The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chiu, P. P. L.
Right arrow Articles by Danska, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chiu, P. P. L.
Right arrow Articles by Danska, J. S.
The Journal of Immunology, 2001, 167: 7169-7179.
Copyright © 2001 by The American Association of Immunologists

Genetic Control of T and B Lymphocyte Activation in Nonobese Diabetic Mice1

Priscilla P. L. Chiu*,{dagger},§, Anthony M. Jevnikar and Jayne S. Danska2,*,{ddagger},§

* Program in Developmental Biology, Hospital for Sick Children Research Institute, Departments of {dagger} Surgery and {ddagger} Immunology and § Institute of Medical Science, University of Toronto, Toronto, Canada; and Departments of Nephrology and Transplantation and Microbiology and Immunology, University of Western Ontario, London, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Type 1 diabetes in nonobese diabetic (NOD) mice is characterized by the infiltration of T and B cells into pancreatic islets. T cells bearing the TCR V{beta}3 chain are disproportionately represented in the earliest stages of islet infiltration (insulitis) despite clonal deletion of most V{beta}3+ immature thymocytes by the mammary tumor virus-3 (Mtv-3) superantigen (SAg). In this report we showed that a high frequency of NOD V{beta}3+ T cells that escape deletion are activated in vivo and that this phenotype is linked to the Mtv-3 locus. One potential mechanism of SAg presentation to peripheral T cells is by activated B cells. Consistent with this idea, we found that NOD mice harbor a significantly higher frequency of activated B cells than nondiabetes-prone strains. These activated NOD B cells expressed cell surface molecules consistent with APC function. At the molecular level, the IgH repertoire of activated B cells in NOD mice was equivalent to resting B cells, suggesting a polyclonal response in vivo. Genetic analysis of the activated B cell phenotype showed linkage to Idd1, the NOD MHC haplotype (H-2g7). Finally, V{beta}3+ thymocyte deletion and peripheral T cell activation did not require B cells, suggesting that other APC populations are sufficient to generate both Mtv-3-linked phenotypes. These data provide insight into the genetic regulation of NOD autoreactive lymphocyte activation that may contribute to failure of peripheral tolerance and the pathogenesis of type I diabetes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Elevated frequencies of activated lymphocytes are common features of autoimmune disorders (1, 2, 3, 4, 5, 6, 7, 8, 9). Activated T cells bearing autoreactive TCRs (3) infiltrate tissues that express the self-Ags, recruit inflammatory cells, and provide costimulatory signals that activate B cells (3, 8, 10, 11). Once activated, B cells become competent APCs (12), potentiating autoreactive T cell recognition (3, 6, 13, 14). Hence, T and B cell activation fuels an inflammatory cascade leading to organ destruction. Efforts to identify genes that control autoimmune disease susceptibility have suggested that some of these genetic loci influence lymphocyte activation and homeostasis. For example, in the NZB x NZW mouse model of systemic lupus erythematosus, the sle1 locus has been shown to mediate loss of B cell tolerance and activation of autoreactive T cells (15). The sle2 locus was shown to regulate B cell hyperactivity and autoantibody production (16). In the MRL-lpr mouse model, lpr was identified as a mutation in the Fas gene resulting in persistent activation of autoreactive lymphocytes contributing to autoimmune nephritis (17). Although the genes at some of these loci have yet to be identified, these studies demonstrate that genetic regulation of lymphocyte activation, proliferation, and homeostasis plays a central role in autoimmune pathogenesis.

Insulin-dependent or type I diabetes mellitus (T1D)3 is an autoimmune disease characterized by the destruction of insulin-producing pancreatic {beta} islet cells (18). Accumulating evidence suggests that dysregulated lymphocyte activation and homeostasis play a role in diabetes susceptibility. Type I diabetes patients (4, 7) and their nondiabetic monozygotic twins display increased frequencies of activated circulating T cells compared with controls (19, 20). In the biobreeding rat model of T1D, variation at the lyp locus causes T cell lymphopenia that is required for diabetes susceptibility in this strain (21). In the nonobese diabetic (NOD) mouse model (22), two insulin-dependent diabetes (Idd) loci have been shown to influence the apoptotic response of lymphocytes to multiple cytotoxic agents (23, 24). In addition, robust proliferation of autoreactive T cells was observed after immunization of NOD mice with autoantigens (25, 26). Collectively, these results suggest that dysregulated T cell activation and death may contribute to susceptibility to and development of T1D.

Previously, we reported that NOD T cells that express the TCR V{beta}3+ gene segment are highly represented in early islet infiltrates and that these TCR {beta}-chains display restricted CDR3 region diversity, suggesting reactivity for relatively few Ags (27). NOD mice harbor an endogenous murine mammary tumor virus (Mtv)-3-encoded superantigen (SAg) that deletes the vast majority of V{beta}3+ thymocytes (28). Thus, these results suggested that rare NOD T cells that escape deletion may become activated and contribute to the early stages of autoimmune islet infiltration. Alternatively, V{beta}3+ T cells that escape deletion could be rendered unresponsive in peripheral tissues, as suggested by a transgenic model involving an Mtv SAg-responsive TCR (29). For these reasons it was of interest to determine whether NOD V{beta}3+ T cells that escape deletion are responsive to signals through their TCR, and whether they displayed evidence of activation in vivo. In this report we show that a high frequency of NOD V{beta}3+ T cells are activated in vivo and that this property is genetically linked to the endogenous SAg, Mtv-3, on chromosome 11.

T1D in NOD mice is primarily mediated by T cells (reviewed in Ref. 30). However, recent reports suggest that NOD B cells also play an important role (31, 32, 33, 34), but the mechanism of this effect is unclear. One possibility is that NOD B cells serve to capture and present critical islet Ags to autoreactive T cells (35, 36, 37). Earlier work suggested that B cells were most capable of presenting Mtv SAg to mature T cells (38), although CD8+ T cells and dendritic cells can perform this function under certain conditions (39, 40). B cell competence for Ag presentation requires an activation-dependent increase in cell surface expression of costimulatory molecules (41). To address the potential role of B cells as APC in the NOD model, we have evaluated their activation status, cell surface phenotype, and Ig repertoire diversity in vivo. We report that the frequency of activated B cells in NOD mice is significantly higher than that observed in other strains, and that the phenotype of these B cells is consistent with their function as APC. In addition, we provide evidence for genetic linkage of B cell activation to or Idd1, the NOD MHC, particularly to I-Ag7. Interestingly, neither thymic deletion nor peripheral activation of NOD V{beta}3+ T cells required B cells, suggesting the sufficiency of other APC types in regulating these potentially autoreactive T cells. Heightened levels of T and B lymphocyte activation behave as genetically regulated events in NOD mice that are evident long before diabetes onset. These observations support a central role of dysregulated lymphocyte homeostasis in preclinical stages of diabetes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

All mice used in these studies were maintained in a pathogen-free facility in which the incidence of diabetes in the NOD colony was 85% for females and 15% for males at 30 wk of age. Female NOD.H-2q SWR and NOD.H-2b C57BL/10 (NOD.B10) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). B cell-deficient NOD.µMT mice were obtained from Dr. D. V. Serreze (The Jackson Laboratory) (31). MHC class II-deficient NOD.I-A{beta}-/- mice were obtained from Dr. A. Jevnikar, University of Western Ontario (London, Canada) (42). The mice used in these studies were 2–7 wk old.

Abs and reagents

The Abs used in flow cytometric analyses, magnetic bead depletions, and in vitro lymphocyte activation assays were affinity-purified from tissue culture supernatants: anti-TCR C{beta} (H57.597), anti-CD3{epsilon} (145-2C11), anti-I-Ag7 (10-2.16), anti-B220 (RA3-6B2), anti-Mac-1 (M1/70); and anti-TCR V{beta}2 (B20.6), anti-TCR V{beta}3 (KJ25), anti-TCR V{beta}4 (KT4), anti-TCR V{beta}5 (MR9-4), anti-TCR V{beta}6 (44-22), anti-TCR V{beta}7 (TR310), anti-TCR V{beta}8 (F23.1), anti-TCR V{beta}9 (MR10-2), anti-TCR V{beta}11 (RR3-15), anti-TCR V{beta}13 (MR12-4), and anti-TCR V{beta}14 (14.2) determinants. Biotinylated anti-Kb (AF6-88.5), FITC-conjugated anti-CD25 (7D4), biotinylated and FITC-conjugated anti-CD69 (H1.2F3), biotinylated anti-IgM (R40-97), biotinylated anti-CD19 (1D3), FITC-conjugated anti-B7-1 (16-10A1), FITC-conjugated anti-B7-2 (GL1), FITC-conjugated anti-ICAM-1 (3E2), allophycocyanin-conjugated RA3-6B2, and FITC-conjugated and biotinylated isotype control Ab were purchased from BD PharMingen (San Diego, CA). Avidin-PE (AV-PE) was purchased from Caltag Laboratories (South San Francisco, CA). Propidium iodide for dead cell exclusion was purchased from Sigma-Aldrich (St. Louis, MO).

Generation and screening of (NOD x B6)F2 intercross mice

NOD mice have an MHC haplotype designated H-2g7 (Kd, I-A{alpha}d, I-A{beta}g7, I-E-/-, Db, Lb). NOD mice were crossed to C57BL/6 (H-2b, I-E-/-, Mtv-3-/-) mice. (NOD x B6)F2 progeny were screened to determine their MHC and Mtv-3 genotypes. Screening for Mtv-3 was performed by Southern blot as previously described (28) and was confirmed by flow cytometric analysis of PBL using anti-TCR V{beta}3 (KJ25) and a pan anti-TCR{beta} (H57.597) mAb. Mtv SAg-mediated deletion of T cells behaves as an autosomal dominant phenotype. A PBL KJ25:H57.597 ratio <1%, as seen in NOD mice, was invariably correlated with the presence of the Mtv-3 provirus by Southern blot. The absence of Mtv-3 was indicated by a PBL KJ25:H57.597 ratio >3%, as seen in B6 mice. The MHC haplotypes of (NOD x B6)F2 mice were determined by flow cytometric analyses of PBL using mAb 10-2.16 (recognizes I-A{beta}g7) and AF6-88.5 (recognizes H-2Kb). H-2g7 and H-2b homozygotes with and without the Mtv-3 provirus were identified for analysis.

Flow cytometry

Preparation and staining of lymph node (LN) cell suspensions were performed as previously described (43) using the Ab listed above. Two- and four-color FACS were performed on FACScan and FACSCalibur, respectively (BD Biosciences, Mountain View, CA). For small populations, 1 x 103–1 x 104 V{beta}3+ and V{beta}7+ T cells were counted per sample. Analysis of FACS data was performed using LYSIS II and CellQuest software (BD Biosciences).

Magnetic bead depletion for enrichment of V{beta}3+ cells in proliferation assays

Enrichment of BALB/c and NOD V{beta}3+ T cells was achieved by immunodepletion of LN cell suspensions using sheep anti-FITC Ab-coated magnetic beads (BioMag separator; Advanced Magnetics, Cambridge, MA) as directed. LN cells were stained with FITC-conjugated Ab directed against B220 and Mac-1 to deplete B cells and APCs, and anti-TCR V{beta}2, -4, -5, -6, -7, -8, -9, -11, -13, and -14 to enrich for V{beta}3+ T cells. B6 LN cells were depleted of non-T cells by staining with FITC-conjugated anti-B220 and anti-Mac-1 Ab. Immunomagnetic depletion efficiency was confirmed by flow cytometry.

Lymphocyte proliferation assays

Proliferative assays of NOD, BALB/c, and B6 V{beta}3+ T cells was performed using 96-well flat-bottom microtiter plates coated with KJ25 or isotype control hamster IgG Ab at 10 µg/ml as previously described (44). To assay equivalent numbers of V{beta}3+ T cells, 3 x 102–1 x 105 B6 B cell-depleted LN cells and 1 x 103–3 x 105 BALB/c or NOD V{beta}3-enriched LN cells were incubated in triplicate in Ab-coated wells. All samples were incubated with 2 x 105 mitomycin C-treated syngeneic splenocytes at 37°C and 5% CO2 in 200 µl of RPMI 1640 medium supplemented with 10% FBS, 5 x 10-3 M 2-ME, 10 mM L-glutamine, 10 mM HEPES, 10 U/ml rIL-2, and 5% penicillin/streptomycin. IL-2 was refreshed every 48 h. Stimulation with 3 µg/ml Con A (Boehringer Diagnostics, La Jolla, CA) was used as a proliferation control. After 72 h the cells were pulsed with 1 µCi of [3H]thymidine (Amersham, Oakville, Canada) for 6 h, and [3H]thymidine incorporation was measured. The mean counts per minute and SD were calculated for each triplicate (mean ± SD). Change in counts per minute was calculated by the difference between the mean counts per minute for the KJ25-treated samples and the mean counts per minute for the isotype control samples.

Cytokine assays

Assays for cytokine production by NOD and BALB/c LN cells were performed using APC-depleted LN cells enriched for V{beta}3+ T cells. V{beta}3-enriched LN cells were incubated in 24-well tissue culture plates coated with KJ25 or 145-2C11 Ab (10 µg/ml) in 1.5 ml of supplemented RPMI 1640 as described above. IL-2 was refreshed after 48 h. Supernatants were removed after 72 h of culture and measured for IL-4 and IFN-{gamma} in triplicate by ELISA using the DuoSet ELISA development system (R&D Systems, Minneapolis, MN) as directed. Recombinant mouse IL-4 and IFN-{gamma} supplied by the manufacturer were used to generate the standard curves for each assay. ELISA data were collected and analyzed using SOFTmax Pro software (version 2.1; Molecular Devices, Sunnyvale, CA).

RNA preparation and cDNA synthesis

LN cells were isolated from eight individual (4- to 6-wk-old) NOD mice. CD69+ and CD69- LN cells were separated by magnetic immunodepletion using FITC-conjugated H1.2F3 (anti-CD69) mAb as described above and confirmed by flow cytometric analysis. RNA was prepared from 1 x 106 NOD spleen cells and from 1 x 106 NOD CD69+ and CD69- LN cells using TRIzol as directed (Life Technologies, Burlington, Canada). RNA was reverse transcribed with Superscript II reverse transcriptase (RT; Life Technologies) as directed and resuspended in 20 µl of sterile H2O. The CD69+ and CD69- LN RNA samples from each animal were coincidentally reverse transcribed using a master RT mix to minimize differences in RT reaction efficiencies between the samples. For every RT reaction set, RNA prepared from NOD spleen cells was used in a mock (without RT) control reaction to provide a negative control in PCR.

Oligonucleotide primers and PCR amplification

In each set of PCRs, titrations of each cDNA sample were analyzed by PCR for {beta}-actin expression (45) and for the expression of B cell-specific gene product of IgH locus as previously described (46) using a degenerate VH 5'-primer, VHALL, and a Cµ 3'-primer, Cµ2A. The primer sequences used were 5' {beta}-actin primer, TGGGTCAGAAGGADTCCTATG; 3' {beta}-actin primer, CAGGCAGCTCATAGCTCTTCT; 5' VHALL primer, AGGT(C/G)(A/C)A(A/G)CTGCAG(C/G)AGTC(A/T)GG; and 3' Cµ2A primer, CTCGATGGTCACCGGATCTG. PCR with both primer sets was performed as follows: 2 min at 85°C followed by 30 cycles of 1.5 min at 94°C, 1.5 min at 55°C, 2.25 min at 72°C, then 10 min at 72°C in a PE 9700 thermal cycler. All PCR sets in which CD69+ and CD69- samples were compared were amplified simultaneously using common stock mixes and identical thermal cycling programs.

Molecular probes

Plasmids containing nine VH families (VH3609P, VHVGam3-8, VHSM7, VHJ606, VHX24, VH15, VHQ52N, VHS107, VH36-60) were provided by Dr. R. Riblet. Plasmids containing VH81X and two members of the VH7183 family, VH37 and VH14, were gifts from Dr. A. Feeney. An Igµ probe (45) was used to detect the total Ig amplification products. Plasmid DNA was prepared as previously described (47), and probes were purified using QIAEX II gel extraction (Qiagen, Chatsworth, CA). Fragments were labeled to high specific activity with [{alpha}-32P]dCTP (3000 Ci/mmol; Amersham) by random hexamer labeling as previously described (48).

Southern blot analysis

PCR products were separated by agarose gel electrophoresis, transferred to nylon membrane (ZetaProbe; Bio-Rad, Hercules, CA), and immobilized with UV light (Stratagene, La Jolla, CA). [{alpha}-32P]-Labeled DNA probes were prepared and hybridized as previously described (27). Each membrane was first probed with one VH family probe and exposed to phosphorscreen. The probe was subsequently stripped from the membrane as previously described (49), and the membrane was then rehybridized to 32P-labeled Cµ probe, followed by exposure to phosphorscreen (see Fig. 5GoA).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 5. Southern blot analysis of NOD CD69+ and CD69- B cell VH repertoire. LN cells were isolated from eight NOD mice at age 28 days and enriched for CD69+ and CD69- LN cells by magnetic bead depletion as described in Materials and Methods. Postenrichment, CD69 expression was confirmed by flow cytometry (data not shown). Three- to 5-fold dilutions of cDNA from CD69+ and CD69- LN cells of each animal were amplified with VHALL-Cµ2A and {beta}-actin primers and transferred to nylon membrane. A, Each blot was first probed with a 32P-labeled VH family probe (VHJ558 probe is shown) and exposed to a phosphorscreen. The VH probe was removed from the membrane, followed by hybridization of the 32P-labeled Ig Cµ probe to the membrane and exposure to phosphorscreen. B, The digitized signal represented by pixel number was quantified by ImageQuant software. The pixel numbers for the VH and Igµ probes for each sample were determined. The results for six VH families from four individual NOD mice are expressed as the mean ratio of CD69+:CD69- samples ± SD for the three dilutions of input cDNA.

 
Quantitation by phosphorscan

Southern blots were digitized by a phosphorscanner (Molecular Dynamics, Sunnyvale, CA). Absolute pixel number (signal intensity) was quantified by volume integration using ImageQuant software (Molecular Dynamics). Quantitation of cDNA titration was used to create a standard curve comparing input templates to signal output. A control sample (without RT) was used to correct for background hybridization for each reaction set. Quantitation of VH and Igµ probe signals was performed, and the pixel numbers (PVH and PIgµ, respectively) were calculated for each sample. The PVH:PIgµ ratio represents the VH family-specific signal compared with the Cµ signal in the cDNA sample. The PVH:PIgµ ratios were calculated for CD69+ and CD69- B cells samples for each animal. To compare the representation of VH families between CD69+ and CD69- B cells, the CD69+ PVH:PIgµ ratio was expressed relative to the CD69- PVH:PIgµ ratio. A CD69+:CD69- ratio of 1 indicates no difference between VH signal observed for CD69+ and CD69- B cells.

Statistical analysis

Statistical analysis of one-way ANOVA was performed using SuperANOVA 1.0 (Abacus Concepts, Berkeley, CA) software. Statistical significance was determined using the Tukey-Kramer test with a significance level of p = 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NOD V{beta}3+ T cells proliferate in response to signals through the TCR

Previously we reported that NOD V{beta}3+ T cells, although rare in the periphery, are well represented among the early islet-infiltrating cells (27). These findings suggested that T cells that escape Mtv-3-mediated clonal deletion may become activated and play a role in the initiation of autoimmune disease. However, one TCR-transgenic model suggested that SAg-reactive T cells that are not deleted by endogenous SAg become anergic to TCR ligation in the periphery (29). To determine the potential functionality of NOD V{beta}3+ T cells that escape Mtv-3 SAg-mediated deletion, lymphocyte proliferation assays were performed. The proliferative response of NOD V{beta}3+ T cells was compared with V{beta}3+ T cells from BALB/c and C57BL/6 (B6) mice. In BALB/c mice, Mtv-6 SAg mediates efficient deletion of V{beta}3+ T cells (50, 51), while B6 has no V{beta}3-specific endogenous SAg. Since V{beta}3+ T cells in NOD and BALB/c are rare, LN T cells expressing V{beta}2, -4, -9, -11, -13, and -14 were removed, resulting in enrichment of V{beta}3+ T cells to >=1% of total T cells. In B6 mice, V{beta}3+ T cells constitute 3% of the T cell population. For stimulation with anti-V{beta}3 Ab, B6 LN cells were diluted so that the absolute number of V{beta}3+ T cells in these cultures was equivalent to NOD and BALB/c V{beta}3-enriched LN cells. The LN T cells prepared in this manner were treated either with the polyclonal activator Con A or with KJ25 (anti-TCR V{beta}3 Ab) or isotype-matched Ab. T cells from all three strains displayed equally vigorous responses to Con A (Fig. 1GoA). Consistent with previous results (29), no significant proliferation was detected from BALB/c V{beta}3+ T cells. In contrast to BALB/c, NOD V{beta}3+ T cells proliferated following KJ25-mediated receptor ligation (Fig. 1GoA). Thus, unlike BALB/c V{beta}3+ T cells that escape endogenous Mtv SAg-mediated deletion, NOD V{beta}3+ T cells appear competent to respond to TCR-mediated signals.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Activation and proliferation of B6, BALB/c, and NOD V{beta}3+ T cells in vitro by TCR ligation. LN cells were isolated from 4- to 6-wk-old B6, BALB/c, and NOD mice. LN cells were enriched for V{beta}3+ T cells by magnetic bead depletion as described in Materials and Methods. A, Equivalent numbers of V{beta}3+ T cells from each strain were activated with Con A, immobilized anti-TCR V{beta}3 Ab (KJ25), or an isotype-matched control Ab (hamster IgG). After 72 h all samples were pulsed with [3H]thymidine to quantify proliferating cells. Left panel, B6, BALB/c and NOD LN cells proliferated in response to the lectin, Con A. Right panel, B6, BALB/c, and NOD V{beta}3-enriched LN cells proliferation in the presence of KJ25 compared with the isotype control Ab. B, Cytokine release by in vitro-activated NOD and BALB/c T cells and V{beta}3+ T cells. LN cells from six mice of each strain were enriched for V{beta}3+ T cells. Postenrichment, V{beta}3+ T cells constituted approximately 1% of the APC-depleted, T cell population. V{beta}3-enriched LN cells (1 x 107) were activated with immobilized anti-CD3{epsilon} (145-2C11) or KJ25 Ab. After 72 h supernatants were analyzed for IFN-{gamma} and IL-4 by ELISA in triplicate. Because the Ab 145-2C11 activates all of the input cells, whereas KJ25 activates only 1% of the input cells, the table depicts the results as the mean ± SD per 105 responder cells for each assay. The lower limit of detection for IFN-{gamma} and IL-4 by ELISA was 0.1 pg/ml.

 
Although NOD V{beta}3+ T cells proliferate in response to signals through the TCR, the functional significance of this activated subset is unclear. Because NOD V{beta}3+ T cells are found in early islet infiltrates, activated V{beta}3+ T cells may secrete cytokines in the islet environment that could bias the local environment toward either proinflammatory Th1- or protective Th2-type response. Previous studies have shown that early islet expression of IFN-{gamma}, a Th1 cytokine, correlates with progression to invasive insulitis and diabetes (45, 52), whereas IL-4 expression during early insulitis correlates with protection from diabetes rather than disease progression (45, 53). To determine the cytokine(s) released by activated NOD V{beta}3+ T cells, cytokine assays were performed following in vitro activation. NOD and BALB/c LN cells produced both IFN-{gamma} and IL-4 following polyclonal T cell activation (Fig. 1GoB), indicating the potential of NOD T cells to produce both Th1 and Th2 cytokines. However, activation of NOD V{beta}3+ T cells produced detectable levels of IFN-{gamma} and undetectable levels of IL-4, whereas neither IFN-{gamma} nor IL-4 could be detected following activation of BALB/c V{beta}3+ T cells (Fig. 1GoB). These results suggest that NOD V{beta}3+ T cells may release IFN-{gamma} following activation in vivo and may contribute to the generation of a proinflammatory environment following their migration into the pancreatic islets. Thus, NOD V{beta}3+ T cell activation and cytokine production suggest that these autoreactive T cells may promote the development of diabetes in NOD mice.

Frequency of activated NOD V{beta}3+ T cells in vivo

Because NOD V{beta}3+ T cells responded to TCR ligation in culture (Fig. 1Go) and were found in the earliest detectable islet infiltrates (27), we postulated that a proportion of these T cells were activated in vivo in young NOD mice. Two cell surface markers were used to examine this idea: CD69, an early activation marker for B and T cells (reviewed in Ref. 54), and CD25, the {alpha}-chain of the high-affinity IL-2R expressed primarily on activated T cells (reviewed in Ref. 55). Using multiparameter flow cytometry, we first analyzed CD69 and CD25 expression on NOD V{beta}3+, V{beta}7+, and V{beta}8+ T cell subsets (0.3, 3–5, and 15–20% of the {alpha}{beta} T cell population, respectively) in 2- to 7-wk-old NOD mice (n = 20). A higher frequency of V{beta}3+ LN T cells expressed CD69+ compared with V{beta}7+ or V{beta}8+ T cell populations from the same animals (p = 0.0001, by one-way ANOVA; Fig. 2Go, A and B). Similarly, a higher frequency of NOD V{beta}3+ T cells coexpressed CD25 compared with V{beta}8+ T cells (p = 0.0001, by one-way ANOVA; Fig. 2GoB). Multiple LN sites (pancreatic, mesenteric, inguinal, and axillary) were compared for V{beta}3+ T cell CD69 and CD25 cell surface expression. No significant difference in the percentages of CD69+ or CD25+ NOD V{beta}3+ T cells was observed between these LN sites (data not shown). Collectively, these results suggest a higher frequency of NOD V{beta}3+ T cells are systemically activated in vivo compared with other T cell subsets.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of activation markers on NOD, BALB/c, or B6 T cells. LN cells (2 x 106) isolated from NOD, B6, and BALB/c mice were stained with FITC-anti-V{beta}3 (KJ25), -anti-V{beta}7 (TR310), -anti-V{beta}8 (F23.1) and biotinylated anti-CD69 (H1.2F3) or anti-CD25 (7D4) Ab, followed by AV-PE. Dead cells were excluded by propidium iodide staining. Results are expressed as the percentage of NOD, BALB/c, or B6 V{beta}3+, V{beta}7+, or V{beta}8+ cells that coexpressed CD69 or CD25. Each bar represents the results from 10 separate experiments performed on NOD (n = 20), BALB/c (n = 10), and B6 (n = 10) mice between 2 and 7 wk of age. The error bars represent the SE. A, FACS histograms of CD69 surface expression on NOD V{beta}3+ and V{beta}8+ T cells from one representative experiment. B, CD69 and CD25 expression on NOD V{beta}3+ and V{beta}8+ T cells. *, p = 0.0001, by one-way ANOVA. C, CD69 expression on NOD and BALB/c V{beta}3+ and V{beta}8+ T cells. *, p = 0.0001, by one-way ANOVA. D, CD25 expression on NOD and B6 V{beta}3+ and V{beta}8+ T cells. *, p = 0.0001 (by one-way ANOVA).

 
T cell activation in NOD and nondiabetes-susceptible strains

Next we asked whether the high frequency of in vivo activated V{beta}3+ T cells observed in NOD mice was evident in diabetes-resistant strains. We compared V{beta}3+ T cells from NOD to B6, which lacks a V{beta}3-specific Mtv, and to BALB/c , in which Mtv-6 SAg mediates deletion of V{beta}3+ thymocytes (50, 51). Compared with BALB/c , a higher frequency of NOD V{beta}3+ T cells coexpressed CD69 (p = 0.0001, by one-way ANOVA; Fig. 2GoC), but no significant differences were observed in V{beta}8+ T cell CD69 expression between the two strains. Similarly, a higher frequency of NOD compared with B6 V{beta}3+ T cells expressed CD25 (p = 0.0001, by one-way ANOVA; Fig. 2GoD) despite the 10-fold greater frequency of V{beta}3+ T cells in B6 compared with NOD mice. These data suggest that a significantly higher percentage of NOD V{beta}3+ T cells that escape thymic deletion are activated in vivo, even compared with BALB/c V{beta}3+ T cells that escape Mtv-6-mediated deletion. Thus, NOD V{beta}3+ T cells can be activated by signals through their TCR both in vitro and in vivo, a phenotype that was not observed in diabetes-resistant strains.

V{beta}3+ T cell activation segregates with the Mtv-3 provirus

The systemic activation of NOD V{beta}3+ T cells suggested a role for a ubiquitously expressed Ag. The V{beta}3-specific Mtv-3 SAg was a logical candidate given the distribution of APC, particularly activated B cells, previously shown to present Mtv SAg (38). To examine the requirement for Mtv-3 in the in vivo activation of NOD V{beta}3+ T cells, a genetic analysis was performed in a series of (NOD x B6)F2 mice segregating Mtv-3. The Mtv-3 genotype of the F2 mice was evaluated by Southern blot and FACS analysis (see Materials and Methods). Because of the well-established role of MHC haplotype in T cell repertoire selection, the V{beta}3+ T cell activation marker phenotype was evaluated in 40 H-2g7 homozygous F2 mice; 20 of these were Mtv-3 negative and 20 were Mtv-3 positive (see Materials and Methods). A higher frequency of CD69+V{beta}3+ T cells was observed in Mtv-3+ (NOD x B6)F2 mice compared with the Mtv-3-negative littermates (p = 0.0001, by one-way ANOVA; Fig. 3Go). In the Mtv-3+ (NOD x B6)F2 mice, the frequency of CD69+V{beta}3+ T cells was also greater than that of V{beta}8+ T cells (p = 0.0001, by one-way ANOVA; Fig. 3Go), as observed in NOD animals (Fig. 2Go). Together, these data suggest that both thymic and peripheral activation of V{beta}3+ NOD T cells require the Mtv-3 provirus, implicating the endogenous Mtv SAg in the activation of V{beta}3+ NOD T cells.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3. V{beta}3+ T cell activation in (NODxB6)F2 mice. (NODxB6)F2 mice were analyzed for H-2 and Mtv-3 genotypes (Materials and Methods). LN cells from H-2g7 homozygotes were stained with KJ25, F23.1, and H1.2F3. A, FACS histograms comparing CD69 surface expression on V{beta}3+ (right panels) and V{beta}8+ (left panels) T cells from Mtv-3 deficient (upper panels) and Mtv-3+ (lower panels) F2 animals. The solid lines represent isotype control. Dotted lines represent CD69 expression on V{beta}-specific subset. B, Comparison of CD69 surface expression on V{beta}3+ and V{beta}8+ T cells from (NOD x B6)F2 Mtv-3 segregants. Results are expressed as described in Fig. 2Go. Each bar represents the results from 20 mice. *, p = 0.0001; **, p = 0.0001 (by one-way ANOVA).

 
B cells are frequently activated in NOD mice

These data suggested that Mtv-3 was linked to the high frequency of activated V{beta}3+ T cells in NOD mice. Because multiple studies have shown that activated B cells are more efficient presenters of Mtv SAg than macrophages and dendritic cells (38, 56, 57), we examined the activation status of NOD B cells by surface expression of CD69 using flow cytometry. Interestingly, a greater percentage of NOD B220+ cells coexpressed CD69 than was seen in either BALB/c (Fig. 4GoA) or B6 mice (p = 0.0001, by one-way ANOVA; Table IGo), whereas expression of this marker on myeloid APC was equivalent between strains (Fig. 4GoA). Similarly, a higher frequency of NOD CD19+IgM+ cells expressed CD69 compared with similar subsets from control mice, confirming the B cell phenotype of these cells (data not shown). This high percentage of activated B cells was observed in NOD mice as young as 14 days of age, 10–15 days prior to the onset of peri-insulitis (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 4. B cell activation in NOD and BALB/c mice. A, LN cells (2 x 106) from NOD and BALB/c mice were stained with FITC-anti-B220 (RA3-6B2), FITC-anti-Mac-1 (M1/70), and biotinylated anti-CD69 (H1.2F3) Ab, followed by AV-PE. Dead cells were excluded by propidium iodide staining. Results are expressed as the percentage of 6B2+ or M1/70+ cells that coexpressed CD69. Each bar represents the average results (± SE) from 23 NOD and 16 BALB/c mice. *, p = 0.0001; **, p = 0.47 (by one-way ANOVA). B, Phenotype of LPS-activated and in vivo-activated NOD B cells. LN cell suspensions were stained with FITC-anti-class II MHC (10-2.16), FITC-anti-B7-1 (16-10A1), FITC-anti-B7-2 (GL1), FITC-anti-ICAM-1 (3E2), biotinylated anti-CD69 (H1.2F3), and allophycocyanin-conjugated anti-B220 (RA3-6B2), followed by AV-PE, and analyzed by three-color FACS. LPS-activated LN cells were used as controls. The histograms depict the fluorescence intensity gated on B220+ LN cells for class II, B7-1, B7-2, or ICAM-1 molecules on LPS-treated or fresh ex vivo NOD LN B cells.

 

View this table:
[in this window]
[in a new window]
 
Table I. Mean percentage of CD69 expression on LN B cells in NOD, C57BL/6, BALB/C, and NOD congenic strains1

 
The capacity of activated B cells to serve as efficient APC depends upon the expression of costimulatory molecules such as B7-1 and B7-2, adhesion molecules such as ICAM-1, and MHC class II molecules (12). Expression of these proteins was examined on ex vivo and LPS-activated NOD CD69- and CD69+ B cells (Fig. 4GoB). The mean fluorescence intensity of MHC class II, B7-1, B7-2, and ICAM-1 expression was increased on CD69+ compared with CD69- NOD B cells and was comparable to the level of expression on LPS-activated B cells (Table IIGo). Only B7-2 expression was lower on ex vivo CD69+ NOD B cells compared with LPS-activated CD69+ B cells. Therefore, the phenotype of CD69+ NOD B cells was consistent with their function as competent APC.


View this table:
[in this window]
[in a new window]
 
Table II. Surface expression of MHC class II, B7-1, B7-2 and ICAM-1 on LPS-activated and ex vivo NOD LN B cells1

 
Repertoire analysis of NOD CD69+ B cells

The high frequency of activated NOD LN B cells could represent either polyclonal activation by many Ags or mitogens or an oligoclonal subset activated by Ag-specific interactions. To address this issue, the Ig VH repertoire expressed by CD69+ and CD69- B cells was compared in individual NOD mice. Magnetic bead immunodepletion was used to partition CD69+ and CD69- NOD LN cells and resulted in >90% purity of these subsets (data not shown). A semiquantitative RT-PCR and Southern blot analysis approach was designed to detect transcripts (cDNA) containing nine different Ig VH genes in NOD CD69+ and CD69- LN cells (see Materials and Methods). A single pair of IgH primers capable of amplifying a broad repertoire of VH genes in Igµ transcripts (VHALL and Cµ2A) (46) was used for each sample. Replicate RT-PCRs were evaluated by Southern blot hybridization with nine VH family-specific probes and with a Cµ to normalize for total IgH cDNA. Several of the VH probes were selected because they are infrequently represented in the mature B cell repertoire and were more likely to be absent from an oligoclonal population. Serial dilutions of cDNA demonstrated that the sensitivity of IgH cDNA detection was approximately 10 cells (data not shown). Using this approach, no significant or reproducible difference in VH family gene usage was detected between CD69+ and CD69- NOD B cells in four individual mice (Fig. 5GoB). These data were most consistent with polyclonal B cell activation in NOD mice.

Activation of NOD V{beta}3+ T cells is B cell independent

The correlation between the high frequencies of in vivo activated V{beta}3+ T cells and B cells in NOD mice suggests that B cells may be involved in Ag and/or SAg presentation to and activation of V{beta}3+ T cells. To determine whether B cells were required to generate the high frequency of activated V{beta}3+ T cells and whether thymic deletion of V{beta}3+ T cells by Mtv-3 was B cell dependent, we used B cell-deficient NOD.µMT mice carrying disruption of the Igµ gene (31). Identical frequencies of V{beta}3+ T cells were observed in NOD.µMT and NOD mice, suggesting that deletion of NOD V{beta}3+ T cells by Mtv-3 is not dependent upon mature B cells (Fig. 6GoA). Interestingly, there were also no significant differences in the percentages of CD69+ or CD25+V{beta}3+ T cells between NOD and NOD.µMT mice (Fig. 6GoB). Together, these results suggest that NOD B cells are not required for either Mtv-3-mediated V{beta}3+ thymocyte deletion or peripheral activation of V{beta}3+ T cells.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 6. Impact of B cells on T cell activation in NOD mice. A, FACS histograms showing the percentage of V{beta}3+ T cells from 4-wk-old NOD and NOD.µMT mice. LN cells were stained with FITC anti-TCR C{beta} (H57.597) and biotinylated anti-V{beta}3 (KJ25), followed by AV-PE. B, Percentages of V{beta}3+ and V{beta}8+ T cells expressing activation markers in NOD and NOD.µMT mice. Each bar represents the average (± SE) from 10 animals.

 
Genetic linkage of NOD B cell activation to the NOD MHC

A high frequency of activated B cells was observed in NOD mice by14 days of age, suggesting that this phenotype precedes insulitis onset. A critical question was what mechanisms regulate NOD B cell activation. Because B cells can be activated by CD40 signals provided by T cells following interactions between TCR/Ag-MHC (3, 8, 10, 11), we asked whether B cell activation was genetically dependent on the NOD MHC haplotype H-2g7. To investigate this idea, the frequencies of activated B cells in NOD, (NOD x B6)F1, (NODxB6)F2, NOD H-2 congenics NOD.B10 (58), NOD.SWR, and MHC class II-deficient NOD.I-A{beta}-/- (42) were compared by flow cytometry. The frequency distributions of CD69+ B cells were similar among all H-2g7 homozygous (NODxB6)F2 mice (Table IGo and Fig. 7Go) and did not segregate with Mtv-3 (data not shown). Interestingly, H-2b/g7 (NODxB6)F1 and H-2g7 homozygous (NOD x B6)F2 mice displayed frequency distributions of CD69+ B cells similar to NOD mice (p = 0.99 and p = 0.68, respectively, by one-way ANOVA). In contrast, H-2d (BALB/c), H-2b (B6), H-2b (NOD x B6)F2, H-2b NOD.B10, and H-2q NOD.SWR mice all had lower frequencies of CD69+ B cells (Table IGo and Fig. 7Go). The H-2 haplotype correlated with B cell activation, as CD69 expression on B cells was significantly different in H-2g7, H-2b, and H-2d mice (p = 0001, by one-way ANOVA; Table IGo). In addition, a significantly lower percentage of activated B cells was observed in NOD.I-A{beta}-/- mice compared with wild-type NOD mice (p = 0.01, by one-way ANOVA). Interpretation of this result should be tempered by the presence of a 19-cM length of 129/Sv-derived chromosome 17 in NOD.I-A{beta}-/- mice that includes H-2Kb, as distinct from the NOD MHC haplotype that is H-2Kd (data not shown). Therefore, we cannot rule out a dampening effect of H-2Kb on the B cell activation phenotype. Collectively, these results suggest that the frequency of activated B cells in NOD mice is genetically linked to the Idd1 haplotype, which exerts a dominant effect on this phenotype. An elegant study showed that MHC class II expression on NOD B cells strongly influences diabetes incidence (59). Our results provide insight into a probable mechanism of this effect, that I-Ag7 expression is required for B cell activation by T cell costimulatory interactions, enabling their APC function in diabetes pathogenesis.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. The high frequency of activated B cells is linked to the NOD MHC. (NOD x B6)F1 and (NOD x B6)F2 mice were bred and screened for H-2 haplotypes as described (see Materials and Methods). LN cells were stained with FITC RA3-6B2 and biotinylated H1.2F3. The average percentage of CD69+B220+ LN cells for each mouse from each strain is shown, with one circle representing one mouse. Each vertical line represents the average percentage of CD69+B220+ LN cells for each strain.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lymphocyte activation and homeostasis are thought to play important roles in diabetes pathogenesis, but the mechanisms of this effect are not yet clear (4, 7, 19, 20, 25). In this work we show that before insulitis onset, young NOD mice harbor a high frequency of activated V{beta}3+ T cells and polyclonal B cells compared with other strains. These lymphocyte phenotypes displayed linkage to two loci, activation of V{beta}3+ T cells to the endogenous SAg, Mtv-3 and polyclonal B cell activation to Idd1, the MHC, and particularly the class II genes. Given previous evidence that V{beta}3+ T cells are rare in NOD mice but are present in the earliest islet infiltrates (27), we examined the behavior of these T cells isolated from peripheral LNs and spleen. We show in this study that a higher percentage of this T cell subset is activated in vivo compared with other TCR V{beta} subsets or to V{beta}3+ T cells in other mouse strains. These observations agree with previous reports that a higher percentage of NOD T cells display activation markers compared with other mouse strains (25, 26). Similar features are characteristic of the diabetes-prone biobreeding rat, where maintenance of the autoreactive T cell compartment depends upon the activation and proliferation of these cells linked to a diabetes susceptibility gene (60, 61, 62). Together, these findings suggest that activation of autoreactive T cells that escape clonal deletion contribute to diabetes pathogenesis.

Although T cell surface expression of CD25 (IL-2R {alpha}-chain) is up-regulated following T cell activation, CD25 may also be a marker for a subset of T cells with regulatory function (reviewed in Ref. 63). Regulatory CD25+ T cells derive from CD25+CD4+CD8- thymocytes and acquire their characteristic phenotype during thymic maturation (64). In the peripheral lymphoid population, the distinction between CD25+ regulatory vs CD25+-activated CD4+ T cells is based on functional studies. CD25+CD4+ T cells do not proliferate in response to TCR stimulation (64) and protect against autoimmune disease onset upon cotransfer with pathogenic CD25-CD4+ T cells (64, 65). Thus, the functional significance of this regulatory T cell population distinguishes their identity from other T cell subsets rather than by CD25 expression alone. The significance of this regulatory subset in T1D was described in one recent study that reported the role of NOD splenic CD25+CD4+ T cells in NOD T1D development (66). Importantly, these CD25+CD4+ T cells were shown to oppose the effects of islet-reactive CD25-CD4+ T cells in coadoptive transfer experiments, thereby protecting against diabetes onset. Although these results may imply a regulatory role for the CD25+V{beta}3+ LN T cells identified in our study, the available evidence suggests that they are unlikely to be regulatory T cells. First, the distinctive feature of regulatory CD25+CD4+ T cells is that they proliferate poorly in response to TCR signals (64, 67, 68). In contrast, we found that NOD V{beta}3+ T cells proliferate vigorously in response to TCR ligation in vitro. Second, one report suggests that CD25+CD4+ regulatory cells are capable of producing both Th1 and Th2 cytokines, such as IFN-{gamma} and IL-4 (69). However, IFN-{gamma}, but not IL-4, was detected following activation of NOD V{beta}3+ T cells, whereas both cytokines were produced by polyclonal activated NOD T cells. Thus, NOD V{beta}3+ T cells do not conform to the cytokine profile of regulatory T cells. Finally, these data are consistent with previous evidence that NOD V{beta}3+ T cells were represented among early islet-infiltrating cells (27), indicating that V{beta}3+ T cells activated in vivo migrate to sites of autoimmune inflammation, potentially mediating a proinflammatory response. It is possible that both regulatory and effector cells are represented within the NOD V{beta}3+ T cell subset, as islet Ag-specific, TCR V{beta}-specific T cells can mediate both functions (70), and regulatory and effector cells overlap in the expression of cell surface markers such as CD25. However, these data taken together are more consistent with the idea that CD25 expression on NOD V{beta}3+ T cells reflects their activation rather than a regulatory phenotype. Their proliferative response and cytokine profile suggest that NOD CD25+V{beta}3+ T cells may be autoreactive T cells participating in the pathogenesis of NOD diabetes. More significantly, our results reflect the failure to maintain peripheral tolerance of NOD V{beta}3+ T cells, indicating the mechanisms by which autoimmune disease develops in the NOD mouse.

The high frequency of activated NOD V{beta}3+ T cells was an unexpected finding, as V{beta}3+ T cells constitute <1% of NOD T cells. Given the equally high frequencies of V{beta}3+ T cells expressing the activation markers CD25 and CD69 in different anatomic sites, the data suggested systemic, rather than pancreas-proximal, activation of this T cell subset. We observed that NOD V{beta}3+ T cell activation was genetically linked to the Mtv-3 locus, consistent with the idea that TCR interaction with endogenous SAg contributes to this activated phenotype. Although SAg interact with nonpolymorphic residues in TCRV{beta}, both the TCR {alpha}-chain and variable TCR{beta} determinants influence specificity for the SAg/MHC complexes (reviewed in Ref. 71). As a result, some V{beta}3+ T cells may escape SAg-mediated thymic deletion because their TCR {alpha}-chain and/or other TCR{beta} determinants limit affinity/avidity for SAg/MHC complexes (72). Alternatively, some potentially SAg-reactive thymocytes escape because they fail to encounter a sufficient density of SAg to mediate deletion. Whether due to differential TCR affinity for SAg, or stochastic inefficiencies in thymic deletion, V{beta}3+ T cells may respond to Mtv-3 SAg when presented at sufficient concentration by professional APC (73). Taken together with the previous demonstration that V{beta}3+ T cells contribute to early NOD insulitis, Mtv-3 SAg-mediated activation of these T cells may promote their involvement in autoimmune inflammation.

Although our results are consistent with a role for Mtv-3 in the activation of NOD V{beta}3+ T cells, these results cannot rule out that Mtv-3 is a marker for a linked gene. One candidate locus on chromosome 11 is the Idd4, previously shown to affect the frequency and progression of insulitis to overt diabetes (74, 75). Idd4 behaves as a recessive or dominant with low penetrance gene when scoring diabetes in crosses between NOD and C57BL/10 mice (74, 75, 76), but the relevant gene(s) at this locus has not yet been identified. In our study the NOD-derived chromosome 11 carrying Mtv-3 behaved as a fully penetrant dominant locus for both deletion of V{beta}3+ thymocytes and activation of V{beta}3+ peripheral T cells. Thymocyte deletion and peripheral T cell activation phenotypes always cosegregated in the (NOD x B6)F2 progeny. This genetic behavior is identical with that of other Mtv-encoded SAg specific for other TCRV{beta} determinants. While it remains possible that Idd4 or another linked locus affected the deletion/activation of V{beta}3+ T cells, the data are most consistent with the interpretation that Mtv-3 controls these phenotypes in NOD mice.

The idea that viral Ag may be involved in the etiology of T1D has received considerable attention. Common human pathogenic viruses, including coxsackie (77) and congenital rubella (78), have been associated with the onset of human diabetes. It is possible that exposure to specific viral Ag and/or SAg may provoke activation of T cells cross-reactive with self-Ag, leading to the initiation of autoimmune disease in genetically susceptible individuals. Indeed, molecular mimicry between peptides from coxsackie virus and glutamic acid decarboxylase, a neuronal enzyme and an islet Ag (79, 80, 81), has been argued to support a hypothesis that T cell cross-reactivity to viral and self Ag presented on I-Ag7 may promote islet cell destruction in T1D (82, 83). Indeed it has been suggested that viral SAg influence diabetes in NOD mice (84) and in humans (85, 86), although the issue has generated controversy (87) and remains unresolved.

We have shown that a striking frequency of NOD B cells are activated in vivo, a feature observed by 2 wk of age and persisting until T1D onset (data not shown). This finding suggests that NOD B cells may be programmed to activate and proliferate in young NOD mice before the onset of insulitis. Therefore, enhanced lymphocyte activation in NOD mice is not restricted to T cells. We found that activated NOD B cells expressed high levels of MHC class II, costimulatory, and adhesion molecules, predicting that they are competent APC for naive T cells. Analyses of (NOD x B6)F2 and NOD congenic mice demonstrated the requirement for H-2g7 to generate the high frequency of activated NOD B cells. Together these data strongly suggest that activated B cells expressing NOD MHC class II molecules may serve as APC in the activation of autoreactive T cells. Indeed, recent reports suggest that NOD B cells are important for the development of T1D (31, 32, 33, 34), serve an important APC function (35, 36, 37), and must express I-Ag7 to contribute to diabetes development (59). The unique NOD class II molecule I-Ag7 has been implicated in the presentation of self-peptides due to promiscuous or altered peptide binding (59, 88, 89). Transgenic expression of MHC class II I-E or alternative alleles of I-A confers strong protection against T1D in NOD mice (reviewed in Ref. 90), suggesting a role for the NOD MHC class II haplotype in the selection and activation of autoreactive T cells (91, 92, 93). Furthermore, the NOD MHC contributes to isotype switch in the production of anti-insulin autoantibodies (94). Therefore, the NOD MHC class II haplotype is pivotal in multiple aspects of T cell and B cell function during progression to T1D.

Previous reports indicate that the NOD splenic B cell VH repertoire displays a bias toward D-proximal VH genes compared with B cells from nondiabetes-prone strains (95). We examined the VH repertoire of the CD69+ NOD B cells in individual mice to determine whether they represented expansion of an oligoclonal B cell subset. The repertoire of CD69+ NOD B cells did not differ significantly from that of CD69- B cells in the same animal, suggesting that NOD B cell activation in vivo is stochastic and not Ag restricted. This feature distinguishes NOD CD69+ B cells from the CD5+ B-1 B cell subset, which are of fetal and peritoneal origin and are characterized by a limited VH repertoire (reviewed in Ref. 96). However, like the CD5+ B-1 subset in the NZB and motheaten models of systemic lupus erythematosus (97), the NOD-activated B cell phenotype showed genetic linkage to a disease susceptibility locus, Idd1 (16). Hence, genetic regulation of B cell activation may contribute directly to the development of diabetes and other forms of autoimmune disease.

The activated V{beta}3+ T cell subset, the genetic linkage of this phenotype to Mtv-3, and the high frequency of CD69+ NOD B cells could be mechanistically related if activated B cells present Mtv-3 SAg to the V{beta}3+ T cells. However, we found that a similar frequency of CD25+CD69+V{beta}3+ T cells was observed in NOD.µMT mice that lack mature B cells. Our data indicate that neither the deletion nor the activation of V{beta}3+ T cells requires B cells, as these phenotypes did not differ between NOD and B cell-deficient NOD.µMT mice. In contrast to evidence that B cells are required for the negative selection of other subsets of Mtv-reactive T cells (98, 99), presentation by myeloid APC appears adequate to mediate both clonal deletion and activation of NOD V{beta}3+ T cells. Thus, there may be distinct requirements for B cells in activation of different islet-reactive T cells specificities in NOD mice (35, 36, 59).


    Acknowledgments
 
We thank Valerie Roy, Denise Martin, and Drs. Gillian Wu, Joan Wither, Trang Duong, Rae Yeung, and Roy Riblet for reagents and technical advice. We thank Drs. Philippe Poussier, Joan Wither, Gillian Wu, and Cynthia Guidos for many helpful discussions and the review of this manuscript.


    Footnotes
 
1 This work was supported by grants from the Canadian Diabetes Association in honor of Madelen Francis Armstrong and the Juvenile Diabetes Research Foundation. J.S.D. is a Research Scientist of the National Cancer Institute of Canada. P.P.L.C. is the recipient of a Juvenile Diabetes Research Foundation Postdoctoral Fellowship. Back

2 Address correspondence and reprint requests to Dr. Jayne S. Danska, Program in Developmental Biology, Hospital for Sick Children Research Institute, University of Toronto, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada. E-mail address: danska{at}sickkids.on.ca Back

3 Abbreviations used in this paper: T1D, type 1 diabetes mellitus; AV-PE, avidin-PE; LN, lymph node; Mtv, murine mammary tumor virus; NOD, nonobese diabetic; SAg, superantigen; RT, reverse transcriptase. Back

Received for publication July 24, 2001. Accepted for publication October 5, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Faveeuw, C., M.-C. Gagnerault, F. Lepault. 1994. Expression of homing and adhesion molecules in infiltrated islets of Langerhans and salivary glands of nonobese diabetic mice. J. Immunol. 152:5969.[Abstract]
  2. Shlomchik, M. J., M. P. Madaio, D. Ni, M. Trounstein, D. Huszar. 1994. The role of B cells in lpr/lpr-induced autoimmunity. J. Exp. Med. 180:1295.[Abstract/Free Full Text]
  3. Kouskoff, V., A.-S. Korganow, V. Duchatelle, C. Degott, C. Benoist, D. Mathis. 1996. Organ-specific disease provoked by systemic autoreactivity. Cell 87:811.[Medline]
  4. Peterson, L. D., G. Duinkerken, G. J. Bruining, R. A. W. van Lier, R. R. P. de Vries, B. O. Roep. 1996. Increased numbers of in vivo activated T cells in patients with recent onset insulin-dependent diabetes mellitus. J. Autoimmun. 9:731.[Medline]
  5. Mato, T., K. Masuko, Y. Misaki, N. Hirose, K. Ito, Y. Takemoto, K. Izawa, S. Yamamori, T. Kato, K. Nishioka, et al 1997. Correlation of clonal T cell expansion with disease activity in systemic lupus erythematosus. Int. Immunol. 9:547.[Abstract/Free Full Text]
  6. Chan, O., M. J. Shlomchik. 1998. A new role for B cells in systemic autoimmunity: B cells promote spontaneous T cell activation in MRL-lpr/lpr mice. J. Immunol. 160:51.[Abstract/Free Full Text]
  7. Gessl, A., W. Waldhausl. 1998. Increased CD69 and human leukocyte antigen-DR expression on T lymphocytes in insulin-dependent diabetes mellitus of long standing. J. Clin. Endocrinol. Metab. 83:2204.[Abstract/Free Full Text]
  8. Ishikawa, S., S. Akakura, M. Abe, K. Terashima, K. Chijiwa, H. Nishimura, S. Hirose, T. Shirai. 1998. A subset of CD4+ T cells expressing early activation antigen CD69 in murine lupus: possible abnormal regulatory role for cytokine imbalance. J. Immunol. 161:1267.[Abstract/Free Full Text]
  9. Odendahl, M., A. Jacobi, A. Hansen, E. Feist, F. Hiepe, G. R. Burmester, P. E. Lipsky, A. Radbruch, T. Dorner. 2000. Disturbed peripheral B lymphocyte homeostasis in systemic lupus erythematosus. J. Immunol. 165:5970.[Abstract/Free Full Text]
  10. Croft, M., S. L. Swain. 1995. Recently activated naive CD4 T cells can help resting B cells, and can produce sufficient autocrine IL-4 to drive differentiation to secretion of Th 2-type cytokines. J. Immunol. 154:4269.[Abstract]
  11. Bode, U., K. Wonigeit, R. Pabst, J. Westermann. 1997. The fate of activated T cells migrating through the body: rescue from apoptosis in the tissue of origin. Eur. J. Immunol. 27:2087.[Medline]
  12. Constant, S., N. Schweitzer, J. West, P. Ranney, K. Bottomly. 1995. B lymphocytes can be competent APCs for priming CD4+ T cells to protein antigens in vivo. J. Immunol. 155:3734.[Abstract]
  13. Lin, R.-H., R. J. Mamula, J. A. Hardin, C. A. Janeway. 1991. Induction of autoreactive B cells allows priming of autoreactive T cells. J. Exp. Med. 173:1433.[Abstract/Free Full Text]
  14. Chan, O. T., L. G. Hannum, A. M. Haberman, M. P. Madaio, M. J. Shlomchik. 1999. A novel mouse with B cells but lacking serum antibody reveals an antibody-independent role for B cells in murine lupus. J. Exp. Med. 189:1639.[Abstract/Free Full Text]
  15. Sobel, E. S., C. Mohan, L. Morel, J. Schiffenbauer, E. K. Wakeland. 1999. Genetic dissection of SLE pathogenesis: adoptive transfer of Sle1 mediates the loss of tolerance by bone marrow-derived B cells. J. Immunol. 162:2415.[Abstract/Free Full Text]
  16. Mohan, C., L. Morel, P. Yang, E. K. Wakeland. 1997. Genetic dissection of systemic lupus erythematosus pathogenesis: sle2 on murine chromosome 4 leads to B cell hyperactivity. J. Immunol. 159:454.[Abstract]
  17. Watanabe-Fukunaga, R., C. I. Brannan, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. Lymphoproliferative disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356:314.[Medline]
  18. Foster, D. W.. 1983. Diabetes mellitus. E. Braunwald, ed. In Harrison’s Principles of Internal Medicine Vol. 2:1778. McGraw-Hill, New York.
  19. Peakman, M., L. Alviggi, M. J. Hussain, D. A. Pyke, R. D. G. Leslie, D. Vergani. 1991. Persistent T cell activation predicts diabetes in unaffected identical co-twins of type 1 diabetics. Diabetologia 34:A56.
  20. Kallmann, B. A., E. F. Lampeter, P. Hanifi-Moghaddam, M. Hawa, R. D. Leslie, H. Kolb. 1999. Cytokine secretion patterns in twins discordant for type I diabetes. Diabetologia 42:1080.[Medline]
  21. Jacob, H. J., A. Pettersson, D. Wilson, Y. Mao, A. Lernmark, E. S. Lander. 1992. Genetic dissection of autoimmune type I diabetes in the BB rat. Nat. Genet. 2:56.[Medline]
  22. Makino, S., K. Kunimoto, Y. Muraoka, Y. Mizushima, K. Katagiri, Y. Tochino. 1980. Breeding of a nonobese diabetic strain of mice. Exp. Anim. 29:1.
  23. Penha-Goncalves, C., K. Lejon, L. Persson, D. Holmberg. 1995. Type 1 diabetes and the control of dexamethasone-induced apoptosis in mice maps to the same region on chromosome 6. Genomics 28:398.[Medline]
  24. Colucci, F., M.-L. Bergman, C. Penha-Goncalves, C. M. Cilio, D. Holmberg. 1997. Apoptosis resistance of nonobese diabetic peripheral lymphocytes linked to the Idd5 diabetes susceptibility region. Proc. Natl. Acad. Sci. USA 94:8670.[Abstract/Free Full Text]
  25. Ridgway, W. M., M. Vasso, A. Lanctot, C. Garvey, C. G. Fathman. 1996. Breaking self-tolerance in nonobese diabetic mice. J. Exp. Med. 183:1657.[Abstract/Free Full Text]
  26. Ridgway, W. M., H. Ito, M. Fasso, C. Yu, C. G. Fathman. 1998. Analysis of the role of variation of major histocompatibility complex class II expression on nonobese diabetic (NOD) peripheral T cell response. J. Exp. Med. 188:2267.[Abstract/Free Full Text]
  27. Galley, K. A., J. S. Danska. 1995. Peri-islet infiltrates of young nonobese diabetic mice display restricted TCR {beta}-chain diversity. J. Immunol. 154:2969.[Abstract]
  28. Fairchild, S., A. M. Knight, J. Dyson, K. Tomonari. 1991. Co-segregation of a gene encoding a deletion ligand for Tcr{beta}-V3+ T cells with Mtv-3. Immunogenetics 34:227.[Medline]
  29. Blackman, M. A., H. Gerhard-Burgert, D. L. Woodland, E. Palmer, J. W. Kappler, P. Marrack. 1990. A role for clonal inactivation in T cell tolerance to Mls-1. Nature 345:540.[Medline]
  30. Delovitch, T. L., B. Singh. 1997. The nonobese diabetic mouse as a model of autoimmune diabetes: immune dysregulation gets the NOD. Immunity 7:727.[Medline]
  31. Serreze, D. V., H. D. Chapman, D. S. Varnum, M. S. Hanson, P. C. Reifsnyder, S. D. Richard, S. A. Fleming, E. H. Leiter, L. D. Shultz. 1996. B lymphocytes are essential for the initiation of T cell-mediated autoimmune diabetes: analysis of a new "speed congenic" stock of NOD.Igµnull mice. J. Exp. Med. 184:2049.[Abstract/Free Full Text]
  32. Noorchashm, H., N. Noorchashm, J. Kern, S. Y. Rostami, C. F. Barker, A. Naji. 1997. B-cells are required for the initiation of insulitis and sialitis in nonobese diabetic mice. Diabetes 46:941.[Abstract]
  33. Akashi, T., S. Nagafuchi, K. Anzai, S. Kondo, D. Kitamura, S. Wakana, J. Ono, M. Kikuchi, Y. Niho, T. Watanabe. 1997. Direct evidence for the contribution of B cells to the progression of insulitis and the development of diabetes in nonobese diabetic mice. Int. Immunol. 9:1159.[Abstract/Free Full Text]
  34. Yang, M., B. Charlton, A. M. Gautam. 1997. Development of insulitis and diabetes in B cell-deficient NOD mice. J. Autoimmun. 10:257.[Medline]
  35. Falcone, M., J. Lee, G. Patstone, B. Yeung, N. Sarvetnik. 1998. B lymphocytes are crucial antigen-presenting cells in the pathogenic autoimmune response to GAD65 antigen in nonobese diabetic mice. J. Immunol. 161:1163.[Abstract/Free Full Text]
  36. Serreze, D. V., S. A. Fleming, H. D. Chapman, S. D. Richard, E. H. Leiter, R. M. Tisch. 1998. B lymphocytes are critical APCs for the initiation of T cell-mediated autoimmune diabetes in nonobese diabetic mice. J. Immunol. 161:3912.[Abstract/Free Full Text]
  37. Noorchashm, H., D. J. Moore, L. E. Noto, N. Noorchashm, A. J. Reed, A. L. Reed, H. K. Song, R. Mozaffari, A. M. Jevnikar, C. F. Barker, et al 2000. Impaired CD4 T cell activation due to reliance upon B cell-mediated costimulation in nonobese diabetic (NOD) mice. J. Immunol. 165:4685.[Abstract/Free Full Text]
  38. Webb, S. R., A. Okamoto, Y. Ron, J. Sprent. 1989. Restricted tissue distribution of Mlsa determinants: stimulation of Mlsa-reactive T cells by B cells but not by dendritic cells or macrophages. J. Exp. Med. 169:1.[Abstract/Free Full Text]
  39. Beutner, U., E. Kraus, D. Kitamura, K. Rajewsky, B. T. Huber. 1994. B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens. J. Exp. Med. 179:1457.[Abstract/Free Full Text]
  40. Waanders, G. A., A. N. Shakhov, W. Held, O. Karapetian, H. Acha-Orbea, H. R. MacDonald. 1993. Peripheral T cell activation and deletion induced by transfer of lymphocyte subsets expressing endogenous or exogenous mouse mammary tumor virus. J. Exp. Med. 177:1359.[Abstract/Free Full Text]
  41. Ho, W. Y., M. P. Cooke, C. C. Goodnow, M. M. Davis. 1994. Resting and anergic B cells are defective in CD28-dependent costimulation of naive CD4+ T cells. J. Exp. Med. 179:1539.[Abstract/Free Full Text]
  42. Anderson, C. C., R. Mukherjee, N. R. Sinclair, A. M. Jevnikar. 1997. Hypogammaglobulinaemia occurs in Fas-deficient MRL-lpr mice following deletion of MHC class II molecules. Clin. Exp. Immunol. 109:473.[Medline]
  43. Guidos, C. J., I. L. Weissman, B. Adkins. 1989. Developmental potential of CD4-8- thymocytes: peripheral progeny includes mature CD4-8- T cells bearing {alpha}{beta} TCR. J. Immunol. 142:3773.[Abstract]
  44. Groves, T., P. Katis, Z. Madden, K. Manickam, D. Ramsden, G. Wu, C. J. Guidos. 1995. In vitro maturation of clonal CD4+CD8+ cell lines in response to TCR engagement. J. Immunol. 154:5011.[Abstract]
  45. Fox, C. J., J. S. Danska. 1997. IL-4 expression at the onset of islet inflammation predicts nondestructive insulitis in nonobese diabetic mice. J. Immunol. 158:2414.[Abstract]
  46. Pennycook, J., A. J. Marshall, G. E. Wu. 1997. PCR assays for endogenous Ig gene rearrangement. I. Lefkovitz, ed. Immunology Methods Manual 237. Academic Press, New York.
  47. Maniatis, T., E. F. Fritsch, J. Sambrook. 1982. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  48. Feinberg, A. P., B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6.[Medline]
  49. Brown, T.. 1993. Hybridization analysis of DNA blots. F. M. Ausubel, and R. Brent, and R. E. Kingston, and D. D. Moore, and J. G. Seidman, and J. A. Smith, and K. Stuhl, eds. In Current Protocols in Molecular Biology Vol. 1:2.10.6. Wiley, New York.
  50. Pullen, A. M., P. Marrack, J. W. Kappler. 1988. The T-cell repertoire is heavily influenced by tolerance to polymorphic self-antigens. Nature 335:796.[Medline]
  51. Abe, R., R. J. Hodes. 1989. T-cell recognition of minor lymphocyte stimulating (Mls) gene products. Annu. Rev. Immunol. 7:683.[Medline]
  52. Rabinovitch, A., W. L. Suarez-Pinzon, O. Sorensen, R. C. Bleackley, R. F. Power. 1995. IFN-{gamma} gene expression in pancreatic islet-infiltrating mononuclear cells correlates with autoimmune diabetes in nonobese diabetic mice. J. Immunol. 154:4874.[Abstract]
  53. Gallichan, W. S., B. Balasa, J. D. Davies, N. Sarvetnick. 1999. Pancreatic IL-4 expression results in islet-reactive Th2 cells that inhibit diabetogenic lymphocytes in the nonobese diabetic mouse. J. Immunol. 163:1696.[Abstract/Free Full Text]
  54. Testi, R., D. D’Ambrosio, R. De Maria, A. Santoni. 1994. The CD69 receptor: a multipurpose cell-surface trigger for hematopoietic cells. Immunol. Today 15:479.[Medline]
  55. Minami, Y., T. Kono, T. Miyazaki, T. Taniguchi. 1993. The IL-2 receptor complex: its structure, function, and target genes. Annu. Rev. Immunol. 11:245.[Medline]
  56. Molina, I. J., N. A. Cannon, R. Hyman, B. T. Huber. 1989. Macrophages and T cells do not express Mlsa determinants. J. Immunol. 143:39.[Abstract]
  57. Jarvis, C. D., R. N. Germain, G. L. Hager, M. Damschroder, L. A. Matis. 1994. Tissue-specific expression of messenger RNAs encoding endogenous viral superantigens. J. Immunol. 152:1032.[Abstract]
  58. Wicker, L. S., M. C. Appel, F. Dotta, A. Pressey, B. J. Miller, N. H. DeLarato, P. A. Fisher, R. C. J. Boltz, L. B. Peterson. 1992. Autoimmune syndromes in major histocompatibility complex (MHC) congenic strains of nonobese diabetic (NOD) mice: the NOD MHC is dominant for insulitis and cyclophosphamide-induced diabetes. J. Exp. Med. 176:67.[Abstract/Free Full Text]
  59. Noorchashm, H., Y. K. Lieu, N. Noorchashm, S. Y. Rostami, S. A. S. Greeley, A. Schlacterman, H. K. Song, L. E. Noto, A. M. Jevnikar, C. F. Barker, et al 1999. I-Ag7-mediated antigen presentation by B lymphocytes is critical in overcoming a checkpoint in T cell tolerance to islet {beta} cells of nonobese diabetic mice. J. Immunol. 163:743.[Abstract/Free Full Text]
  60. Ramanathan, S., P. Poussier. 1998. Antigen activation rescues recent thymic emigrants from programmed cell death in the BB rat. J. Immunol. 160:5757.[Abstract/Free Full Text]
  61. Moore, J. K., D. Bellgrau. 1999. Promiscuous activation and cell cycle entry in T cells from autoimmune animals. Transplant. Proc. 31:1606.[Medline]
  62. Moore, J. K., R. I. Scheinman, D. Bellgrau. 2001. The identification of a novel T cell activation state controlled by a diabetogenic gene. J. Immunol. 166:241.[Abstract/Free Full Text]
  63. Shevach, E. M.. 2000. Regulatory T cells in autoimmunity. Annu. Rev. Immunol. 18:423.[Medline]
  64. Itoh, M., T. Takahashi, N. Sakaguchi, Y. Kuniyasu, J. Shimizu, F. Otsuka, S. Sakaguchi. 1999. Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J. Immunol. 162:5317.[Abstract/Free Full Text]
  65. Annacker, O., R. Pimenta-Araujo, O. Burlen-Defranoux, T. C. Barbosa, A. Cumano, A. Bandeira. 2001. CD25+CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10. J. Immunol. 166:3008.[Abstract/Free Full Text]
  66. Salomon, B., D. J. Lenschow, L. Rhee, N. Ashourian, B. Singh, A. Sharpe, J. A. Bluestone. 2000. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431.[Medline]
  67. Takahashi, T., Y. Kuniyasu, M. Toda, N. Sakaguchi, M. Itoh, M. Iwata, J. Shimizu, S. Sakaguchi. 1998. Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int. Immunol. 10:1969.[Abstract/Free Full Text]
  68. Thornton, A. M., E. M. Shevach. 1998. CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J. Exp. Med. 188:287.[Abstract/Free Full Text]
  69. Asano, M., T. Masaaki, N. Sakaguchi, S. Sakaguchi. 1996. Autoimmune disease as a consequence of developmental abnormality of a T cell population. J. Exp. Med. 184:387.[Abstract/Free Full Text]
  70. Quinn, A., B. McInerney, E. P. Reich, O. Kim, K. P. Jensen, E. E. Sercarz. 2001. Regulatory and effector CD4 T cells in nonobese diabetic mice recognize overlapping determinants on glutamic acid decarboxylase and use distinct V{beta} genes. J. Immunol. 166:2982.[Abstract/Free Full Text]
  71. Li, H., A. Llera, E. L. Malchiodi, R. A. Mariuzza. 1999. The structural basis of T cell activation by superantigens. Annu. Rev. Immunol. 17:435.[Medline]
  72. Chies, J. A. B., G. Marodon, A. Joret, A. Regnault, M. Lembezat, B. Rocha, A. Freitas. 1995. Persistence of V{beta}6+ T cells in Mls-1a mice: a role for the third complementarity-determining region (CDR3) of the T cell receptor in superantigen recognition. J. Immunol. 155:4171.[Abstract]
  73. Heeg, K., H. Wagner. 1995. Induction of responsiveness in superantigen-induced anergic T cells: role for ligand density and constimulatory signals. J. Immunol. 155:83.[Abstract]
  74. Todd, J. A., T. J. Aitman, T. J. Cornall, S. Ghosh, J. R. S. Hall, C. M. Hearne, A. M. Knight, J. M. Love, M. A. McAleer, J.-B. Prins, et al 1991. Genetic analysis of autoimmune type 1 diabetes mellitus in mice. Nature 351:542.[Medline]
  75. Ghosh, S., S. M. Palmer, N. R. Rodrigues, H. J. Cordell, C. M. Hearne, R. J. Cornall, J.-B. Prins, O. McShane, G. M. Lathrop, L. B. Peterson, et al 1993. Polygenic control of autoimmune diabetes in non-obese diabetic mice. Nat. Genet. 4:404.[Medline]
  76. Todd, J. A.. 1990. Genetic control of autoimmunity in type 1 diabetes. Immunol. Today 11:122.[Medline]
  77. King, M. L., A. Shaikh, D. Bidwell, A. Voller, J. E. Banatvala. 1983. Coxsackie-B-virus-specific IgM responses in children with insulin-dependent (juvenile-onset; type I) diabetes mellitus. Lancet 1:1397.[Medline]
  78. Menser, M. A., J. M. Forrest, J. M. Bransby. 1978. Rubella infection and diabetes mellitus. Lancet 1:57.[Medline]
  79. Baekkeskow, S., H.-J. Aanstoot, S. Christgau, A. Reetz, M. Solimema, M. Cascalho, F. Folli, H. Richter-Olesen, P. Camilli. 1990. Identification of the 64K autoantigen in insulin-dependent diabetes as the GABA-synthesizing enzyme glutamic acid decarboxylase. Nature 347:151.[Medline]
  80. Tisch, R., X. Yang, S. M. Singer, R. S. Liblau, L. Fugger, H. O. McDevitt. 1993. Immune response to glutamic acid decarboxylase correlates with insulitis in non-obese diabetic mice. Nature 366:72.[Medline]
  81. Kaufman, D. L., M. Clare-Salzer, J. Tian, T. Forsthuber, G. S. P. Ting, P. Robinson, M. A. Atkinson, E. E. Sercarz, A. J. Tobin, P. V. Lehmann. 1993. Spontaneous loss of T-cell tolerance to glutamic acid decarboxylase in murine insulin-dependent diabetes. Nature 366:69.[Medline]
  82. Tian, J., P. V. Lehmann, D. L. Kaufman. 1994. T cell cross-reactivity between coxsackievirus and glutamic acid decarboxylase is associated with a murine diabetes susceptibility allele. J. Exp. Med. 180:1979.[Abstract/Free Full Text]
  83. Serreze, D. V., E. W. Ottendorfer, T. M. Ellis, C. J. Gauntt, M. A. Atkinson. 2000. Acceleration of type 1 diabetes by a coxsackievirus infection requires a preexisting critical mass of autoreactive T-cells in pancreatic islets. Diabetes 49:708.[Abstract]
  84. McDuffie, M., A. Ostrowska. 1993. Superantigen-like effects and incidence of diabetes in NOD mice. Diabetes 42:1094.[Abstract]
  85. Conrad, B., E. Weidmann, G. Trucco, W. A. Ridert, R. Behboo, C. Ricordi, H. Rodriquez-Rilo, D. Finegold, M. Trucco. 1994. Evidence for superantigen involvement in insulin-dependent diabetes mellitus aetiology. Nature 371:351.[Medline]
  86. Conrad, B., R. N. Weissmahr, J. Boni, R. Arcari, J. Schupbach, B. Mach. 1997. A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes. Cell 90:303.[Medline]
  87. Murphy, V. J., L. C. Harrison, W. A. Rudert, P. Luppi, M. Trucco, A. Fierabracci, P. A. Biro, G. F. Bottazzo. 1998. Retroviral superantigens and type 1 diabetes mellitus. Cell 95:9.[Medline]
  88. Miyazaki, T., M. Uno, M. Uehira, H. Kikutani, T. Kishimoto, M. Kimoto, H. Nishimoto, J. Miyazaki, K. Yamamura. 1990. Direct evidence for the contribution of the unique I-Anod to the development of insulitis in non-obese diabetic mice. Nature 345:722.[Medline]
  89. Latek, R. R., A. Suri, S. J. Petzold, C. A. Nelson, O. Kanagawa, E. R. Unanue, D. H. Fremont. 2000. Structural basis of peptide binding and presentation by the type I diabetes-associated MHC class II molecule of NOD mice. Immunity 12:699.[Medline]
  90. Wicker, L. S.. 1997. Major histocompatibility complex-linked control of autoimmunity. J. Exp. Med. 186:973.[Free Full Text]
  91. Reich, E., R. S. Sherwin, O. Kanagawa, C. A. Janeway. 1989. An explanation for the protective effect of the MHC class II I-E molecule in murine diabetes. Nature 341:326.[Medline]
  92. Schmidt, D., J. Verdaguer, N. Averill, P. Santamaria. 1997. A mechanism for the major histocompatibility complex-linked resistance to autoimmunity. J. Exp. Med. 186:1056.
  93. Kanagawa, O., J. Shimizu, B. A. Vaupel. 2000. Thymic and postthymic regulation of diabetogenic CD8 T cell development in TCR-transgenic nonobese diabetic mice. J. Immunol. 164:5466.[Abstract/Free Full Text]
  94. Hutchings, P., P. Tonks, A. Cooke. 1997. Effect of MHC transgene expression on spontaneous insulin autoantibody class switch in nonobese diabetic mice. Diabetes 46:779.[Abstract]
  95. Leijon, K., A. Freitas, D. Holmberg. 1993. Analysis of VH gene utilisation in the non-obese diabetic mouse. Autoimmunity 15:11.[Medline]
  96. Hardy, R. R., C. E. Carmack, Y. S. Li, K. Hayakawa. 1994. Distinctive developmental origins and specificities of murine CD5+ B cells. Immunol. Rev. 137:91.[Medline]
  97. Sidman, C. L., L. D. Shultz, R. R. Hardy, K. Haykawa, L. A. Herzenberg. 1986. Production of immunoglobulin isotypes by Ly-1+ B cells in viable motheaten and normal mice. Science 232:1423.[Abstract/Free Full Text]
  98. Mazda, O., Y. Watanabe, J. Gyotoku, Y. Katsura. 1991. Requirement of dendritic cells and B cells in the clonal deletion of Mls-reactive T cells in the thymus. J. Exp. Med. 173:539.[Abstract/Free Full Text]
  99. Inaba, M., K. Inaba, M. Hosono, T. Kumamoto, T. Ishida, S. Muramatsu, T. Masuda, S. Ikehara. 1991. Distinct mechanisms of neonatal tolerance induced by dendritic cells and thymic B cells. J. Exp. Med. 173:549.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. M. Marleau, K. L. Summers, and B. Singh
Differential Contributions of APC Subsets to T Cell Activation in Nonobese Diabetic Mice
J. Immunol., April 15, 2008; 180(8): 5235 - 5249.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Hussain and T. L. Delovitch
Intravenous Transfusion of BCR-Activated B Cells Protects NOD Mice from Type 1 Diabetes in an IL-10-Dependent Manner
J. Immunol., December 1, 2007; 179(11): 7225 - 7232.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Rolf, V. Motta, N. Duarte, M. Lundholm, E. Berntman, M.-L. Bergman, L. Sorokin, S. L. Cardell, and D. Holmberg
The Enlarged Population of Marginal Zone/CD1dhigh B Lymphocytes in Nonobese Diabetic Mice Maps to Diabetes Susceptibility Region Idd11
J. Immunol., April 15, 2005; 174(8): 4821 - 4827.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Hussain and T. L. Delovitch
Dysregulated B7-1 and B7-2 Expression on Nonobese Diabetic Mouse B Cells Is Associated with Increased T Cell Costimulation and the Development of Insulitis
J. Immunol., January 15, 2005; 174(2): 680 - 687.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Hussain, K. V. Salojin, and T. L. Delovitch
Hyperresponsiveness, Resistance to B-Cell Receptor--Dependent Activation-Induced Cell Death, and Accumulation of Hyperactivated B-Cells in Islets Is Associated With the Onset of Insulitis but not Type 1 Diabetes
Diabetes, August 1, 2004; 53(8): 2003 - 2011.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chiu, P. P. L.
Right arrow Articles by Danska, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chiu, P. P. L.
Right arrow Articles by Danska, J. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS