such as cytoplasmic IFN-{gamma} staining and CTL assays, as we reported previously (36), although blocking tests with anti-CD3 mAb should be performed to confirm the specificity of the tetramer binding. Studies are now in progress to compare these monitoring methods to determine which one is reliable to predict in vivo antitumor responses against TL-positive tumors.

In addition to the TCR/CD3-dependent binding of the T3b-TL tetramer to TL-restricted CTL populations, we also showed its CD8-dependent, but TCR/CD3-independent binding to thymocytes and iIEL. Because the binding to iIEL and thymocytes was almost completely inhibited by an anti-CD8{alpha} mAb, the CD8 molecule on T lymphocytes is indispensable for the binding. Thus, the important question needing to be answered is whether 1) the CD8 molecule alone is sufficient for the binding, or 2) CD8 plus another molecule expressed on TL tetramer-positive iIEL and thymocytes are necessary.

Up to the present, three groups of molecules other than the TCR/CD3 complex are reported to interact with MHC tetramers: 1) CD8 (37), 2) NK receptors (20), and 3) molecules belonging to the Ig supergene family (21). The recent report (37) that some human MHC tetramers bind to CD8+ T lymphocytes expressing irrelevant TCR in a dose-dependent manner suggests a possibility that the TL tetramer binds to CD8 without additional molecules. This possibility is supported by the finding that the binding affinity between murine MHC class I and murine CD8 is somehow stronger than that observed in human counterparts (reviewed in Ref. 38). TL molecule was also found to bind to human CD8-transfected Chinese hamster ovary cells (39). However, in the present study, the TL tetramer did not interact with lymphocytes from spleen and peripheral lymph nodes, even though they express almost the same amounts of CD8 on their cell surfaces. In addition, there is no difference in the intensity of T3b-TL tetramer staining between CD8{alpha}{alpha}+ and CD8{alpha}{beta}+ populations of iIEL, indicating that the composition of CD8 ({alpha}{alpha} vs {alpha}{beta}) does not affect the tetramer binding. Therefore, CD8 molecules expressed on iIEL and thymocytes must be distinct from those on peripheral T lymphocytes in their conformation and/or posttranscriptional modifications, if TL interacts with CD8 without additional molecule(s). Recently, Daniels and Jameson (40) reported that CD8 plays a critical role in interactions between TCR and MHC multimer, and that anti-CD8{alpha} mAbs can exert either blocking or augmenting influence, depending on the epitopes detected. Our present study showed that an anti-CD8{alpha} mAb (clone 35-17-2) blocked the binding of T3b-TL tetramer to iIEL, thymocytes, or CTL, but our preliminary results showed that binding to CTL was not affected or even slightly augmented by another mAb (clone 53-6.7), which was referred as an augmenting Ab by them. This may point to conformational differences in CD8 molecules expressed on TL tetramer-positive and -negative lymphocyte populations. However, at this moment there is no clear experimental evidence in support of this conclusion.

Another possibility is that CD8 plus another molecule expressed on TL tetramer-positive iIEL and thymocytes are necessary for the binding. A first candidate for our unknown molecule might be an NK receptor (20). However, our preliminary study showed that NK1.1+ cells from B6 mice were not stained with the TL tetramer, suggesting that typical NK receptors are probably not, although the coexpression with CD8 may facilitate binding to the TL tetramer. Another candidate group is that of Ig supergene family molecules, such as Ig-like transcript-2 and -4, which are the ligands for HLA-G (21). However, these molecules are reported to be expressed on blood monocytes, but not on lymphocytes in humans, suggesting that these mouse homologues are probably not the ligands for TL. Recently, Wang et al. (41) reported a novel, but enigmatic Qa-1-binding molecule on CD8+ cells, which seemed to be different from the possible TL ligand, because it is expressed by virtually all CD8+ cells derived from various lymphoid tissues, and its Qa-1 binding is not inhibited by an anti-CD8 mAb. To define TL-binding molecule(s), biochemical analyses have been attempted in our laboratory, but to date without success. This may be due to the low binding affinity between TL and its ligand itself, which can easily be speculated from the present findings that either the absence of CD8 on iIEL and thymocytes from the gene knockout or anti-CD8 mAb blocking completely abrogates T3b-TL tetramer binding. We also plan to produce a mAb to inhibit TL tetramer binding to iIEL and/or thymocytes, and thereby detect molecules that are indispensable for the binding together with CD8.

TL is known to be expressed on intestinal epithelium of all mouse strains and cortical thymocytes of certain strains, but little is known about its function as an MHC class Ib molecule. Based on the present finding that the TL tetramer binds to iIEL and CD4+CD8+ thymocytes, it is conceivable that these tetramer-positive lymphocyte populations interact in situ with TL expressed on intestinal epithelial cells and cortical thymocytes and play an important role in host defense. With the soluble TL molecule prepared in this study, it may be possible to define the Ag molecule presented by TL and elucidate the physiological function of TL in vivo.


    Acknowledgments
 
We are grateful to Drs. J. A. Bluestone, K. Iwabuchi, R. T. Kubo, H. Shiku, N. Shinohara, N. Tada, S. Tonegawa, and M. Watanabe for their kind gifts of various materials used in this study. We thank Dr. M. A. Moore for his editorial assistance.


    Footnotes
 
1 This work was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Science, Sports, and Technology, Japan; a special project grant from Aichi Cancer Center; a Bristol-Myers Squibb Research Grant; and an Imanaga Medical Research Grant. Back

2 Address correspondence and reprint requests to Dr. Kunio Tsujimura, Division of Immunology, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan. E-mail address: ktsujimu{at}aichi-cc.pref.aichi.jp Back

3 Current address: Department of Biological Systems, RIKEN BioResource Center, Tsukuba Institute, RIKEN, 3-1-1 Koyadai, Tsukuba 305-0074, Japan. Back

4 Abbreviations used in this paper: TL, thymus leukemia; {beta}2m, {beta}2-microglobulin; BSP, biotin-specific peptide; IEL, intraepithelial lymphocyte(s); iIEL, intestinal IEL. Back

Received for publication March 5, 2001. Accepted for publication May 9, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Klein, J.. 1986. Natural History of the Major Histocompatibility Complex Wiley & Sons, New York.
  2. Shawar, S. M., J. M. Vyas, J. R. Rodgers, R. R. Rich. 1994. Antigen presentation by major histocompatibility complex class I-B molecules. Annu. Rev. Immunol. 12:839.[Medline]
  3. Old, L. J., E. Stockert. 1977. Immunogenetics of cell surface antigens of mouse leukemia. Annu. Rev. Genet. 11:127.[Medline]
  4. Chen, Y.-T., Y. Obata, E. Stockert, T. Takahashi, L. J. Old. 1987. Tla-region genes and their products. Immunol. Res. 6:30.[Medline]
  5. Hershberg, R., P. Eghtesady, B. Sydora, K. Brorson, H. Cheroutre, R. Modlin, M. Kronenberg. 1990. Expression of the thymus leukemia antigen in mouse intestinal epithelium. Proc. Natl. Acad. Sci. USA 87:9727.[Abstract/Free Full Text]
  6. Wu, M., L. Van Kaer, S. Itohara, S. Tonegawa. 1991. Highly restricted expression of the thymus leukemia antigens on intestinal epithelial cells. J. Exp. Med. 174:213.[Abstract/Free Full Text]
  7. Morita, A., T. Takahashi, E. Stockert, E. Nakayama, T. Tsuji, Y. Matsudaira, L. J. Old, Y. Obata. 1994. TL antigen as a transplantation antigen recognized by TL-restricted cytotoxic T cells. J. Exp. Med. 179:777.[Abstract/Free Full Text]
  8. Tsujimura, K., T. Takahashi, A. Morita, H. Hasegawa-Nishiwaki, S. Iwase, Y. Obata. 1996. Positive selection of {gamma}{delta} CTL by TL antigen expressed in the thymus. J. Exp. Med. 184:2175.[Abstract/Free Full Text]
  9. Tsujimura, K., T. Takahashi, S. Iwase, Y. Matsudaira, Y. Kaneko, H. Yagita, Y. Obata. 1998. Two types of anti-TL (thymus leukemia) CTL clones with distinct target specificities: differences in cytotoxic mechanisms and accessory molecule requirements. J. Immunol. 160:5253.[Abstract/Free Full Text]
  10. Tsujimura, K., Y. Obata, S. Iwase, Y. Matsudaira, S. Ozeki, T. Takahashi. 2000. The epitope detected by cytotoxic T lymphocytes against thymus leukemia (TL) antigen is TAP independent. Int. Immunol. 12:1217.[Abstract/Free Full Text]
  11. Holcombe, H. R., A. R. Castaño, H. Cheroutre, M. Teitell, J. K. Maher, P. A. Peterson, M. Kronenberg. 1995. Nonclassical behavior of the thymus leukemia antigen: peptide transporter-independent expression of a nonclassical class I molecule. J. Exp. Med. 181:1433.[Abstract/Free Full Text]
  12. Rodgers, J. R., V. Mehta, R. G. Cook. 1995. Surface expression of {beta}2-microglobulin-associated thymus-leukemia antigen is independent of TAP2. Eur. J. Immunol. 25:1001.[Medline]
  13. Joyce, S., I. Negishi, A. Boesteanu, A. D. DeSilva, P. Sharma, M. J. Chorney, D. Y. Loh, L. Van Kaer. 1996. Expansion of natural (NK1+) T cells that express {alpha}{beta} T cell receptors in transporters associated with antigen presentation-1 null and thymus leukemia antigen positive mice. J. Exp. Med. 184:1579.[Abstract/Free Full Text]
  14. Germain, R. N.. 1994. MHC-dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell 76:287.[Medline]
  15. Kronenberg, M., L. Brossay, Z. Kurepa, J. Forman. 1999. Conserved lipid and peptide presentation functions of nonclassical class I molecules. Immunol. Today 20:515.[Medline]
  16. Altman, J. D., P. A. H. Moss, P. J. R. Goulder, D. H. Barouch, M. G. McHeyzer-Williams, J. I. Bell, A. J. McMichael, M. M. Davis. 1996. Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94.[Abstract/Free Full Text]
  17. Pittet, M. J., D. Valmori, P. R. Dunbar, D. E. Speiser, D. Lienard, F. Lejeune, K. Fleischhauer, V. Cerundolo, J. C. Cerottini, P. Romero. 1999. High frequencies of naive Melan-A/MART-1-specific CD8+ T cells in a large proportion of human histocompatibility leukocyte antigen (HLA)-A2 individuals. J. Exp. Med. 190:705.[Abstract/Free Full Text]
  18. McMichael, A. J., C. A. O’Callaghan. 1998. A new look at T cells. J. Exp. Med. 187:1367.[Free Full Text]
  19. Ferlin, W., N. Glaichenhaus, E. Mougneau. 2000. Present difficulties and future promise of MHC multimers in autoimmune exploration. Curr. Opin. Immunol. 12:670.[Medline]
  20. Hanke, T., H. Takizawa, C. W. McMahon, D. H. Busch, E. G. Pamer, J. D. Miller, J. D. Altman, Y. Liu, D. Cado, F. A. Lemonnier, et al 1999. Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity 11:67.[Medline]
  21. Allan, D. S., M. Colonna, L. L. Lanier, T. D. Churakova, J. S. Abrams, S. A. Ellis, A. J. McMichael, V. M. Braud. 1999. Tetrameric complexes of human histocompatibility leukocyte antigen (HLA)-G bind to peripheral blood myelomonocytic cells. J. Exp. Med. 189:1149.[Abstract/Free Full Text]
  22. Hamasima, N., T. Takahashi, O. Taguchi, Y. Nishizuka, E. Stockert, L. J. Old, Y. Obata. 1989. Expression of TL, H-2, and chimeric H-2/TL genes in transgenic mice: abnormal thymic differentiation and T-cell lymphomas in a TL transgenic strain. Proc. Natl. Acad. Sci. USA 86:7995.[Abstract/Free Full Text]
  23. Obata, Y., O. Taguchi, Y. Matsudaira, H. Hasegawa, N. Hamasima, T. Takahashi. 1991. Abnormal thymic development, impaired immune function and {gamma}{delta} T cell lymphomas in a TL transgenic mouse strain. J. Exp. Med. 174:351.[Abstract/Free Full Text]
  24. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  25. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, F. W. Alt. 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68:855.[Medline]
  26. Lefrançois, L., and N. Lycke. 1996. Isolation of mouse small intestinal intraepithelial lymphocytes, Peyer’s patch, and lamina propria cells. In Current Protocols in Immunology, Vol. 1. J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, and W. Strober, eds. Wiley & Sons, New York, p. 3.19.1.
  27. Watanabe, H., K. Ohtsuka, M. Kimura, Y. Ikarashi, K. Ohmori, A. Kusumi, T. Ohteki, S. Seki, T. Abo. 1992. Details of an isolation method for hepatic lymphocytes in mice. J. Immunol. Methods 146:145.[Medline]
  28. Obata, Y., Y. T. Chen, E. Stockert, L. J. Old. 1985. Structural analysis of TL genes of the mouse. Proc. Natl. Acad. Sci. USA 82:5475.[Abstract/Free Full Text]
  29. Leo, O., M. Foo, D. H. Sachs, L. E. Samelson, J. A. Bluestone. 1987. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc. Natl. Acad. Sci. USA 84:1374.[Abstract/Free Full Text]
  30. Kubo, R. T., W. Born, J. W. Kappler, P. Marrack, M. Pigeon. 1989. Characterization of a monoclonal antibody which detects all murine {alpha}{beta} T cell receptors. J. Immunol. 142:2736.[Abstract]
  31. Itohara, S., N. Nakanishi, O. Kanagawa, R. Kubo, S. Tonegawa. 1989. Monoclonal antibodies specific to native murine T-cell receptor {gamma}{delta}: analysis of {gamma}{delta} T cells during thymic ontogeny and in peripheral lymphoid organs. Proc. Natl. Acad. Sci. USA 86:5094.[Abstract/Free Full Text]
  32. Dialynas, D. P., Z. S. Quan, K. A. Wall, A. Pierres, J. Quintáns, M. R. Loken, M. Pierres, F. W. Fitch. 1983. Characterization of the murine T cell surface molecule, designated L3T4, identified by monoclonal antibody GK1.5: similarity of L3T4 to the human Leu-3/T4 molecule. J. Immunol. 131:2445.[Abstract]
  33. Tada, N., S. Kimura, A. Hatzfeld, U. Hammerling. 1980. Ly-m11: the H-3 region of mouse chromosome 2 controls a new surface alloantigen. Immunogenetics 11:441.[Medline]
  34. Haskins, K., R. Kubo, J. White, M. Pigeon, J. Kappler, P. Marrack. 1983. The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J. Exp. Med. 157:1149.[Abstract/Free Full Text]
  35. Busch, D. H., I. M. Pilip, S. Vijh, E. G. Pamer. 1998. Coordinate regulation of complex T cell populations responding to bacterial infection. Immunity 8:353.[Medline]
  36. Iwase, S., K. Tsujimura, Y. Matsudaira, S. Ozeki, K. Onozaki, Y. Obata, T. Takahashi. 2000. Comparison of anti-tumor responses against TL positive lymphoma induced by skin grafting and dendritic cell immunization. Microbiol. Immunol. 44:609.[Medline]
  37. Bodinier, M., M. A. Peyrat, C. Tournay, F. Davodeau, F. Romagne, M. Bonneville, F. Lang. 2000. Efficient detection and immunomagnetic sorting of specific T cells using multimers of MHC class I and peptide with reduced CD8 binding. Nat. Med. 6:707.[Medline]
  38. Gao, G. F., B. K. Jakobsen. 2000. Molecular interactions of coreceptor CD8 and MHC class I: the molecular basis for functional coordination with the T-cell receptor. Immunol. Today 21:630.[Medline]
  39. Teitell, M., M. F. Mescher, C. A. Olson, D. R. Littman, M. Kronenberg. 1991. The thymus leukemia antigen binds human and mouse CD8. J. Exp. Med. 174:1131.[Abstract/Free Full Text]
  40. Daniels, M. A., S. C. Jameson. 2000. Critical role for CD8 in T cell receptor binding and activation by peptide/major histocompatibility complex multimers. J. Exp. Med. 191:335.[Abstract/Free Full Text]
  41. Wang, R., S. Ramaswamy, D. Hu, H. Cantor. 2001. Definition of a novel binding site on CD8 cells for a conserved region of the MHC class Ib molecule Qa-1 that regulates IFN-{gamma} expression. Eur. J. Immunol. 31:87.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
N. Pardigon, K. Takeda, B. Saunier, F. Hornung, J. Gibbs, A. Weisberg, N. Contractor, B. Kelsall, J. R. Bennink, and J. W. Yewdell
CD8{alpha}{alpha}-Mediated Intraepithelial Lymphocyte Snatching of Thymic Leukemia MHC Class Ib Molecules In Vitro and In Vivo
J. Immunol., August 1, 2006; 177(3): 1590 - 1598.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Attinger, L. Devine, Y. Wang-Zhu, D. Martin, J.-h. Wang, E. L. Reinherz, M. Kronenberg, H. Cheroutre, and P. Kavathas
Molecular Basis for the High Affinity Interaction between the Thymic Leukemia Antigen and the CD8{alpha}{alpha} Molecule
J. Immunol., March 15, 2005; 174(6): 3501 - 3507.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
N. Pardigon, S. Darche, B. Kelsall, J. R. Bennink, and J. W. Yewdell
The TL MHC class Ib molecule has only marginal effects on the activation, survival and trafficking of mouse small intestinal intraepithelial lymphocytes
Int. Immunol., September 1, 2004; 16(9): 1305 - 1313.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. Tsujimura, Y. Obata, E. Kondo, K. Nishida, Y. Matsudaira, Y. Akatsuka, K. Kuzushima, and T. Takahashi
Thymus leukemia antigen (TL)-specific cytotoxic T lymphocytes recognize the {alpha}1/{alpha}2 domain of TL free from antigenic peptides
Int. Immunol., November 1, 2003; 15(11): 1319 - 1326.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Weber, A. Attinger, C. C. Kemball, J. L. Wigal, J. Pohl, Y. Xiong, E. L. Reinherz, H. Cheroutre, M. Kronenberg, and P. E. Jensen
Peptide-Independent Folding and CD8{alpha}{alpha} Binding by the Nonclassical Class I Molecule, Thymic Leukemia Antigen
J. Immunol., November 15, 2002; 169(10): 5708 - 5714.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Devine, L. Rogozinski, O. V. Naidenko, H. Cheroutre, and P. B. Kavathas
The Complementarity-Determining Region-Like Loops of CD8{alpha} Interact Differently with {beta}2-Microglobulin of the Class I Molecules H-2Kb and Thymic Leukemia Antigen, While Similarly with Their {alpha}3 Domains
J. Immunol., April 15, 2002; 168(8): 3881 - 3886.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsujimura, K.
Right arrow Articles by Takahashi, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS