|
|
||||||||
CUTTING EDGE |
Expression Is Critical for Export of IL-2 from T Cells1



Departments of
*
Biochemistry and
Pharmacology, Royal College of Surgeons in Ireland, and
Department of Clinical Medicine, Trinity Centre for Health Sciences, St. Jamess Hospital, Dublin, Ireland.
| Abstract |
|---|
|
|
|---|
, in IL-2 production and secretion. The T cell
lymphoma line HuT 78 secretes IL-2 in response to the phorbol ester
PMA. A PKC
-deficient clone of HuT 78, K-4, did not secrete IL-2 in
response to PMA stimulation. As assessed by RT-PCR, K-4 expressed mRNA
for IL-2 following PMA activation, and intracellular IL-2 protein was
detected by immunofluorescence. An enhanced green fluorescent
protein-linked PKC
construct was microinjected into K-4 cells, which
were then stimulated with PMA; those cells that expressed PKC
could
secrete IL-2, as determined by an in situ immunofluorescent assay. This
study demonstrates that PKC
is not necessary for transcription of
the IL-2 gene or translation of mRNA to protein, but that expression of
this PKC isoform is critical to the export of IL-2 molecules from T
cells. | Introduction |
|---|
|
|
|---|
,
,
and
novel (
,
,
,
, and µ) and the atypical (
, and
/
) subfamilies (reviewed in Ref. 1). T lymphocytes
express the PKC isoforms
,
I,
,
,
,
, and
.
Activation of PKC may be mimicked in vitro by phorbol esters such as
PMA. PKC has been shown to play a key role in T cells, and various
studies have been conducted in an attempt to elucidate specific roles
for individual isoforms in T lymphocyte activation. Using mutationally
active PKC isoforms, it has been shown that PKC
and, to a lesser
extent, PKC
can regulate the transcription factors AP-1 and NF-AT-1
(2). PKC
, which forms part of the supramolecular
complex at the interface of the T cell and APC, has been shown to be an
upstream regulator of c-Jun N-terminal kinase/stress-activated protein
kinase and IL-2 promoter activation in Jurkat T cells
(3, 4, 5). More recently, it has been shown that this isoform
synergizes with p95vav in the activation of the
transcription factor NF-
B in T cells (6). Others have
used neutralizing isoform-specific Abs to study the role of PKC
isoforms in the activation of PBL. These studies demonstrate that
PKC
and PKC
participate in the regulation of IL-2 synthesis,
whereas neutralization of PKC
and PKC
results in inhibition of
IL-2R expression (7, 8).
We have previously shown that a PKC
-deficient T cell line, K-4,
cannot rearrange its microtubule cytoskeleton and therefore cannot
display a motile phenotype when stimulated through the adhesion
molecule LFA-1 (9). The parent line, HuT 78, becomes
motile when stimulated through LFA-1, with reorganization of the
microtubule cytoskeleton. Following activation, PKC
relocates from
the cytosol to associate with the microtubule cytoskeleton in the area
adjacent to the microtubule organizing center (MTOC) and along the
dendrite. In mammalian cells, the microtubule cytoskeleton is
intimately associated with the secretory process; the Golgi is centred
at the MTOC and associates with microtubules and microtubule motors. In
addition, the coatomer or coat protein-1 complex, which assembles onto
Golgi membranes and is involved in Golgi membrane traffic, associates
with signaling molecules including the PKC
isoform
(10).
In contrast to HuT 78, the PKC
-deficient K-4 cell line does not
secrete IL-2 when activated with PMA. Because LFA-1 can transduce an
accessory signal for IL-2 secretion in T cells and PKC
colocalizes
with the microtubule cytoskeleton following activation through LFA-1
(9), the aim of this study was to analyze the specific
role of PKC
in IL-2 production and secretion. We show that K-4 cells
can make IL-2 at the level of both RNA and protein but fail to export
the IL-2 from the cell. When PKC
was introduced into K-4 cells by
microinjection, these cells could secrete IL-2 in response to PMA
activation, thus demonstrating a crucial role for PKC
in the export
of IL-2 from T cells.
| Materials and Methods |
|---|
|
|
|---|
The human T cell lymphoma cell line HuT 78 (American Type Culture Collection (ATCC), Manassas, VA), the K-4 cell line, generated as described previously (11), and human PBL were used in this study. Cells were cultured in RPMI 1640 medium containing 10% FCS, L-glutamine, penicillin, and streptomycin. Cultures were set up at a concentration of 1 x 106 cells/ml in 24-well plates (Nalge Nunc International, Roskilde, Denmark) for 24 h either alone in the presence of PMA (10 ng/ml) or, in the case of PBL, with anti-CD3, anti-LFA-1, and anti-CD28 or PMA plus PHA (10 µg/ml). Anti-CD3 (OKT3) was obtained from ATCC, anti-LFA-1 from Sanbio (Uden, The Netherlands), and anti-CD28 from Alexis (Nottingham, U.K.). PKC inhibitors Go 6976, bisindolylmaleimide (Calbiochem, Nottingham, U.K.), and LY 379196 (a kind gift of Eli Lily, Indianapolis, IN) were added to cells 30 min before addition of stimulus. Supernatants were collected for analysis of cytokine secretion or cells harvested for analysis of IL-2 expression at 24 h following stimulation.
Detection of secreted cytokines
Secreted IL-2 was detected by an ELISA kit (BioSource International, Nivelles, Belgium) according to the manufacturers instructions.
RNA extraction and RT-PCR
IL-2 mRNA was detected by RT-PCR. Total cellular RNA was
prepared using the direct guanidinium isothiocyanate method and
transcribed into cDNA using avian myeloblastosis virus reverse
transcriptase (Promega Corp, Madison, WN). The cDNA was amplified using
1 U Taq polymerase in a Hybaid OmniGene (Hybaid, Middlesex,
U.K.) in 35 cycles (denaturation at 95oC for 3
min, annealing at 60oC for 45 s, and
elongation at 72oC for 4 min (one time);
denaturation at 95oC for 1 min, annealing at
55oC for 45 s, and elongation at
72oC for 2 min (10 times); denaturation at
95oC for 1 min, annealing at
55oC for 45 s increasing at
0.5oC per cycle, and elongation at
72oC for 2 min increasing at
3oC per cycle (25 times). The following
primers were used: IL-2 sense, AACCTCAACTCCTGCCACAATG, and antisense,
CAAGTTAGTGTTGAGATGATGC; and
-actin sense,
TACATGGCTGGGGTGTTGAA, and antisense, AAGAGAGGCATCCTCACCCT. The
IL-2 primers span three introns, thus controlling for amplification of
genomic IL-2 DNA. PCR products were separated in 2% agarose gels and
visualized by staining with ethidium bromide.
Detection of intracellular IL-2
Cells were fixed in acetone-formaldehyde (1:1) and permeabilized
in 0.5% Triton X-100. IL-2 was detected using a rat anti-IL-2 mAb
(BD PharMingen, San Diego, CA) followed by tetramethylrhodamine
isothiocyanate-conjugated goat anti-rat (Sigma, Poole, Dorset,
U.K.). PKC
was detected by a rabbit anti-PKC
anti-peptide Ab (Research and Diagnostic Abs, Berkley, CA) followed
by FITC-conjugated goat anti-rabbit Ab (Sigma). Microscopic
observations and photography were performed on a Nikon TE300 microscope
(Nikon, Melville, NY) with a Leica DC100 camera (Leica, Deerfield, IL).
For flow cytometry, cells were stained with FITC-conjugated rat
anti-IL-2 (BD PharMingen).
Immunofluorescent in situ assay for IL-2 secretion
The immunofluorescent in situ assay procedure was largely based on the ELISPOT cytokine detection method with modifications. Single-well chambered glass coverslips (Nalge Nunc International) were treated with 1 mg/ml high m.w. poly(L-lysine) (Sigma) for 1 h at 37oC, washed twice with PBS, and coated with the capture Abs (0.1 mg/ml goat-anti-human IL-2; Sigma) overnight at 4oC. Unbound Abs were removed by gentle double-wash in PBS. Cells were added to the chambers at 1 x 105/ml, allowed to settle, and activated by 10 ng/ml PMA for 12 h (with or without brefeldin A; Sigma). In the experiments with enhanced green fluorescent protein (EGFP) constructs, activation was started after a 2-h recovery interval after microinjection. Cell fixation and immunofluorescent detection of intracellular and captured secreted IL-2 were performed as described above.
Microinjection of EGFP constructs
The EGFP-PKC
(I) plasmid and "empty" EGFP vector were
obtained from Clontech Laboratories (Basingstoke, U.K.). Direct
intranuclear microinjection of DNA (0.5 µg/µl) was conducted within
a 10- to 60-min interval after the initial adhesion of the cells to the
poly(amino acid)-coated chambered coverslips. On average, 50100 cells
were injected this way using glass capillary microneedles with
Narishige (Tokyo, Japan) microinjection equipment.
| Results and Discussion |
|---|
|
|
|---|
-deficient clone K-4
fails to secrete IL-2 in response to this stimulus (Fig. 1
isoform is further
emphasized by the fact that the classical PKC isoform-specific
inhibitor, Go 6976, completely inhibited PMA-stimulated IL-2 secretion
in HuT 78 cells (Fig. 1
selective inhibitor
LY 379196, and the broad spectrum PKC inhibitor bisindolylmaleimide
(Fig. 1
plays a key role in
IL-2 production not just in the cell line model system but,
importantly, in normal human PBL.
|
-deficient cell line K-4 can
produce TNF and has a previously characterized defect in microtubule
function, we investigated whether these cells could actually make IL-2
at the level of protein. We postulated that the failure to detect the
production of this cytokine may be due to a defect in the classical
secretory pathway in which microtubules, together with other functional
and signaling molecules, play a crucial role.
First we examined production of IL-2 at the level of mRNA in both
cell lines. As demonstrated by RT-PCR, resting K-4 cells express low
levels of IL-2 mRNA, which is significantly increased following
activation with PMA. By this method, patterns of mRNA expression are
the same in HuT 78 and K-4 cells (Fig. 2
). Szamel et al. have shown a correlation between PKC
translocation
from cytosol to membrane with appearance of IL-2 mRNA at 4 h
following T cell activation (8). However, we now
demonstrate the induction of IL-2 message at 24 h following PMA
activation even in the absence of PKC
expression. Another PKC
isoform, PKC
, plays a key role in the transcription of the IL-2 gene
(14, 15).
|
-deficient K-4 cells (Fig. 3
gene was then
introduced into K-4 cells by microinjection, and those cells expressing
the EGFP-PKC
construct were restored with the ability to secrete
IL-2 following PMA activation (Fig. 4
-transfected K-4
cells were able to secrete IL-2, comparable to 87.9 ± 2.7%
obtained in the parental HuT 78 cell line (Fig. 4
|
|
helix bundle
cytokine family. Its production is largely controlled by regulation of
transcription and message stabilization. Effective mRNA translation is
followed by efficient translocation into the endoplasmic reticulum and
secretion of the cytokine (20, 21). PKC has been linked to
microtubule function, and there is evidence to suggest that PKC may
participate in the Golgi/microtubule-regulated stage of secretion.
'-coat protein I, which is a coatomer complex protein essential for
Golgi budding and vesicular trafficking, has been shown as a
PKC
-selective receptor for activated C-kinase (10).
This could be a mechanism whereby activated PKC
could regulate Golgi
function. In addition, study of secretion of heparan sulfate
proteoglycans from HepG2 cells showed that membrane-bound PKC supported
vesicle formation with PKC
and PKC
attaching to highly purified
Golgi membranes (22). We have previously demonstrated that
PKC
and PKC
associate with the microtubule cytoskeleton/MTOC in
locomotory T cells, while others have shown that modulation of PKC
activity can prevent reorientation of the MTOC in cytotoxic T cells
(9, 23). Phorbol ester-resistant U937 cells display
defective microtubule reorganization (24). This correlated
with diminished PKC
II association with microtubules and loss of
heat-soluble microtubule-associated PKC-binding proteins.
Microtubule-associated proteins , particularly microtubule-associated
protein-2 and -4 are substrates for PKC, and site-specific
phosphorylation of these proteins modulates their
regulation of tubulin polymerization (25, 26).
In this study, we have definitively shown that although PKC
expression is not necessary for IL-2 transcription or translation, it
is essential for the export of the cytokine from the T cell. These
findings represent another level of control in IL-2 production and a
potential target in immunomodulatory therapy.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr Aideen Long, Department of Biochemistry, Royal College of Surgeons in Ireland, St. Stephens Green, Dublin 2, Ireland. E-mail address: aclong{at}rcsi.ie ![]()
3 Abbreviations used in this paper: PKC, protein kinase C; EGFP, enhanced green fluorescent protein; MTOC, microtubule organizing center. ![]()
Received for publication December 18, 2000. Accepted for publication May 21, 2001.
| References |
|---|
|
|
|---|
, -
and -
in T cell activation. J. Biol. Chem. 270:9833.
to activate JNK and IL-2 promoter in T lymphocytes. EMBO J. 17:3101.[Medline]
, a selective upstream regulator of JNK/SAPK and IL-2 promoter activation in Jurkat T cells. Eur. J. Immunol. 29:132.[Medline]
B by functional cooperation between Vav and PKC
in T lymphocytes. J. Biol. Chem. 275:24547.
. Eur. J. Immunol. 23:3072.[Medline]
(I) and
. J. Immunol. 161:6487.
'-COP, a selective binding protein (RACK) for protein kinase C
. J. Biol. Chem. 272:29200.
-isozyme-deficient T-cell line. FEBS Lett. 301:310.[Medline]
from cells. Nature 385:729.[Medline]
B are induced by autocrine production of tumor necrosis factor
in the human T lymphoma line HuT 78. J. Biol. Chem. 270:7399.
demonstrates cell-type selective function. Eur. J. Immunol. 30:3645.[Medline]
participates in NF-
B activation induced by CD3-CD28 costimulation through selective activation of I
B kinase
. Mol. Cell. Biol. 20:2933.
in human ntera 2 neurons (NT2N). Biochemistry 39:7428.[Medline]
in the inhibitory effect of growth factor on calcium-stimulated chloride secretion in human epithelial cells. J. Biol. Chem. 275:21169.This article has been cited by other articles:
![]() |
N. K. Verma, J. Dourlat, A. M. Davies, A. Long, W.-Q. Liu, C. Garbay, D. Kelleher, and Y. Volkov STAT3-Stathmin Interactions Control Microtubule Dynamics in Migrating T-cells J. Biol. Chem., May 1, 2009; 284(18): 12349 - 12362. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ehre, Y. Zhu, L. H. Abdullah, J. Olsen, K. I. Nakayama, K. Nakayama, R. O. Messing, and C. W. Davis nPKC{varepsilon}, a P2Y2-R downstream effector in regulated mucin secretion from airway goblet cells Am J Physiol Cell Physiol, November 1, 2007; 293(5): C1445 - C1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Lockhart and J. Miller Engagement of CD28 Outside of the Immunological Synapse Results in Up-Regulation of IL-2 mRNA Stability but Not IL-2 Transcription. J. Immunol., April 15, 2006; 176(8): 4778 - 4784. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Slattery, E. Campbell, T. McMorrow, and M. P. Ryan Cyclosporine A-Induced Renal Fibrosis: A Role for Epithelial-Mesenchymal Transition Am. J. Pathol., August 1, 2005; 167(2): 395 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. E. Dreikhausen, K. Gorf, K. Resch, and M. Szamel Protein kinase C{beta}1, a major regulator of TCR-CD28-activated signal transduction leading to IL-2 gene transcription and secretion Int. Immunol., September 1, 2003; 15(9): 1089 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chibber, B. M. Ben-Mahmud, G. E. Mann, J. J. Zhang, and E. M. Kohner Protein Kinase C {beta}2-Dependent Phosphorylation of Core 2 GlcNAc-T Promotes Leukocyte-Endothelial Cell Adhesion: A Mechanism Underlying Capillary Occlusion in Diabetic Retinopathy Diabetes, June 1, 2003; 52(6): 1519 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Cipriani, H. Knowles, L. Chen, L. Battistini, and C. F. Brosnan Involvement of Classical and Novel Protein Kinase C Isoforms in the Response of Human V{gamma}9V{delta}2 T Cells to Phosphate Antigens J. Immunol., November 15, 2002; 169(10): 5761 - 5770. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |