|
|
||||||||


*
Division of Immunology, Aichi Cancer Center Research Institute, Nagoya, Japan; and
Second Department of Pathology, Aichi Medical University, Nagakute, Japan
| Abstract |
|---|
|
|
|---|

and TCR
CTL
with TL, but not H-2 restriction. We previously reported that the CTL
epitope is TAP independent, but the antigenic molecule(s) presented by
TL has yet to be determined. In the present study, TL tetramers were
prepared with T3b-TL and murine
2-microglobulin, not including antigenic peptides, and
binding specificity was studied. CTL clones against TL Ags were stained
with the T3b-TL tetramer, and the binding shown to be CD3
and CD8 dependent. Normal lymphocytes from various origins were also
studied. Surprisingly, most CD8+ intraepithelial
lymphocytes derived from the small intestines (iIEL), as well as
CD8+ and CD4+CD8+ thymocytes, were
stained, while only very minor populations of CD8+ cells
derived from other peripheral lymphoid tissues, such as spleen and
lymph nodes, were positive. The binding of T3b-TL tetramers
to CD8+ iIEL and thymocytes was CD8 dependent, but CD3
independent, in contrast to that to TL-restricted CTL. These results
altogether showed that TL-restricted CTL can be monitored by
CD3-dependent binding of T3b-TL tetramers. In addition,
CD3-independent T3b-TL tetramer binding to iIEL and
thymocytes may imply that TL expressed on intestinal epithelium and
cortical thymocytes has a physiological function interacting with these
tetramer+CD8+ T
lymphocytes. | Introduction |
|---|
|
|
|---|
In our previous studies, we showed that TL can be recognized by both
TCR
and TCR
CTL (7, 8, 9). Because the cytotoxic
activity of these CTL is inhibited by TL, but not by anti-H-2 Abs,
it was concluded that recognition of TL is direct without any
requirement for Ag presentation by H-2 molecules. Recent studies
conducted by ourselves and other investigators have demonstrated that
TL molecules are transported to and stably expressed on the surfaces of
TAP-deficient cells (10, 11, 12, 13). We further showed that most
TL-restricted CTL recognize the epitope(s), expressed on TL in a
TAP-independent manner (10). However, it has not been
determined whether TL can present the Ag molecule(s), as in the cases
of MHC class Ia and II (14) and some MHC class Ib
molecules (15).
Recent progress in molecular biology has allowed production of MHC tetramers as important tools to identify Ag-specific T lymphocytes by flow cytometry (16). The dynamics and magnitude of T cell responses in immunity against tumors and pathogens and in autoimmune diseases have thereby been characterized (17, 18, 19). Furthermore, this new tool has been shown to be useful in the search for natural ligands for MHC other than TCR (20, 21).
In the present study, we prepared TL tetramers consisting of
T3b-TL and
2-microglobulin (
2m),
not including antigenic peptides, and studied the binding specificity
to TL-restricted CTL. Normal lymphocytes of various origins were also
examined to identify natural ligand(s) for TL and elucidate the
physiological function(s) of TL themselves and recognizing T
lymphocytes.
| Materials and Methods |
|---|
|
|
|---|
The derivation of the transgenic mouse strains used in this
study has been described previously (22, 23). Tg.Con.3-1,
having a chimeric gene in which the T3b gene
from C57BL/6 (B6) is driven by the H-2Kb
promoter, expresses T3b-TL ubiquitously. Another
strain, Tg.Tlaa-3-1, having a
Tlaa-3 transgene (from
A-strain) with its own promoter, expresses
Tlaa-3-TL predominantly on thymocytes and
intestinal epithelial cells. These transgenic mice were generated on a
C3H background, without TL expression in the thymus, but with
expression of T3k-TL in the intestine. C3H and B6
mice were purchased from Japan SLC (Hamamatsu, Japan), and CD8
knockout mice from The Jackson Laboratory (Bar Harbor, ME). DO11.10-TCR
transgenic mice crossed with Rag2-/- mice
(DO11.10/Rag2-/-; Refs. 24, 25)
were kindly provided by K. Iwabuchi (Hokkaido University, Sapporo,
Japan).
Cells
CTL clones against TL or H-2Kb were established as previously described (7, 8, 9, 10). Intraepithelial lymphocytes (IEL) from the small intestines (iIEL) (26) and lymphocytes from Peyers patches (26) and liver (27) were prepared as described.
Antibodies
Rat mAb against TL (HD168; Ref. 28) and mouse mAb
to TL.2 (TT213; Ref. 7) were described previously. The
following mAbs were kindly provided by other investigators, as detailed
earlier (7, 8, 9, 10): hamster mAb against CD3 (145-2C11; Ref.
29), TCR
(H57-597; Ref. 30), and
TCR
(3A10; Ref. 31); rat mAb against L3T4/CD4
(GK1.5; Ref. 33) and Lyt-2/CD8
(35-17-2; kindly
provided by N. Shinohara, Kitasato University, Sagamihara, Japan); and
mouse mAb against
2m (S19.8; Ref. 33). IgG
fractions were obtained from ascitic fluid-bearing hybridomas producing
the mAbs described above with protein G-Sepharose (Amersham Pharmacia
Biotech, Uppsala, Sweden), and used for blocking assays. The following
mAbs were purchased: purified mouse mAb against V
9 (MR10-2;
PharMingen, San Diego, CA); FITC-labeled rat mAb against Thy-1.2
(30-H12; BD Biosciences Immunocytometry Systems, Mountain View, CA),
L3T4/CD4 (GK1.5; PharMingen), and Lyt-2/CD8
(53-6.7; PharMingen);
hamster mAbs against anti-CD3 (145-2C11; PharMingen), TCR
(H57-597; Cedarlane Laboratories, Hornby, Ontario, Canada), and
TCR
(GL3; Cedarlane Laboratories); mouse mAb against
Lyt-3.2/CD8
(53-5.8; PharMingen); and CyChrome-labeled rat mAbs
against Ly-5/CD45 (30-F11; PharMingen) and Lyt-2/CD8
(53-6.7;
PharMingen). Biotinylated mouse mAb against DO11.10-TCR (KJ1-26; Ref.
34) was kindly provided by K. Iwabuchi.
Construction of T3b-TL tetramers
Tetrameric
T3b-TL/
2m complexes were
constructed as recently described (16, 35). A cDNA
encoding a GlySer linker and a biotin-specific peptide (BSP) was fused
to the 3' end of the truncated T3b
(encoding from the leader sequence to aa 279) by PCR with the 5' primer
GGAATTCATGAGGATGGGGACCATG and the 3' primer
GCGCAAGCTTTTAACGATGATTCCACACCATTTTCTGTGCATCCAGAATATGATGCAGGGATCCGGTCTGAGGAAGCTCCTCCCA,
using the plasmid T3b-pUC19 (10) as
the template. The 5' and 3' primers were tagged with EcoRI
and HindIII sites, respectively. cDNA encoding murine
2m was prepared by PCR with the 5' primer
CGGGATCCATGGCTCGCTCGGTGACC and the 3' primer
GCGCAAGCTTTCACATGTCTCGATCCCAGTA using the plasmid
2m-pUC19 (10). The 5' and 3'
primers were tagged with BamHI and HindIII sites,
respectively.
Baculoviruses containing BSP-tagged soluble T3b
or
2m cDNA were prepared using Bac-to-Bac
baculovirus expression systems (Life Technologies, Gaithersburg, MD),
according to the manufacturers instructions. Briefly, BSP-tagged
soluble T3b and
2m cDNAs
were inserted into EcoRI/HindIII and
BamHI/HindIII sites, respectively, of the plasmid
pFastBac1 and transferred into bacmid in DH10Bac competent cells. Sf9
cells were transfected with recombinant bacmid using CellFECTIN
(Life Technologies) to prepare virus solution, and Sf9 cells were
simultaneously infected with the viruses encoding BSP-tagged soluble
T3b and
2m.
Soluble T3b-TL/
2m
complexes were roughly purified from culture supernatants of infected
Sf9 cells with DEAE cellulose (DE52; Whatman, Kent, U.K.) and gel
filtration (Superdex 200 HR 10/30; Amersham Pharmacia Biotech).
Concentrations of T3b/
2m
complexes were approximately determined by sandwich ELISA using
anti-TL mAbs (TT213 and HD168 for capturing and developing mAb,
respectively). Affinity-purified
T3b/
2m was used as the
standards. In vitro biotinylation with BirA (Avidity, Boulder,
CO), tetramerization by addition of PE-labeled streptavidin (Molecular
Probes, Eugene, OR), and purification of tetrameric complexes by gel
filtration (Superdex 200 HR 10/30) were performed as described
(16, 35).
Flow cytometric analysis and sorting
Cells were incubated with T3b-TL tetramers (10 µg/ml) at 37°C for 30 min and then incubated with fluorescein-labeled mAb at 4°C for 30 min. Flow cytometric analysis and sorting were performed on a FACSCalibur (BD Biosciences Immunocytometry Systems) using CellQuest software.
| Results |
|---|
|
|
|---|
In a previous study, we showed most TL-restricted CTL clones to
recognize TL expressed on insect cells (10). Based on this
evidence, we have chosen soluble
T3b-TL/
2m already
assembled in insect cells as the source of tetramers. To preserve the
association of T3b-TL and
2m (and a possibly presented antigenic
molecule derived from insect cells), mild purification procedures were
used, and the crude preparation of
T3b-TL/
2m complexes was
biotinylated with BirA biotin ligase. Most proteins biotinylated in
these procedures were confirmed to be T3b-TL by
SDS-PAGE (data not shown). After purification with gel filtration, the
soluble T3b-TL/
2m
complex was multimerized with PE-labeled streptavidin, and tetramerized
fractions were isolated by gel filtration, as described (16, 35).
To investigate the binding specificity, TL- and
H-2Kb-restricted CTL clones were stained with
T3b-TL tetramers. As shown in Fig. 1
, TL-restricted CTL clones, both TCR
and 
phenotypes, were
positive, whereas an H-2Kb-restricted CTL clone
(2-8-2) was not. An additional five
H-2Kb-restricted CTL clones were tested and found
to be unstained (data not shown). Staining intensity roughly correlated
with the cytotoxic activity of each CTL clone against
TL+ target cells (9). Type I CTL
clones that can kill any TL+ target cells were
brightly stained, whereas type II CTL clones that can kill
TL+ Con A blast cells, but not leukemia cells,
were very weakly stained. To assess the binding specificity further,
Ab-blocking tests were performed. As shown in Fig. 2
, T3b-TL tetramer staining of TL-restricted CTL
clone TC9-1 was inhibited by anti-TL, CD3, CD8
, and
2m mAbs. Similar results were also obtained
with other CTL clones (data not shown). Because
T3b-TL tetramer staining was not clearly
inhibited by a mAb against TCR, a mAb against the V
chain was used
for blocking experiments. T3b-TL tetramer
staining of TC9-1 (expressing V
9) was weakly, but significantly
inhibited by anti-V
9 mAb (Fig. 2
). These results together
suggested that the T3b-TL tetramer used in this
study is recognizable by TCR/CD3 complexes expressed on TL-restricted
CTL clones.
|
|
|
To investigate the tissue distribution of TL-reactive cells, T
lymphocytes were prepared from various organs of C3H mice
(TL- strain) and stained with
T3b-TL tetramer. Unexpectedly, large populations
of iIEL as well as thymocytes were stained, whereas very few (<0.1%)
CD3+ T lymphocytes from the spleen and peripheral
lymph nodes were positive (Fig. 4
). Intestinal IEL and thymocytes were also prepared from other strains,
such as TL- B6 and TL transgenic strains,
Tg.Con.3-1 expressing T3b-TL ubiquitously, and
Tg.Tlaa-3-1 expressing
Tlaa-3-TL on thymocytes and intestinal
epithelium, and then tested. Both iIEL and thymocytes were also
positive (data not shown). When these cells were triple stained with
T3b-TL tetramer/CD3/CD45,
T3b-TL tetramer+ cells were
almost exclusively
CD3+CD45+, showing that
other hemopoietic cells do not express the molecules interacting with
TL (data not shown). Minor populations derived from Peyers patches
and liver were also stained with the T3b-TL
tetramer, but no further analyses were performed on these populations,
because the intensity was weak (Fig. 4
).
|
molecules, and the type of TCR (
or 
) and
CD8 (
or 
) and the expression of Thy-1 did not seem to
correlate with T3b-TL tetramer binding. To
analyze the binding specificity of the T3b-TL
tetramer to these lymphocyte populations, Ab-blocking tests were
performed. The results showed that the binding was inhibited by
anti-CD8
, TL, and
2m mAb, but not by
anti-CD3 mAb (Fig. 7
|
|
|
-/-
mice to investigate CD8 dependence of T3b-TL
tetramer binding to thymocytes and iIEL, because most of them express
CD8
and the binding was blocked almost completely with CD8
mAb.
As shown in Fig. 9
-/- mice were
not stained with the T3b-TL tetramer, suggesting
that the CD8 molecule is indispensable for T3b-TL
tetramer binding.
|
|
| Discussion |
|---|
|
|
|---|
2m is associated
with an antigenic molecule derived from insect cells. The present study
demonstrated that the staining intensity of CTL clones roughly
correlated with the cytotoxic activity against
TL+ target cells, and that TL-restricted CTL
could be enriched by selecting the tetramer-positive population. These
results altogether showed that the T3b-TL
tetramer prepared in this study is useful for monitoring the dynamics
and magnitude of T cell responses against TL, similarly to other
monitoring methods, such as cytoplasmic IFN-
staining and CTL
assays, as we reported previously (36), although blocking
tests with anti-CD3 mAb should be performed to confirm the
specificity of the tetramer binding. Studies are now in progress to
compare these monitoring methods to determine which one is reliable to
predict in vivo antitumor responses against TL-positive tumors.
In addition to the TCR/CD3-dependent binding of the
T3b-TL tetramer to TL-restricted CTL populations,
we also showed its CD8-dependent, but TCR/CD3-independent binding to
thymocytes and iIEL. Because the binding to iIEL and thymocytes was
almost completely inhibited by an anti-CD8
mAb, the CD8 molecule
on T lymphocytes is indispensable for the binding. Thus, the important
question needing to be answered is whether 1) the CD8 molecule alone is
sufficient for the binding, or 2) CD8 plus another molecule expressed
on TL tetramer-positive iIEL and thymocytes are necessary.
Up to the present, three groups of molecules other than the TCR/CD3
complex are reported to interact with MHC tetramers: 1) CD8
(37), 2) NK receptors (20), and 3) molecules
belonging to the Ig supergene family (21). The recent
report (37) that some human MHC tetramers bind to
CD8+ T lymphocytes expressing irrelevant TCR in a
dose-dependent manner suggests a possibility that the TL tetramer binds
to CD8 without additional molecules. This possibility is supported by
the finding that the binding affinity between murine MHC class I and
murine CD8 is somehow stronger than that observed in human counterparts
(reviewed in Ref. 38). TL molecule was also found to bind
to human CD8-transfected Chinese hamster ovary cells (39).
However, in the present study, the TL tetramer did not interact with
lymphocytes from spleen and peripheral lymph nodes, even though they
express almost the same amounts of CD8 on their cell surfaces. In
addition, there is no difference in the intensity of
T3b-TL tetramer staining between
CD8
+ and CD8
+
populations of iIEL, indicating that the composition of CD8 (
vs

) does not affect the tetramer binding. Therefore, CD8 molecules
expressed on iIEL and thymocytes must be distinct from those on
peripheral T lymphocytes in their conformation and/or
posttranscriptional modifications, if TL interacts with CD8 without
additional molecule(s). Recently, Daniels and Jameson (40)
reported that CD8 plays a critical role in interactions between TCR and
MHC multimer, and that anti-CD8
mAbs can exert either blocking
or augmenting influence, depending on the epitopes detected. Our
present study showed that an anti-CD8
mAb (clone 35-17-2)
blocked the binding of T3b-TL tetramer to iIEL,
thymocytes, or CTL, but our preliminary results showed that binding to
CTL was not affected or even slightly augmented by another mAb (clone
53-6.7), which was referred as an augmenting Ab by them. This may point
to conformational differences in CD8 molecules expressed on TL
tetramer-positive and -negative lymphocyte populations. However, at
this moment there is no clear experimental evidence in support of this
conclusion.
Another possibility is that CD8 plus another molecule expressed on TL tetramer-positive iIEL and thymocytes are necessary for the binding. A first candidate for our unknown molecule might be an NK receptor (20). However, our preliminary study showed that NK1.1+ cells from B6 mice were not stained with the TL tetramer, suggesting that typical NK receptors are probably not, although the coexpression with CD8 may facilitate binding to the TL tetramer. Another candidate group is that of Ig supergene family molecules, such as Ig-like transcript-2 and -4, which are the ligands for HLA-G (21). However, these molecules are reported to be expressed on blood monocytes, but not on lymphocytes in humans, suggesting that these mouse homologues are probably not the ligands for TL. Recently, Wang et al. (41) reported a novel, but enigmatic Qa-1-binding molecule on CD8+ cells, which seemed to be different from the possible TL ligand, because it is expressed by virtually all CD8+ cells derived from various lymphoid tissues, and its Qa-1 binding is not inhibited by an anti-CD8 mAb. To define TL-binding molecule(s), biochemical analyses have been attempted in our laboratory, but to date without success. This may be due to the low binding affinity between TL and its ligand itself, which can easily be speculated from the present findings that either the absence of CD8 on iIEL and thymocytes from the gene knockout or anti-CD8 mAb blocking completely abrogates T3b-TL tetramer binding. We also plan to produce a mAb to inhibit TL tetramer binding to iIEL and/or thymocytes, and thereby detect molecules that are indispensable for the binding together with CD8.
TL is known to be expressed on intestinal epithelium of all mouse strains and cortical thymocytes of certain strains, but little is known about its function as an MHC class Ib molecule. Based on the present finding that the TL tetramer binds to iIEL and CD4+CD8+ thymocytes, it is conceivable that these tetramer-positive lymphocyte populations interact in situ with TL expressed on intestinal epithelial cells and cortical thymocytes and play an important role in host defense. With the soluble TL molecule prepared in this study, it may be possible to define the Ag molecule presented by TL and elucidate the physiological function of TL in vivo.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kunio Tsujimura, Division of Immunology, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan. E-mail address: ktsujimu{at}aichi-cc.pref.aichi.jp ![]()
3 Current address: Department of Biological Systems, RIKEN BioResource Center, Tsukuba Institute, RIKEN, 3-1-1 Koyadai, Tsukuba 305-0074, Japan. ![]()
4 Abbreviations used in this paper: TL, thymus leukemia;
2m,
2-microglobulin; BSP, biotin-specific peptide; IEL, intraepithelial lymphocyte(s); iIEL, intestinal IEL. ![]()
Received for publication March 5, 2001. Accepted for publication May 9, 2001.
| References |
|---|
|
|
|---|

CTL by TL antigen expressed in the thymus. J. Exp. Med. 184:2175.
2-microglobulin-associated thymus-leukemia antigen is independent of TAP2. Eur. J. Immunol. 25:1001.[Medline]

T cell receptors in transporters associated with antigen presentation-1 null and thymus leukemia antigen positive mice. J. Exp. Med. 184:1579.
T cell lymphomas in a TL transgenic mouse strain. J. Exp. Med. 174:351.
T cell receptors. J. Immunol. 142:2736.[Abstract]

: analysis of 
T cells during thymic ontogeny and in peripheral lymphoid organs. Proc. Natl. Acad. Sci. USA 86:5094.
expression. Eur. J. Immunol. 31:87.[Medline]This article has been cited by other articles:
![]() |
N. Pardigon, K. Takeda, B. Saunier, F. Hornung, J. Gibbs, A. Weisberg, N. Contractor, B. Kelsall, J. R. Bennink, and J. W. Yewdell CD8{alpha}{alpha}-Mediated Intraepithelial Lymphocyte Snatching of Thymic Leukemia MHC Class Ib Molecules In Vitro and In Vivo J. Immunol., August 1, 2006; 177(3): 1590 - 1598. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Attinger, L. Devine, Y. Wang-Zhu, D. Martin, J.-h. Wang, E. L. Reinherz, M. Kronenberg, H. Cheroutre, and P. Kavathas Molecular Basis for the High Affinity Interaction between the Thymic Leukemia Antigen and the CD8{alpha}{alpha} Molecule J. Immunol., March 15, 2005; 174(6): 3501 - 3507. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pardigon, S. Darche, B. Kelsall, J. R. Bennink, and J. W. Yewdell The TL MHC class Ib molecule has only marginal effects on the activation, survival and trafficking of mouse small intestinal intraepithelial lymphocytes Int. Immunol., September 1, 2004; 16(9): 1305 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsujimura, Y. Obata, E. Kondo, K. Nishida, Y. Matsudaira, Y. Akatsuka, K. Kuzushima, and T. Takahashi Thymus leukemia antigen (TL)-specific cytotoxic T lymphocytes recognize the {alpha}1/{alpha}2 domain of TL free from antigenic peptides Int. Immunol., November 1, 2003; 15(11): 1319 - 1326. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Weber, A. Attinger, C. C. Kemball, J. L. Wigal, J. Pohl, Y. Xiong, E. L. Reinherz, H. Cheroutre, M. Kronenberg, and P. E. Jensen Peptide-Independent Folding and CD8{alpha}{alpha} Binding by the Nonclassical Class I Molecule, Thymic Leukemia Antigen J. Immunol., November 15, 2002; 169(10): 5708 - 5714. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Devine, L. Rogozinski, O. V. Naidenko, H. Cheroutre, and P. B. Kavathas The Complementarity-Determining Region-Like Loops of CD8{alpha} Interact Differently with {beta}2-Microglobulin of the Class I Molecules H-2Kb and Thymic Leukemia Antigen, While Similarly with Their {alpha}3 Domains J. Immunol., April 15, 2002; 168(8): 3881 - 3886. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |