The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Long, A.
Right arrow Articles by Volkov, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Long, A.
Right arrow Articles by Volkov, Y.
The Journal of Immunology, 2001, 167: 636-640.
Copyright © 2001 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Protein Kinase C{beta} Expression Is Critical for Export of IL-2 from T Cells1

Aideen Long2,*, Dermot Kelleher{ddagger}, Sara Lynch{dagger} and Yuri Volkov{ddagger}

Departments of * Biochemistry and {dagger} Pharmacology, Royal College of Surgeons in Ireland, and {ddagger} Department of Clinical Medicine, Trinity Centre for Health Sciences, St. James’s Hospital, Dublin, Ireland.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
Protein kinase C (PKC) plays an integral part in T cell activation and IL-2 secretion. We investigated the role of a particular PKC isoform, PKC{beta}, in IL-2 production and secretion. The T cell lymphoma line HuT 78 secretes IL-2 in response to the phorbol ester PMA. A PKC{beta}-deficient clone of HuT 78, K-4, did not secrete IL-2 in response to PMA stimulation. As assessed by RT-PCR, K-4 expressed mRNA for IL-2 following PMA activation, and intracellular IL-2 protein was detected by immunofluorescence. An enhanced green fluorescent protein-linked PKC{beta} construct was microinjected into K-4 cells, which were then stimulated with PMA; those cells that expressed PKC{beta} could secrete IL-2, as determined by an in situ immunofluorescent assay. This study demonstrates that PKC{beta} is not necessary for transcription of the IL-2 gene or translation of mRNA to protein, but that expression of this PKC isoform is critical to the export of IL-2 molecules from T cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Stimulation of T lymphocytes results in the activation of several enzymes and transcription factors and, subsequently, a set of pleiotropic cellular responses that include proliferation and cytokine secretion. T cell activation via the TCR-CD3 complex is associated with the hydrolysis of inositol phospholipid, resulting in the production of inositol polyphosphates and diacylglycerols that regulate intracellular calcium and protein kinase C (PKC),3 respectively. PKC consists of a family of isoforms divided into three groups based on enzymatic properties. These are the classical {alpha}, {beta}, and {gamma} novel ({delta}, {epsilon}, {eta}, {theta}, and µ) and the atypical ({zeta}, and {lambda}/{iota}) subfamilies (reviewed in Ref. 1). T lymphocytes express the PKC isoforms {alpha}, {beta}I, {delta}, {epsilon}, {zeta}, {eta}, and {theta}. Activation of PKC may be mimicked in vitro by phorbol esters such as PMA. PKC has been shown to play a key role in T cells, and various studies have been conducted in an attempt to elucidate specific roles for individual isoforms in T lymphocyte activation. Using mutationally active PKC isoforms, it has been shown that PKC{epsilon} and, to a lesser extent, PKC{alpha} can regulate the transcription factors AP-1 and NF-AT-1 (2). PKC{theta}, which forms part of the supramolecular complex at the interface of the T cell and APC, has been shown to be an upstream regulator of c-Jun N-terminal kinase/stress-activated protein kinase and IL-2 promoter activation in Jurkat T cells (3, 4, 5). More recently, it has been shown that this isoform synergizes with p95vav in the activation of the transcription factor NF-{kappa}B in T cells (6). Others have used neutralizing isoform-specific Abs to study the role of PKC isoforms in the activation of PBL. These studies demonstrate that PKC{beta} and PKC{delta} participate in the regulation of IL-2 synthesis, whereas neutralization of PKC{alpha} and PKC{theta} results in inhibition of IL-2R expression (7, 8).

We have previously shown that a PKC{beta}-deficient T cell line, K-4, cannot rearrange its microtubule cytoskeleton and therefore cannot display a motile phenotype when stimulated through the adhesion molecule LFA-1 (9). The parent line, HuT 78, becomes motile when stimulated through LFA-1, with reorganization of the microtubule cytoskeleton. Following activation, PKC{beta} relocates from the cytosol to associate with the microtubule cytoskeleton in the area adjacent to the microtubule organizing center (MTOC) and along the dendrite. In mammalian cells, the microtubule cytoskeleton is intimately associated with the secretory process; the Golgi is centred at the MTOC and associates with microtubules and microtubule motors. In addition, the coatomer or coat protein-1 complex, which assembles onto Golgi membranes and is involved in Golgi membrane traffic, associates with signaling molecules including the PKC{epsilon} isoform (10).

In contrast to HuT 78, the PKC{beta}-deficient K-4 cell line does not secrete IL-2 when activated with PMA. Because LFA-1 can transduce an accessory signal for IL-2 secretion in T cells and PKC{beta} colocalizes with the microtubule cytoskeleton following activation through LFA-1 (9), the aim of this study was to analyze the specific role of PKC{beta} in IL-2 production and secretion. We show that K-4 cells can make IL-2 at the level of both RNA and protein but fail to export the IL-2 from the cell. When PKC{beta} was introduced into K-4 cells by microinjection, these cells could secrete IL-2 in response to PMA activation, thus demonstrating a crucial role for PKC{beta} in the export of IL-2 from T cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Cell culture

The human T cell lymphoma cell line HuT 78 (American Type Culture Collection (ATCC), Manassas, VA), the K-4 cell line, generated as described previously (11), and human PBL were used in this study. Cells were cultured in RPMI 1640 medium containing 10% FCS, L-glutamine, penicillin, and streptomycin. Cultures were set up at a concentration of 1 x 106 cells/ml in 24-well plates (Nalge Nunc International, Roskilde, Denmark) for 24 h either alone in the presence of PMA (10 ng/ml) or, in the case of PBL, with anti-CD3, anti-LFA-1, and anti-CD28 or PMA plus PHA (10 µg/ml). Anti-CD3 (OKT3) was obtained from ATCC, anti-LFA-1 from Sanbio (Uden, The Netherlands), and anti-CD28 from Alexis (Nottingham, U.K.). PKC inhibitors Go 6976, bisindolylmaleimide (Calbiochem, Nottingham, U.K.), and LY 379196 (a kind gift of Eli Lily, Indianapolis, IN) were added to cells 30 min before addition of stimulus. Supernatants were collected for analysis of cytokine secretion or cells harvested for analysis of IL-2 expression at 24 h following stimulation.

Detection of secreted cytokines

Secreted IL-2 was detected by an ELISA kit (BioSource International, Nivelles, Belgium) according to the manufacturer’s instructions.

RNA extraction and RT-PCR

IL-2 mRNA was detected by RT-PCR. Total cellular RNA was prepared using the direct guanidinium isothiocyanate method and transcribed into cDNA using avian myeloblastosis virus reverse transcriptase (Promega Corp, Madison, WN). The cDNA was amplified using 1 U Taq polymerase in a Hybaid OmniGene (Hybaid, Middlesex, U.K.) in 35 cycles (denaturation at 95oC for 3 min, annealing at 60oC for 45 s, and elongation at 72oC for 4 min (one time); denaturation at 95oC for 1 min, annealing at 55oC for 45 s, and elongation at 72oC for 2 min (10 times); denaturation at 95oC for 1 min, annealing at 55oC for 45 s increasing at 0.5oC per cycle, and elongation at 72oC for 2 min increasing at 3oC per cycle (25 times). The following primers were used: IL-2 sense, AACCTCAACTCCTGCCACAATG, and antisense, CAAGTTAGTGTTGAGATGATGC; and {beta}-actin sense, TACATGGCTGGGGTGTTGAA, and antisense, AAGAGAGGCATCCTCACCCT. The IL-2 primers span three introns, thus controlling for amplification of genomic IL-2 DNA. PCR products were separated in 2% agarose gels and visualized by staining with ethidium bromide.

Detection of intracellular IL-2

Cells were fixed in acetone-formaldehyde (1:1) and permeabilized in 0.5% Triton X-100. IL-2 was detected using a rat anti-IL-2 mAb (BD PharMingen, San Diego, CA) followed by tetramethylrhodamine isothiocyanate-conjugated goat anti-rat (Sigma, Poole, Dorset, U.K.). PKC{beta} was detected by a rabbit anti-PKC{beta} anti-peptide Ab (Research and Diagnostic Abs, Berkley, CA) followed by FITC-conjugated goat anti-rabbit Ab (Sigma). Microscopic observations and photography were performed on a Nikon TE300 microscope (Nikon, Melville, NY) with a Leica DC100 camera (Leica, Deerfield, IL). For flow cytometry, cells were stained with FITC-conjugated rat anti-IL-2 (BD PharMingen).

Immunofluorescent in situ assay for IL-2 secretion

The immunofluorescent in situ assay procedure was largely based on the ELISPOT cytokine detection method with modifications. Single-well chambered glass coverslips (Nalge Nunc International) were treated with 1 mg/ml high m.w. poly(L-lysine) (Sigma) for 1 h at 37oC, washed twice with PBS, and coated with the capture Abs (0.1 mg/ml goat-anti-human IL-2; Sigma) overnight at 4oC. Unbound Abs were removed by gentle double-wash in PBS. Cells were added to the chambers at 1 x 105/ml, allowed to settle, and activated by 10 ng/ml PMA for 12 h (with or without brefeldin A; Sigma). In the experiments with enhanced green fluorescent protein (EGFP) constructs, activation was started after a 2-h recovery interval after microinjection. Cell fixation and immunofluorescent detection of intracellular and captured secreted IL-2 were performed as described above.

Microinjection of EGFP constructs

The EGFP-PKC{beta}(I) plasmid and "empty" EGFP vector were obtained from Clontech Laboratories (Basingstoke, U.K.). Direct intranuclear microinjection of DNA (0.5 µg/µl) was conducted within a 10- to 60-min interval after the initial adhesion of the cells to the poly(amino acid)-coated chambered coverslips. On average, 50–100 cells were injected this way using glass capillary microneedles with Narishige (Tokyo, Japan) microinjection equipment.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
The T cell lymphoma line HuT 78 secretes high levels of IL-2 in response to PMA activation, whereas the PKC{beta}-deficient clone K-4 fails to secrete IL-2 in response to this stimulus (Fig. 1Goa). A critical role for this PKC{beta} isoform is further emphasized by the fact that the classical PKC isoform-specific inhibitor, Go 6976, completely inhibited PMA-stimulated IL-2 secretion in HuT 78 cells (Fig. 1Gob). IL-2 production was also inhibited by the mitogen-activated protein/extracellular signal-regulated kinase kinase inhibitor, PD 098059, and the phosphatidylinositol-3 kinase inhibitor, LY 294 002 (data not shown). Stimulation of IL-2 production in PBL either through the TCR alone, through the TCR and accessory molecules LFA-1 and CD28, or using PMA plus PHA was inhibited by Go 6976, the PKC{beta} selective inhibitor LY 379196, and the broad spectrum PKC inhibitor bisindolylmaleimide (Fig. 1Goc). This indicates that PKC{beta} plays a key role in IL-2 production not just in the cell line model system but, importantly, in normal human PBL.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1. IL-2 production by HuT 78 and K-4 cells. a, IL-2 secretion was measured in resting and PMA-activated (10 ng/ml) HuT 78 and K-4 cells. b, The effect of the PKC inhibitor, Go 6976 (10 µM), on PMA-stimulated IL-2 secretion in HuT 78 cells. c, IL-2 production in human PBL following stimulation through the TCR, the TCR in combination with LFA-1 and CD28, or with PMA and PHA (with or without PKC inhibitors Go 6976, LY 379196 (10 µM), or bisindolylmaleimide (Bis IM; 2 µM)). Cells were preincubated in the presence of inhibitor for 30 min before stimulation and secreted IL-2 measured at 24 h (n = 2 experiments).

 
The proinflammatory cytokine TNF is secreted following activation of many cells including monocytes and lymphocytes. The mechanism by which this cytokine is secreted has been previously described; it is expressed as a membrane-bound pro-molecule. Release from the cell is mediated by proteolytic cleavage (12). Both HuT 78 and K-4 cells secrete TNF when activated with PMA (13). This PMA-stimulated TNF secretion is sensitive to Go 6976, PD 098059, and LY 294 002 (data not shown), suggesting that similar signaling pathways are involved in both TNF and IL-2 production in these cell lines when stimulated with PMA. Given that the PKC{beta}-deficient cell line K-4 can produce TNF and has a previously characterized defect in microtubule function, we investigated whether these cells could actually make IL-2 at the level of protein. We postulated that the failure to detect the production of this cytokine may be due to a defect in the classical secretory pathway in which microtubules, together with other functional and signaling molecules, play a crucial role.

First we examined production of IL-2 at the level of mRNA in both cell lines. As demonstrated by RT-PCR, resting K-4 cells express low levels of IL-2 mRNA, which is significantly increased following activation with PMA. By this method, patterns of mRNA expression are the same in HuT 78 and K-4 cells (Fig. 2Go). Szamel et al. have shown a correlation between PKC{beta} translocation from cytosol to membrane with appearance of IL-2 mRNA at 4 h following T cell activation (8). However, we now demonstrate the induction of IL-2 message at 24 h following PMA activation even in the absence of PKC{beta} expression. Another PKC isoform, PKC{theta}, plays a key role in the transcription of the IL-2 gene (14, 15).



View larger version (76K):
[in this window]
[in a new window]
  		FIGURE 2. IL-2 mRNA expression in HuT 78 and K-4 cells, resting and following activation with PMA (10 ng/ml). RNA was isolated from resting and PMA-activated HuT 78 and K-4 cells (PBL were used as a positive control), and RT-PCR for IL-2 mRNA was conducted. Lane 1, HuT 78 cells resting; lane 2, PMA-activated HuT 78 cells; lane 3, K-4 cells resting; lane 4, PMA-activated K-4 cells; lane 5, resting PBL; and lane 6, PHA-activated PBL. RT-PCR product size was assessed using a 100-bp ladder. A {beta}-actin control was included for each sample.

 
The PKC{beta}-deficient K-4 cells (Fig. 3Go, e and d) express IL-2 at the level of protein. Both HuT 78 and K-4 cells express low levels of IL-2 in the resting state. Intracellular IL-2 was detected in HuT 78 and K-4 cells following activation with PMA (Fig. 3Go, b and d). Quantitative analysis of intracellular IL-2 by flow cytometry revealed 15.4 and 32.9% resting HuT 78 and K-4 cells, respectively, as positively stained. PMA activation of HuT 78 cells led to a 3.7-fold increase in the number of positive cells and a 22.4% rise in the intracellular IL-2 fluorescence intensity levels. Activated K-4 cells similarly demonstrated a significant 1.7-fold increase in the positive cell number and a 41.2% gain in their mean staining intensity values. An in situ assay for the detection of IL-2 secretion from individual cells was established. This approach confirmed clearly the inability of K-4 cells to secrete this cytokine when compared with HuT 78 cells (Fig. 4Go, a and c). An EGFP-linked PKC{beta} gene was then introduced into K-4 cells by microinjection, and those cells expressing the EGFP-PKC{beta} construct were restored with the ability to secrete IL-2 following PMA activation (Fig. 4Goc), demonstrating an essential role for this isoform in transporting the cytokine from the T cell. Quantitatively, 76.0 ± 6.5% of EGFP-PKC{beta}-transfected K-4 cells were able to secrete IL-2, comparable to 87.9 ± 2.7% obtained in the parental HuT 78 cell line (Fig. 4Gof). K-4 cells microinjected with an empty EGFP vector were unable to secrete IL-2 in response to PMA (Fig. 4Go, e and f). A typical "starburst" IL-2 secretion pattern was abolished in the cells in the presence of brefeldin A (Fig. 4Go, b, d, and f).



View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 3. Intracellular staining of IL-2 by immunocytochemistry. HuT 78 and K-4 cells (resting and PMA-activated) were dual-stained for IL-2 (red) and PKC{beta} (green). a, HuT 78 cells resting; b, HuT 78 cells activated with PMA; c, K-4 cells resting; d, K-4 cells activated with PMA. Left panel displays overlayed Hoffman modulation contrast images and IL-2 immunofluorescence staining.

 


View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 4. In situ detection of IL-2 secretion in HuT 78 cells and K-4 cells expressing EGFP-PKC{beta} construct. a–e, Overlaid fluorescent images illustrating localization of IL-2 (red) and EGFP (green). a, IL-2 secretion by PMA-activated HuT 78 cells (red granular staining outside the cell body represents the captured, secreted IL-2). b, HuT 78 cells in the presence of brefeldin A. c, Reexpression of PKC{beta} in K-4 cells restores their ability to secrete IL-2 (double-positive cells displaying both red and green fluorescence). Untransfected K-4 cells produce IL-2, but do not secrete. d, IL-2 secretion is inhibited in EGFP-PKC{beta}-transfected K-4 cells by brefeldin A. e, K-4 cells microinjected with empty EGFP vector do not secrete IL-2. f, Quantification of cells secreting IL-2. Columns (left to right) correspond to a–e. Values represent means ± SE obtained from 35–50 microscopic fields representing two independent studies.

 
Studies using a range of PKC activators and inhibitors have demonstrated the involvement of PKC in the secretion of many biological molecules including neurotransmitter release from nerve terminals and amyliod precursor protein secretion from neurons, chloride secretion from epithelial cells, and parietal cell acid (HCl) secretion (16, 17, 18, 19). However, the subcellular localization and position of PKC isoforms within these secretory processes/cascades has not been well defined. IL-2 is a member of the four {alpha} helix bundle cytokine family. Its production is largely controlled by regulation of transcription and message stabilization. Effective mRNA translation is followed by efficient translocation into the endoplasmic reticulum and secretion of the cytokine (20, 21). PKC has been linked to microtubule function, and there is evidence to suggest that PKC may participate in the Golgi/microtubule-regulated stage of secretion. {beta}'-coat protein I, which is a coatomer complex protein essential for Golgi budding and vesicular trafficking, has been shown as a PKC{epsilon}-selective receptor for activated C-kinase (10). This could be a mechanism whereby activated PKC{epsilon} could regulate Golgi function. In addition, study of secretion of heparan sulfate proteoglycans from HepG2 cells showed that membrane-bound PKC supported vesicle formation with PKC{alpha} and PKC{zeta} attaching to highly purified Golgi membranes (22). We have previously demonstrated that PKC{beta} and PKC{delta} associate with the microtubule cytoskeleton/MTOC in locomotory T cells, while others have shown that modulation of PKC activity can prevent reorientation of the MTOC in cytotoxic T cells (9, 23). Phorbol ester-resistant U937 cells display defective microtubule reorganization (24). This correlated with diminished PKC{beta}II association with microtubules and loss of heat-soluble microtubule-associated PKC-binding proteins. Microtubule-associated proteins , particularly microtubule-associated protein-2 and -4 are substrates for PKC, and site-specific phosphorylation of these proteins modulates their regulation of tubulin polymerization (25, 26).

In this study, we have definitively shown that although PKC{beta} expression is not necessary for IL-2 transcription or translation, it is essential for the export of the cytokine from the T cell. These findings represent another level of control in IL-2 production and a potential target in immunomodulatory therapy.


   Acknowledgments
 
We thank E. Caron and A. Hall (London, U.K.) for help in establishing microinjection techniques and N. Saito (Kobe, Japan) for advice in GFP plasmid methodology.


   Footnotes
 
1 This work was supported by the Health Research Board of Ireland, Enterprise Ireland, and Wellcome Trust. A.L. was the recipient of a Wellcome Trust Career Development Award. Back

2 Address correspondence and reprint requests to Dr Aideen Long, Department of Biochemistry, Royal College of Surgeons in Ireland, St. Stephen’s Green, Dublin 2, Ireland. E-mail address: aclong{at}rcsi.ie Back

3 Abbreviations used in this paper: PKC, protein kinase C; EGFP, enhanced green fluorescent protein; MTOC, microtubule organizing center. Back

Received for publication December 18, 2000. Accepted for publication May 21, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Nishizuka, Y.. 1992. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258:607.[Abstract/Free Full Text]
  2. Genot, E. M., P. J. Parker, D. A. Cantrell. 1995. Analysis of the role of protein kinase C-{alpha}, -{epsilon} and -{zeta} in T cell activation. J. Biol. Chem. 270:9833.[Abstract/Free Full Text]
  3. Monks, C. R. F., B. A. Freiberg, H. Kupfer, N. Sciaky, A. Kupfer. 1998. Three-dimensional segregation of supramolecular activation clusters in T cells. Nature 395:82.[Medline]
  4. Werlen, G., E. Jacinto, Y. Xia, M. Karin. 1998. Calcineurin preferentially synergizes with PKC-{theta} to activate JNK and IL-2 promoter in T lymphocytes. EMBO J. 17:3101.[Medline]
  5. Ghaffari-Tabrizi, N., B. Bauer, A. Villunger, G. Baier-Bitterlich, A. Altman, G. Utermann, F. Uberall, G. Baier. 1999. Protein kinase C{theta}, a selective upstream regulator of JNK/SAPK and IL-2 promoter activation in Jurkat T cells. Eur. J. Immunol. 29:132.[Medline]
  6. Dienz, O., S. P. Hehner, W. Droge, M. L. Schmitz. 2000. Synergistic activation of NF{kappa}B by functional cooperation between Vav and PKC{theta} in T lymphocytes. J. Biol. Chem. 275:24547.[Abstract/Free Full Text]
  7. Szamel, M., F. Bartels, K. Resch. 1993. Cyclosporin A inhibits T cell receptor-induced interleukin-2 synthesis of human T lymphocytes by selectively preventing a transmembrane signal transduction pathway leading to sustained activation of a protein kinase C isoenzyme, protein kinase C-{beta}. Eur. J. Immunol. 23:3072.[Medline]
  8. Szamel, M., A. Appel, R. Schwinzer, K. Resch. 1998. Different protein kinase C isoenzymes regulate IL-2 receptor expression or IL-2 synthesis in human lymphocytes stimulated via the TCR. J. Immunol. 160:2207.[Abstract/Free Full Text]
  9. Volkov, Y., A. Long, D. Kelleher. 1998. Inside the crawling T cell: leukocyte function-associated antigen-1 cross-linking is associated with microtubule-directed translocation of protein kinase C {beta}(I) and {delta}. J. Immunol. 161:6487.[Abstract/Free Full Text]
  10. Csukai, M., C.-H. Chen, M. A. De Matteis, D. Mochly-Rosen. 1997. The coatomer protein {beta}'-COP, a selective binding protein (RACK) for protein kinase C{epsilon}. J. Biol. Chem. 272:29200.[Abstract/Free Full Text]
  11. Kelleher, D., A. Long. 1992. Development and characterization of a protein kinase C {beta}-isozyme-deficient T-cell line. FEBS Lett. 301:310.[Medline]
  12. Black, R. A., C. T. Rauch, C. J. Kozlosky, J. J. Peschon, J. L. Slack, M. F. Wolfson, B. J. Castner, K. L. Stocking, P. Reddy, S. Srinivasan, et al 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-{alpha} from cells. Nature 385:729.[Medline]
  13. O’Connell, M. A., R. Cleere, A. Long, L. A. O’Neill, D. Kelleher. 1995. Cellular proliferation and activation of NF{kappa}B are induced by autocrine production of tumor necrosis factor {alpha} in the human T lymphoma line HuT 78. J. Biol. Chem. 270:7399.[Abstract/Free Full Text]
  14. Bauer, B., N. Krumbock, N. Ghaffari-Tabrizi, S. Kampfer, A. Villunger, M. Wilda, H. Hameister, G. Utermann, M. Leitges, F. Uberall, G. Baier. 2000. T cell expressed PKC{theta} demonstrates cell-type selective function. Eur. J. Immunol. 30:3645.[Medline]
  15. Lin, X., A. O’Mahony, Y. Mu, R. Geleziunas, W. C. Greene. 2000. Protein kinase C-{theta} participates in NF-{kappa}B activation induced by CD3-CD28 costimulation through selective activation of I{kappa}B kinase {beta}. Mol. Cell. Biol. 20:2933.[Abstract/Free Full Text]
  16. Bittner, M. A., R. W. Holz. 2000. Latrotoxin stimulates secretion in permeabilized cells by regulating an intracellular Ca2+- and ATP-dependent event: a role for protein kinase C. J. Biol. Chem. 275:25351.[Abstract/Free Full Text]
  17. Jolly-Tornetta, C., B. A. Wolf. 2000. Regulation of amyloid precursor protein (APP) secretion by protein kinase C{alpha} in human ntera 2 neurons (NT2N). Biochemistry 39:7428.[Medline]
  18. Chow, J. Y., J. M. Uribe, K. E. Barrett. 2000. A role for protein kinase C{epsilon} in the inhibitory effect of growth factor on calcium-stimulated chloride secretion in human epithelial cells. J. Biol. Chem. 275:21169.[Abstract/Free Full Text]
  19. Chew, C. S., C. J. Zhou, Jr J. A. Parente. 1997. Ca2+-independent protein kinase C isoforms may modulate parietal cell HCl secretion. Am. J. Physiol. 272:G246.[Abstract/Free Full Text]
  20. Tagaya, Y., R. N. Bamford, A. P. DeFilippis, T. A. Waldmann. 1996. IL-15: a pleiotropic Cytokine with diverse receptor/signaling pathways whose expression is controlled at multiple levels. Immunity 4:329.[Medline]
  21. Kurys, G., Y. Tagaya, R. Bamford, J. A. Hanover, T. A. Waldmann. 2000. The long signal peptide isoform and its alternative processing direct the intracellular trafficking of interleukin-15. J. Biol. Chem. 275:30653.[Abstract/Free Full Text]
  22. Westermann, P., M. Knoblich, O. Maier, C. Lindshau, H. Haller. 1996. Protein kinase C bound to the Golgi apparatus supports the formation of constitutive transport vesicles. Biochem. J. 320:651.
  23. Nesic, D., S. Henderson, S. Vukmanovic. 1998. Prevention of antigen-induced microtubule organizing center reorientation in cytotoxic T cells by modulation of protein kinase C activity. Int. Immunol. 10:1741.[Abstract/Free Full Text]
  24. Kiley, S. C., P. J. Parker. 1997. Defective microtubule reorganisation in phorbol ester-resistant U937 variants: reconstitution of the normal cell phenotype with nocodazole treatment. Cell Growth Differ. 8:231.[Abstract]
  25. Ainsztein, A. M., D. L. Purich. 1994. Stimulation of tubulin polymerization by MAP-2: control by protein kinase C-mediated phosphorylation at specific sites in the microtubule-binding region. J. Biol. Chem. 269:28465.[Abstract/Free Full Text]
  26. Mori, A., H. Aizawa, T. C. Saido, H. Kawasaki, K. Mizuno, H. Murofushi, K. Suzuki, H. Sakai. 1991. Site-specific phosphorylation by protein kinase C inhibits assembly-promoting activity of microtubule-associated protein 4. Biochemistry 30:9341.[Medline]



This article has been cited by other articles:


Home page
 J. Pharmacol. Exp. Ther.Home page
J.-P. Evenou, J. Wagner, G. Zenke, V. Brinkmann, K. Wagner, J. Kovarik, K. A. Welzenbach, G. Weitz-Schmidt, C. Guntermann, H. Towbin, et al.
The Potent Protein Kinase C-Selective Inhibitor AEB071 (Sotrastaurin) Represents a New Class of Immunosuppressive Agents Affecting Early T-Cell Activation
J. Pharmacol. Exp. Ther., September 1, 2009; 330(3): 792 - 801.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. K. Verma, J. Dourlat, A. M. Davies, A. Long, W.-Q. Liu, C. Garbay, D. Kelleher, and Y. Volkov
STAT3-Stathmin Interactions Control Microtubule Dynamics in Migrating T-cells
J. Biol. Chem., May 1, 2009; 284(18): 12349 - 12362.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
C. Ehre, Y. Zhu, L. H. Abdullah, J. Olsen, K. I. Nakayama, K. Nakayama, R. O. Messing, and C. W. Davis
nPKC{varepsilon}, a P2Y2-R downstream effector in regulated mucin secretion from airway goblet cells
Am J Physiol Cell Physiol, November 1, 2007; 293(5): C1445 - C1454.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Sanchez-Lockhart and J. Miller
Engagement of CD28 Outside of the Immunological Synapse Results in Up-Regulation of IL-2 mRNA Stability but Not IL-2 Transcription.
J. Immunol., April 15, 2006; 176(8): 4778 - 4784.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
C. Slattery, E. Campbell, T. McMorrow, and M. P. Ryan
Cyclosporine A-Induced Renal Fibrosis: A Role for Epithelial-Mesenchymal Transition
Am. J. Pathol., August 1, 2005; 167(2): 395 - 407.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
U. E. Dreikhausen, K. Gorf, K. Resch, and M. Szamel
Protein kinase C{beta}1, a major regulator of TCR-CD28-activated signal transduction leading to IL-2 gene transcription and secretion
Int. Immunol., September 1, 2003; 15(9): 1089 - 1098.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
R. Chibber, B. M. Ben-Mahmud, G. E. Mann, J. J. Zhang, and E. M. Kohner
Protein Kinase C {beta}2-Dependent Phosphorylation of Core 2 GlcNAc-T Promotes Leukocyte-Endothelial Cell Adhesion: A Mechanism Underlying Capillary Occlusion in Diabetic Retinopathy
Diabetes, June 1, 2003; 52(6): 1519 - 1527.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Cipriani, H. Knowles, L. Chen, L. Battistini, and C. F. Brosnan
Involvement of Classical and Novel Protein Kinase C Isoforms in the Response of Human V{gamma}9V{delta}2 T Cells to Phosphate Antigens
J. Immunol., November 15, 2002; 169(10): 5761 - 5770.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Long, A.
Right arrow Articles by Volkov, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Long, A.
Right arrow Articles by Volkov, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS