|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,
*
Program in Developmental Biology, Hospital for Sick Children Research Institute, Departments of
Surgery and
Immunology and
Institute of Medical Science, University of Toronto, Toronto, Canada; and
¶ Departments of Nephrology and Transplantation and Microbiology and Immunology, University of Western Ontario, London, Canada
| Abstract |
|---|
|
|
|---|
3 chain are disproportionately represented in the
earliest stages of islet infiltration (insulitis) despite clonal
deletion of most V
3+ immature thymocytes by the mammary
tumor virus-3 (Mtv-3) superantigen (SAg). In this report
we showed that a high frequency of NOD V
3+ T cells that
escape deletion are activated in vivo and that this phenotype is linked
to the Mtv-3 locus. One potential mechanism of SAg
presentation to peripheral T cells is by activated B cells. Consistent
with this idea, we found that NOD mice harbor a significantly higher
frequency of activated B cells than nondiabetes-prone strains. These
activated NOD B cells expressed cell surface molecules consistent with
APC function. At the molecular level, the IgH repertoire of activated B
cells in NOD mice was equivalent to resting B cells, suggesting a
polyclonal response in vivo. Genetic analysis of the activated B cell
phenotype showed linkage to Idd1, the NOD MHC haplotype
(H-2g7). Finally, V
3+ thymocyte deletion and
peripheral T cell activation did not require B cells, suggesting that
other APC populations are sufficient to generate both
Mtv-3-linked phenotypes. These data provide insight into
the genetic regulation of NOD autoreactive lymphocyte activation that
may contribute to failure of peripheral tolerance and the pathogenesis
of type I diabetes. | Introduction |
|---|
|
|
|---|
Insulin-dependent or type I diabetes mellitus
(T1D)3 is an
autoimmune disease characterized by the destruction of
insulin-producing pancreatic
islet cells (18).
Accumulating evidence suggests that dysregulated lymphocyte activation
and homeostasis play a role in diabetes susceptibility. Type I diabetes
patients (4, 7) and their nondiabetic monozygotic twins
display increased frequencies of activated circulating T cells compared
with controls (19, 20). In the biobreeding rat model of
T1D, variation at the lyp locus causes T cell lymphopenia
that is required for diabetes susceptibility in this strain
(21). In the nonobese diabetic (NOD) mouse model
(22), two insulin-dependent diabetes (Idd) loci
have been shown to influence the apoptotic response of lymphocytes to
multiple cytotoxic agents (23, 24). In addition, robust
proliferation of autoreactive T cells was observed after immunization
of NOD mice with autoantigens (25, 26). Collectively,
these results suggest that dysregulated T cell activation and death may
contribute to susceptibility to and development of T1D.
Previously, we reported that NOD T cells that express the TCR
V
3+ gene segment are highly represented in
early islet infiltrates and that these TCR
-chains display
restricted CDR3 region diversity, suggesting reactivity for relatively
few Ags (27). NOD mice harbor an endogenous murine mammary
tumor virus (Mtv)-3-encoded superantigen (SAg)
that deletes the vast majority of V
3+
thymocytes (28). Thus, these results suggested that rare
NOD T cells that escape deletion may become activated and contribute to
the early stages of autoimmune islet infiltration. Alternatively,
V
3+ T cells that escape deletion could be
rendered unresponsive in peripheral tissues, as suggested by a
transgenic model involving an Mtv SAg-responsive TCR (29).
For these reasons it was of interest to determine whether NOD
V
3+ T cells that escape deletion are
responsive to signals through their TCR, and whether they displayed
evidence of activation in vivo. In this report we show that a high
frequency of NOD V
3+ T cells are activated in
vivo and that this property is genetically linked to the endogenous
SAg, Mtv-3, on chromosome 11.
T1D in NOD mice is primarily mediated by T cells (reviewed in Ref.
30). However, recent reports suggest that NOD B cells also
play an important role (31, 32, 33, 34), but the mechanism of this
effect is unclear. One possibility is that NOD B cells serve to capture
and present critical islet Ags to autoreactive T cells
(35, 36, 37). Earlier work suggested that B cells were most
capable of presenting Mtv SAg to mature T cells (38),
although CD8+ T cells and dendritic cells can
perform this function under certain conditions (39, 40). B
cell competence for Ag presentation requires an activation-dependent
increase in cell surface expression of costimulatory molecules
(41). To address the potential role of B cells as APC in
the NOD model, we have evaluated their activation status, cell surface
phenotype, and Ig repertoire diversity in vivo. We report that the
frequency of activated B cells in NOD mice is significantly higher than
that observed in other strains, and that the phenotype of these B cells
is consistent with their function as APC. In addition, we provide
evidence for genetic linkage of B cell activation to or
Idd1, the NOD MHC, particularly to
I-Ag7. Interestingly, neither thymic deletion nor
peripheral activation of NOD V
3+ T cells
required B cells, suggesting the sufficiency of other APC types in
regulating these potentially autoreactive T cells. Heightened levels of
T and B lymphocyte activation behave as genetically regulated events in
NOD mice that are evident long before diabetes onset. These
observations support a central role of dysregulated lymphocyte
homeostasis in preclinical stages of diabetes.
| Materials and Methods |
|---|
|
|
|---|
All mice used in these studies were maintained in a
pathogen-free facility in which the incidence of diabetes in the NOD
colony was 85% for females and 15% for males at 30 wk of age. Female
NOD.H-2q SWR and NOD.H-2b
C57BL/10 (NOD.B10) mice were purchased from The Jackson Laboratory (Bar
Harbor, ME). B cell-deficient NOD.µMT mice were obtained from Dr.
D. V. Serreze (The Jackson Laboratory) (31). MHC
class II-deficient NOD.I-A
-/- mice were
obtained from Dr. A. Jevnikar, University of Western Ontario (London,
Canada) (42). The mice used in these studies were 27
wk old.
Abs and reagents
The Abs used in flow cytometric analyses, magnetic bead
depletions, and in vitro lymphocyte activation assays were
affinity-purified from tissue culture supernatants: anti-TCR C
(H57.597), anti-CD3
(145-2C11),
anti-I-Ag7 (10-2.16), anti-B220
(RA3-6B2), anti-Mac-1 (M1/70); and anti-TCR V
2 (B20.6),
anti-TCR V
3 (KJ25), anti-TCR V
4 (KT4), anti-TCR V
5
(MR9-4), anti-TCR V
6 (44-22), anti-TCR V
7 (TR310),
anti-TCR V
8 (F23.1), anti-TCR V
9 (MR10-2), anti-TCR
V
11 (RR3-15), anti-TCR V
13 (MR12-4), and anti-TCR V
14
(14.2) determinants. Biotinylated anti-Kb
(AF6-88.5), FITC-conjugated anti-CD25 (7D4), biotinylated and
FITC-conjugated anti-CD69 (H1.2F3), biotinylated anti-IgM
(R40-97), biotinylated anti-CD19 (1D3), FITC-conjugated
anti-B7-1 (16-10A1), FITC-conjugated anti-B7-2 (GL1),
FITC-conjugated anti-ICAM-1 (3E2), allophycocyanin-conjugated
RA3-6B2, and FITC-conjugated and biotinylated isotype control Ab were
purchased from BD PharMingen (San Diego, CA). Avidin-PE (AV-PE)
was purchased from Caltag Laboratories (South San Francisco, CA).
Propidium iodide for dead cell exclusion was purchased from
Sigma-Aldrich (St. Louis, MO).
Generation and screening of (NOD x B6)F2 intercross mice
NOD mice have an MHC haplotype designated
H-2g7 (Kd,
I-A
d, I-A
g7,
I-E-/-, Db,
Lb). NOD mice were crossed to C57BL/6
(H-2b, I-E-/-,
Mtv-3-/-) mice.
(NOD x B6)F2 progeny were screened to
determine their MHC and Mtv-3 genotypes. Screening for
Mtv-3 was performed by Southern blot as previously described
(28) and was confirmed by flow cytometric analysis of PBL
using anti-TCR V
3 (KJ25) and a pan anti-TCR
(H57.597)
mAb. Mtv SAg-mediated deletion of T cells behaves as an autosomal
dominant phenotype. A PBL KJ25:H57.597 ratio <1%, as seen in NOD
mice, was invariably correlated with the presence of the
Mtv-3 provirus by Southern blot. The absence of
Mtv-3 was indicated by a PBL KJ25:H57.597 ratio >3%, as
seen in B6 mice. The MHC haplotypes of
(NOD x B6)F2 mice were determined by flow
cytometric analyses of PBL using mAb 10-2.16 (recognizes
I-A
g7) and AF6-88.5 (recognizes
H-2Kb). H-2g7 and
H-2b homozygotes with and without the
Mtv-3 provirus were identified for analysis.
Flow cytometry
Preparation and staining of lymph node (LN) cell suspensions
were performed as previously described (43) using the Ab
listed above. Two- and four-color FACS were performed on FACScan and
FACSCalibur, respectively (BD Biosciences, Mountain View, CA). For
small populations, 1 x 1031 x
104 V
3+ and
V
7+ T cells were counted per sample. Analysis
of FACS data was performed using LYSIS II and CellQuest software (BD
Biosciences).
Magnetic bead depletion for enrichment of V
3+ cells
in proliferation assays
Enrichment of BALB/c and NOD V
3+ T
cells was achieved by immunodepletion of LN cell suspensions using
sheep anti-FITC Ab-coated magnetic beads (BioMag separator;
Advanced Magnetics, Cambridge, MA) as directed. LN cells were stained
with FITC-conjugated Ab directed against B220 and Mac-1 to deplete B
cells and APCs, and anti-TCR V
2, -4, -5, -6, -7, -8, -9, -11,
-13, and -14 to enrich for V
3+ T cells. B6 LN
cells were depleted of non-T cells by staining with FITC-conjugated
anti-B220 and anti-Mac-1 Ab. Immunomagnetic depletion
efficiency was confirmed by flow cytometry.
Lymphocyte proliferation assays
Proliferative assays of NOD, BALB/c, and B6
V
3+ T cells was performed using 96-well
flat-bottom microtiter plates coated with KJ25 or isotype control
hamster IgG Ab at 10 µg/ml as previously described (44).
To assay equivalent numbers of V
3+ T cells,
3 x 1021 x
105 B6 B cell-depleted LN cells and 1 x
1033 x 105 BALB/c
or NOD V
3-enriched LN cells were incubated in triplicate in
Ab-coated wells. All samples were incubated with 2 x
105 mitomycin C-treated syngeneic splenocytes at
37°C and 5% CO2 in 200 µl of RPMI 1640
medium supplemented with 10% FBS, 5 x
10-3 M 2-ME, 10 mM L-glutamine, 10
mM HEPES, 10 U/ml rIL-2, and 5% penicillin/streptomycin. IL-2 was
refreshed every 48 h. Stimulation with 3 µg/ml Con A (Boehringer
Diagnostics, La Jolla, CA) was used as a proliferation control. After
72 h the cells were pulsed with 1 µCi of
[3H]thymidine (Amersham, Oakville, Canada) for
6 h, and [3H]thymidine incorporation was
measured. The mean counts per minute and SD were calculated for each
triplicate (mean ± SD). Change in counts per minute was
calculated by the difference between the mean counts per minute for the
KJ25-treated samples and the mean counts per minute for the isotype
control samples.
Cytokine assays
Assays for cytokine production by NOD and BALB/c LN cells were
performed using APC-depleted LN cells enriched for
V
3+ T cells. V
3-enriched LN cells were
incubated in 24-well tissue culture plates coated with KJ25 or 145-2C11
Ab (10 µg/ml) in 1.5 ml of supplemented RPMI 1640 as described above.
IL-2 was refreshed after 48 h. Supernatants were removed after
72 h of culture and measured for IL-4 and IFN-
in triplicate by
ELISA using the DuoSet ELISA development system (R&D Systems,
Minneapolis, MN) as directed. Recombinant mouse IL-4 and IFN-
supplied by the manufacturer were used to generate the standard curves
for each assay. ELISA data were collected and analyzed using SOFTmax
Pro software (version 2.1; Molecular Devices, Sunnyvale, CA).
RNA preparation and cDNA synthesis
LN cells were isolated from eight individual (4- to 6-wk-old) NOD mice. CD69+ and CD69- LN cells were separated by magnetic immunodepletion using FITC-conjugated H1.2F3 (anti-CD69) mAb as described above and confirmed by flow cytometric analysis. RNA was prepared from 1 x 106 NOD spleen cells and from 1 x 106 NOD CD69+ and CD69- LN cells using TRIzol as directed (Life Technologies, Burlington, Canada). RNA was reverse transcribed with Superscript II reverse transcriptase (RT; Life Technologies) as directed and resuspended in 20 µl of sterile H2O. The CD69+ and CD69- LN RNA samples from each animal were coincidentally reverse transcribed using a master RT mix to minimize differences in RT reaction efficiencies between the samples. For every RT reaction set, RNA prepared from NOD spleen cells was used in a mock (without RT) control reaction to provide a negative control in PCR.
Oligonucleotide primers and PCR amplification
In each set of PCRs, titrations of each cDNA sample were
analyzed by PCR for
-actin expression (45) and for the
expression of B cell-specific gene product of IgH locus as previously
described (46) using a degenerate VH
5'-primer, VHALL, and a Cµ 3'-primer, Cµ2A.
The primer sequences used were 5'
-actin primer,
TGGGTCAGAAGGADTCCTATG; 3'
-actin primer, CAGGCAGCTCATAGCTCTTCT; 5'
VHALL primer,
AGGT(C/G)(A/C)A(A/G)CTGCAG(C/G)AGTC(A/T)GG; and 3' Cµ2A primer,
CTCGATGGTCACCGGATCTG. PCR with both primer sets was performed as
follows: 2 min at 85°C followed by 30 cycles of 1.5 min at 94°C,
1.5 min at 55°C, 2.25 min at 72°C, then 10 min at 72°C in a PE
9700 thermal cycler. All PCR sets in which
CD69+ and CD69- samples
were compared were amplified simultaneously using common stock mixes
and identical thermal cycling programs.
Molecular probes
Plasmids containing nine VH families
(VH3609P, VHVGam3-8,
VHSM7, VHJ606,
VHX24, VH15,
VHQ52N, VHS107,
VH36-60) were provided by Dr. R. Riblet.
Plasmids containing VH81X and two members of the
VH7183 family, VH37 and
VH14, were gifts from Dr. A. Feeney. An Igµ
probe (45) was used to detect the total Ig amplification
products. Plasmid DNA was prepared as previously described
(47), and probes were purified using QIAEX II gel
extraction (Qiagen, Chatsworth, CA). Fragments were labeled to high
specific activity with [
-32P]dCTP (3000
Ci/mmol; Amersham) by random hexamer labeling as previously described
(48).
Southern blot analysis
PCR products were separated by agarose gel electrophoresis,
transferred to nylon membrane (ZetaProbe; Bio-Rad, Hercules, CA), and
immobilized with UV light (Stratagene, La Jolla, CA).
[
-32P]-Labeled DNA probes were prepared and
hybridized as previously described (27). Each membrane was
first probed with one VH family probe and exposed
to phosphorscreen. The probe was subsequently stripped from the
membrane as previously described (49), and the membrane
was then rehybridized to 32P-labeled Cµ probe,
followed by exposure to phosphorscreen (see Fig. 5
A).
|
Southern blots were digitized by a phosphorscanner (Molecular Dynamics, Sunnyvale, CA). Absolute pixel number (signal intensity) was quantified by volume integration using ImageQuant software (Molecular Dynamics). Quantitation of cDNA titration was used to create a standard curve comparing input templates to signal output. A control sample (without RT) was used to correct for background hybridization for each reaction set. Quantitation of VH and Igµ probe signals was performed, and the pixel numbers (PVH and PIgµ, respectively) were calculated for each sample. The PVH:PIgµ ratio represents the VH family-specific signal compared with the Cµ signal in the cDNA sample. The PVH:PIgµ ratios were calculated for CD69+ and CD69- B cells samples for each animal. To compare the representation of VH families between CD69+ and CD69- B cells, the CD69+ PVH:PIgµ ratio was expressed relative to the CD69- PVH:PIgµ ratio. A CD69+:CD69- ratio of 1 indicates no difference between VH signal observed for CD69+ and CD69- B cells.
Statistical analysis
Statistical analysis of one-way ANOVA was performed using SuperANOVA 1.0 (Abacus Concepts, Berkeley, CA) software. Statistical significance was determined using the Tukey-Kramer test with a significance level of p = 0.05.
| Results |
|---|
|
|
|---|
3+ T cells proliferate in response to signals
through the TCR
Previously we reported that NOD V
3+ T
cells, although rare in the periphery, are well represented among the
early islet-infiltrating cells (27). These findings
suggested that T cells that escape Mtv-3-mediated clonal
deletion may become activated and play a role in the initiation of
autoimmune disease. However, one TCR-transgenic model suggested that
SAg-reactive T cells that are not deleted by endogenous SAg become
anergic to TCR ligation in the periphery (29). To
determine the potential functionality of NOD
V
3+ T cells that escape Mtv-3
SAg-mediated deletion, lymphocyte proliferation assays were performed.
The proliferative response of NOD V
3+ T cells
was compared with V
3+ T cells from BALB/c and
C57BL/6 (B6) mice. In BALB/c mice, Mtv-6 SAg mediates
efficient deletion of V
3+ T cells (50, 51), while B6 has no V
3-specific endogenous SAg. Since
V
3+ T cells in NOD and BALB/c are rare, LN T
cells expressing V
2, -4, -9, -11, -13, and -14 were removed,
resulting in enrichment of V
3+ T cells to
1% of total T cells. In B6 mice, V
3+ T
cells constitute 3% of the T cell population. For stimulation with
anti-V
3 Ab, B6 LN cells were diluted so that the absolute number
of V
3+ T cells in these cultures was
equivalent to NOD and BALB/c V
3-enriched LN cells. The LN T cells
prepared in this manner were treated either with the polyclonal
activator Con A or with KJ25 (anti-TCR V
3 Ab) or isotype-matched
Ab. T cells from all three strains displayed equally vigorous responses
to Con A (Fig. 1
A). Consistent
with previous results (29), no significant proliferation
was detected from BALB/c V
3+ T cells. In
contrast to BALB/c, NOD V
3+ T cells
proliferated following KJ25-mediated receptor ligation (Fig. 1
A). Thus, unlike BALB/c V
3+ T
cells that escape endogenous Mtv SAg-mediated deletion, NOD
V
3+ T cells appear competent to respond to
TCR-mediated signals.
|
3+ T cells proliferate in
response to signals through the TCR, the functional significance of
this activated subset is unclear. Because NOD
V
3+ T cells are found in early islet
infiltrates, activated V
3+ T cells may secrete
cytokines in the islet environment that could bias the local
environment toward either proinflammatory Th1- or protective Th2-type
response. Previous studies have shown that early islet expression of
IFN-
, a Th1 cytokine, correlates with progression to invasive
insulitis and diabetes (45, 52), whereas IL-4 expression
during early insulitis correlates with protection from diabetes rather
than disease progression (45, 53). To determine the
cytokine(s) released by activated NOD V
3+ T
cells, cytokine assays were performed following in vitro activation.
NOD and BALB/c LN cells produced both IFN-
and IL-4 following
polyclonal T cell activation (Fig. 1
3+ T cells
produced detectable levels of IFN-
and undetectable levels of IL-4,
whereas neither IFN-
nor IL-4 could be detected following activation
of BALB/c V
3+ T cells (Fig. 1
3+ T cells may
release IFN-
following activation in vivo and may contribute to the
generation of a proinflammatory environment following their migration
into the pancreatic islets. Thus, NOD V
3+ T
cell activation and cytokine production suggest that these autoreactive
T cells may promote the development of diabetes in NOD mice.
Frequency of activated NOD V
3+ T cells in vivo
Because NOD V
3+ T cells responded to TCR
ligation in culture (Fig. 1
) and were found in the earliest detectable
islet infiltrates (27), we postulated that a proportion of
these T cells were activated in vivo in young NOD mice. Two cell
surface markers were used to examine this idea: CD69, an early
activation marker for B and T cells (reviewed in Ref. 54),
and CD25, the
-chain of the high-affinity IL-2R expressed primarily
on activated T cells (reviewed in Ref. 55). Using
multiparameter flow cytometry, we first analyzed CD69 and CD25
expression on NOD V
3+,
V
7+, and V
8+ T cell
subsets (0.3, 35, and 1520% of the 
T cell population,
respectively) in 2- to 7-wk-old NOD mice (n = 20). A
higher frequency of V
3+ LN T cells expressed
CD69+ compared with V
7+
or V
8+ T cell populations from the same
animals (p = 0.0001, by one-way ANOVA; Fig. 2
, A and B).
Similarly, a higher frequency of NOD V
3+ T
cells coexpressed CD25 compared with V
8+ T
cells (p = 0.0001, by one-way ANOVA; Fig. 2
B). Multiple LN sites (pancreatic, mesenteric, inguinal,
and axillary) were compared for V
3+ T cell
CD69 and CD25 cell surface expression. No significant difference in the
percentages of CD69+ or
CD25+ NOD V
3+ T cells
was observed between these LN sites (data not shown). Collectively,
these results suggest a higher frequency of NOD
V
3+ T cells are systemically activated in vivo
compared with other T cell subsets.
|
Next we asked whether the high frequency of in vivo activated
V
3+ T cells observed in NOD mice was evident
in diabetes-resistant strains. We compared V
3+
T cells from NOD to B6, which lacks a V
3-specific Mtv, and to BALB/c
, in which Mtv-6 SAg mediates deletion of
V
3+ thymocytes (50, 51). Compared
with BALB/c , a higher frequency of NOD V
3+ T
cells coexpressed CD69 (p = 0.0001, by one-way
ANOVA; Fig. 2
C), but no significant differences were
observed in V
8+ T cell CD69 expression between
the two strains. Similarly, a higher frequency of NOD compared with B6
V
3+ T cells expressed CD25
(p = 0.0001, by one-way ANOVA; Fig. 2
D) despite the 10-fold greater frequency of
V
3+ T cells in B6 compared with NOD mice.
These data suggest that a significantly higher percentage of NOD
V
3+ T cells that escape thymic deletion are
activated in vivo, even compared with BALB/c
V
3+ T cells that escape
Mtv-6-mediated deletion. Thus, NOD
V
3+ T cells can be activated by signals
through their TCR both in vitro and in vivo, a phenotype that was not
observed in diabetes-resistant strains.
V
3+ T cell activation segregates with the Mtv-3
provirus
The systemic activation of NOD V
3+ T
cells suggested a role for a ubiquitously expressed Ag. The
V
3-specific Mtv-3 SAg was a logical candidate given the
distribution of APC, particularly activated B cells, previously shown
to present Mtv SAg (38). To examine the requirement for
Mtv-3 in the in vivo activation of NOD
V
3+ T cells, a genetic analysis was performed
in a series of (NOD x B6)F2 mice segregating
Mtv-3. The Mtv-3 genotype of the
F2 mice was evaluated by Southern blot and FACS
analysis (see Materials and Methods). Because of the
well-established role of MHC haplotype in T cell repertoire selection,
the V
3+ T cell activation marker phenotype was
evaluated in 40 H-2g7 homozygous
F2 mice; 20 of these were Mtv-3
negative and 20 were Mtv-3 positive (see Materials and
Methods). A higher frequency of
CD69+V
3+ T cells was
observed in Mtv-3+
(NOD x B6)F2 mice compared with the
Mtv-3-negative littermates (p =
0.0001, by one-way ANOVA; Fig. 3
). In the
Mtv-3+
(NOD x B6)F2 mice, the frequency of
CD69+V
3+ T cells was
also greater than that of V
8+ T cells
(p = 0.0001, by one-way ANOVA; Fig. 3
), as
observed in NOD animals (Fig. 2
). Together, these data suggest that
both thymic and peripheral activation of V
3+
NOD T cells require the Mtv-3 provirus, implicating the
endogenous Mtv SAg in the activation of V
3+
NOD T cells.
|
These data suggested that Mtv-3 was linked to the high
frequency of activated V
3+ T cells in NOD
mice. Because multiple studies have shown that activated B cells are
more efficient presenters of Mtv SAg than macrophages and
dendritic cells (38, 56, 57), we examined the activation
status of NOD B cells by surface expression of CD69 using flow
cytometry. Interestingly, a greater percentage of NOD
B220+ cells coexpressed CD69 than was seen in
either BALB/c (Fig. 4
A) or B6
mice (p = 0.0001, by one-way ANOVA; Table I
), whereas expression of this marker on
myeloid APC was equivalent between strains (Fig. 4
A).
Similarly, a higher frequency of NOD
CD19+IgM+ cells expressed
CD69 compared with similar subsets from control mice, confirming the B
cell phenotype of these cells (data not shown). This high percentage of
activated B cells was observed in NOD mice as young as 14 days of age,
1015 days prior to the onset of peri-insulitis (data not shown).
|
|
|
The high frequency of activated NOD LN B cells could represent
either polyclonal activation by many Ags or mitogens or an oligoclonal
subset activated by Ag-specific interactions. To address this issue,
the Ig VH repertoire expressed by
CD69+ and CD69- B cells
was compared in individual NOD mice. Magnetic bead immunodepletion was
used to partition CD69+ and
CD69- NOD LN cells and resulted in >90% purity
of these subsets (data not shown). A semiquantitative RT-PCR and
Southern blot analysis approach was designed to detect transcripts
(cDNA) containing nine different Ig VH genes in
NOD CD69+ and CD69- LN
cells (see Materials and Methods). A single pair
of IgH primers capable of amplifying a broad repertoire of
VH genes in Igµ transcripts
(VHALL and Cµ2A) (46) was used for
each sample. Replicate RT-PCRs were evaluated by Southern blot
hybridization with nine VH family-specific probes
and with a Cµ to normalize for total IgH cDNA. Several of the
VH probes were selected because they are
infrequently represented in the mature B cell repertoire and were more
likely to be absent from an oligoclonal population. Serial dilutions of
cDNA demonstrated that the sensitivity of IgH cDNA detection was
approximately 10 cells (data not shown). Using this approach, no
significant or reproducible difference in VH
family gene usage was detected between CD69+ and
CD69- NOD B cells in four individual mice (Fig. 5
B). These data were most
consistent with polyclonal B cell activation in NOD mice.
Activation of NOD V
3+ T cells is B cell independent
The correlation between the high frequencies of in vivo activated
V
3+ T cells and B cells in NOD mice suggests
that B cells may be involved in Ag and/or SAg presentation to and
activation of V
3+ T cells. To determine
whether B cells were required to generate the high frequency of
activated V
3+ T cells and whether thymic
deletion of V
3+ T cells by Mtv-3
was B cell dependent, we used B cell-deficient NOD.µMT mice carrying
disruption of the Igµ gene (31). Identical frequencies
of V
3+ T cells were observed in NOD.µMT and
NOD mice, suggesting that deletion of NOD V
3+
T cells by Mtv-3 is not dependent upon mature B cells (Fig. 6
A). Interestingly, there were
also no significant differences in the percentages of
CD69+ or
CD25+V
3+ T cells between
NOD and NOD.µMT mice (Fig. 6
B). Together, these results
suggest that NOD B cells are not required for either
Mtv-3-mediated V
3+ thymocyte
deletion or peripheral activation of V
3+ T
cells.
|
A high frequency of activated B cells was observed in NOD mice
by14 days of age, suggesting that this phenotype precedes insulitis
onset. A critical question was what mechanisms regulate NOD B cell
activation. Because B cells can be activated by CD40 signals provided
by T cells following interactions between TCR/Ag-MHC (3, 8, 10, 11), we asked whether B cell activation was genetically
dependent on the NOD MHC haplotype H-2g7. To
investigate this idea, the frequencies of activated B cells in NOD,
(NOD x B6)F1,
(NODxB6)F2, NOD H-2 congenics NOD.B10
(58), NOD.SWR, and MHC class II-deficient
NOD.I-A
-/- (42) were compared
by flow cytometry. The frequency distributions of
CD69+ B cells were similar among all
H-2g7 homozygous
(NODxB6)F2 mice (Table I
and Fig. 7
) and did not segregate with
Mtv-3 (data not shown). Interestingly,
H-2b/g7 (NODxB6)F1 and
H-2g7 homozygous
(NOD x B6)F2 mice displayed frequency
distributions of CD69+ B cells similar to NOD
mice (p = 0.99 and p = 0.68,
respectively, by one-way ANOVA). In contrast,
H-2d (BALB/c), H-2b (B6),
H-2b (NOD x B6)F2,
H-2b NOD.B10, and H-2q
NOD.SWR mice all had lower frequencies of
CD69+ B cells (Table I
and Fig. 7
). The H-2
haplotype correlated with B cell activation, as CD69 expression on B
cells was significantly different in H-2g7,
H-2b, and H-2d mice
(p = 0001, by one-way ANOVA; Table I
). In
addition, a significantly lower percentage of activated B cells was
observed in NOD.I-A
-/- mice compared with
wild-type NOD mice (p = 0.01, by one-way
ANOVA). Interpretation of this result should be tempered by the
presence of a 19-cM length of 129/Sv-derived chromosome 17 in
NOD.I-A
-/- mice that includes
H-2Kb, as distinct from the NOD MHC haplotype
that is H-2Kd (data not shown). Therefore, we
cannot rule out a dampening effect of H-2Kb on
the B cell activation phenotype. Collectively, these results suggest
that the frequency of activated B cells in NOD mice is genetically
linked to the Idd1 haplotype, which exerts a dominant effect
on this phenotype. An elegant study showed that MHC class II expression
on NOD B cells strongly influences diabetes incidence
(59). Our results provide insight into a probable
mechanism of this effect, that I-Ag7 expression
is required for B cell activation by T cell costimulatory interactions,
enabling their APC function in diabetes pathogenesis.
|
| Discussion |
|---|
|
|
|---|
3+ T cells and
polyclonal B cells compared with other strains. These lymphocyte
phenotypes displayed linkage to two loci, activation of
V
3+ T cells to the endogenous SAg,
Mtv-3 and polyclonal B cell activation to Idd1,
the MHC, and particularly the class II genes. Given previous evidence
that V
3+ T cells are rare in NOD mice but are
present in the earliest islet infiltrates (27), we
examined the behavior of these T cells isolated from peripheral LNs and
spleen. We show in this study that a higher percentage of this T cell
subset is activated in vivo compared with other TCR V
subsets or to
V
3+ T cells in other mouse strains. These
observations agree with previous reports that a higher percentage of
NOD T cells display activation markers compared with other mouse
strains (25, 26). Similar features are characteristic of
the diabetes-prone biobreeding rat, where maintenance of the
autoreactive T cell compartment depends upon the activation and
proliferation of these cells linked to a diabetes susceptibility gene
(60, 61, 62). Together, these findings suggest that activation
of autoreactive T cells that escape clonal deletion contribute to
diabetes pathogenesis.
Although T cell surface expression of CD25 (IL-2R
-chain) is
up-regulated following T cell activation, CD25 may also be a marker for
a subset of T cells with regulatory function (reviewed in Ref.
63). Regulatory CD25+ T cells derive
from
CD25+CD4+CD8-
thymocytes and acquire their characteristic phenotype during thymic
maturation (64). In the peripheral lymphoid population,
the distinction between CD25+ regulatory vs
CD25+-activated CD4+ T
cells is based on functional studies.
CD25+CD4+ T cells do not
proliferate in response to TCR stimulation (64) and
protect against autoimmune disease onset upon cotransfer with
pathogenic CD25-CD4+ T
cells (64, 65). Thus, the functional significance of this
regulatory T cell population distinguishes their identity from other T
cell subsets rather than by CD25 expression alone. The significance of
this regulatory subset in T1D was described in one recent study that
reported the role of NOD splenic
CD25+CD4+ T cells in NOD
T1D development (66). Importantly, these
CD25+CD4+ T cells were
shown to oppose the effects of islet-reactive
CD25-CD4+ T cells in
coadoptive transfer experiments, thereby protecting against diabetes
onset. Although these results may imply a regulatory role for the
CD25+V
3+ LN T cells
identified in our study, the available evidence suggests that they are
unlikely to be regulatory T cells. First, the distinctive feature of
regulatory CD25+CD4+ T
cells is that they proliferate poorly in response to TCR signals
(64, 67, 68). In contrast, we found that NOD
V
3+ T cells proliferate vigorously in response
to TCR ligation in vitro. Second, one report suggests that
CD25+CD4+ regulatory cells
are capable of producing both Th1 and Th2 cytokines, such as IFN-
and IL-4 (69). However, IFN-
, but not IL-4, was
detected following activation of NOD V
3+ T
cells, whereas both cytokines were produced by polyclonal activated NOD
T cells. Thus, NOD V
3+ T cells do not conform
to the cytokine profile of regulatory T cells. Finally, these data are
consistent with previous evidence that NOD V
3+
T cells were represented among early islet-infiltrating cells
(27), indicating that V
3+ T cells
activated in vivo migrate to sites of autoimmune inflammation,
potentially mediating a proinflammatory response. It is possible that
both regulatory and effector cells are represented within the NOD
V
3+ T cell subset, as islet Ag-specific, TCR
V
-specific T cells can mediate both functions (70), and
regulatory and effector cells overlap in the expression of cell surface
markers such as CD25. However, these data taken together are more
consistent with the idea that CD25 expression on NOD
V
3+ T cells reflects their activation rather
than a regulatory phenotype. Their proliferative response and cytokine
profile suggest that NOD
CD25+V
3+ T cells may be
autoreactive T cells participating in the pathogenesis of NOD diabetes.
More significantly, our results reflect the failure to maintain
peripheral tolerance of NOD V
3+ T cells,
indicating the mechanisms by which autoimmune disease develops in the
NOD mouse.
The high frequency of activated NOD V
3+ T
cells was an unexpected finding, as V
3+ T
cells constitute <1% of NOD T cells. Given the equally high
frequencies of V
3+ T cells expressing the
activation markers CD25 and CD69 in different anatomic sites, the data
suggested systemic, rather than pancreas-proximal, activation of this T
cell subset. We observed that NOD V
3+ T cell
activation was genetically linked to the Mtv-3 locus,
consistent with the idea that TCR interaction with endogenous SAg
contributes to this activated phenotype. Although SAg interact with
nonpolymorphic residues in TCRV
, both the TCR
-chain and variable
TCR
determinants influence specificity for the SAg/MHC complexes
(reviewed in Ref. 71). As a result, some
V
3+ T cells may escape SAg-mediated thymic
deletion because their TCR
-chain and/or other TCR
determinants
limit affinity/avidity for SAg/MHC complexes (72).
Alternatively, some potentially SAg-reactive thymocytes escape because
they fail to encounter a sufficient density of SAg to mediate deletion.
Whether due to differential TCR affinity for SAg, or stochastic
inefficiencies in thymic deletion, V
3+ T
cells may respond to Mtv-3 SAg when presented at sufficient
concentration by professional APC (73). Taken together
with the previous demonstration that V
3+ T
cells contribute to early NOD insulitis, Mtv-3 SAg-mediated
activation of these T cells may promote their involvement in autoimmune
inflammation.
Although our results are consistent with a role for Mtv-3 in
the activation of NOD V
3+ T cells, these
results cannot rule out that Mtv-3 is a marker for a linked
gene. One candidate locus on chromosome 11 is the Idd4,
previously shown to affect the frequency and progression of insulitis
to overt diabetes (74, 75). Idd4 behaves as a
recessive or dominant with low penetrance gene when scoring diabetes in
crosses between NOD and C57BL/10 mice (74, 75, 76), but the
relevant gene(s) at this locus has not yet been identified. In our
study the NOD-derived chromosome 11 carrying Mtv-3 behaved
as a fully penetrant dominant locus for both deletion of
V
3+ thymocytes and activation of
V
3+ peripheral T cells. Thymocyte deletion and
peripheral T cell activation phenotypes always cosegregated in the
(NOD x B6)F2 progeny. This genetic behavior is
identical with that of other Mtv-encoded SAg specific for
other TCRV
determinants. While it remains possible that
Idd4 or another linked locus affected the
deletion/activation of V
3+ T cells, the data
are most consistent with the interpretation that Mtv-3
controls these phenotypes in NOD mice.
The idea that viral Ag may be involved in the etiology of T1D has received considerable attention. Common human pathogenic viruses, including coxsackie (77) and congenital rubella (78), have been associated with the onset of human diabetes. It is possible that exposure to specific viral Ag and/or SAg may provoke activation of T cells cross-reactive with self-Ag, leading to the initiation of autoimmune disease in genetically susceptible individuals. Indeed, molecular mimicry between peptides from coxsackie virus and glutamic acid decarboxylase, a neuronal enzyme and an islet Ag (79, 80, 81), has been argued to support a hypothesis that T cell cross-reactivity to viral and self Ag presented on I-Ag7 may promote islet cell destruction in T1D (82, 83). Indeed it has been suggested that viral SAg influence diabetes in NOD mice (84) and in humans (85, 86), although the issue has generated controversy (87) and remains unresolved.
We have shown that a striking frequency of NOD B cells are activated in vivo, a feature observed by 2 wk of age and persisting until T1D onset (data not shown). This finding suggests that NOD B cells may be programmed to activate and proliferate in young NOD mice before the onset of insulitis. Therefore, enhanced lymphocyte activation in NOD mice is not restricted to T cells. We found that activated NOD B cells expressed high levels of MHC class II, costimulatory, and adhesion molecules, predicting that they are competent APC for naive T cells. Analyses of (NOD x B6)F2 and NOD congenic mice demonstrated the requirement for H-2g7 to generate the high frequency of activated NOD B cells. Together these data strongly suggest that activated B cells expressing NOD MHC class II molecules may serve as APC in the activation of autoreactive T cells. Indeed, recent reports suggest that NOD B cells are important for the development of T1D (31, 32, 33, 34), serve an important APC function (35, 36, 37), and must express I-Ag7 to contribute to diabetes development (59). The unique NOD class II molecule I-Ag7 has been implicated in the presentation of self-peptides due to promiscuous or altered peptide binding (59, 88, 89). Transgenic expression of MHC class II I-E or alternative alleles of I-A confers strong protection against T1D in NOD mice (reviewed in Ref. 90), suggesting a role for the NOD MHC class II haplotype in the selection and activation of autoreactive T cells (91, 92, 93). Furthermore, the NOD MHC contributes to isotype switch in the production of anti-insulin autoantibodies (94). Therefore, the NOD MHC class II haplotype is pivotal in multiple aspects of T cell and B cell function during progression to T1D.
Previous reports indicate that the NOD splenic B cell VH repertoire displays a bias toward D-proximal VH genes compared with B cells from nondiabetes-prone strains (95). We examined the VH repertoire of the CD69+ NOD B cells in individual mice to determine whether they represented expansion of an oligoclonal B cell subset. The repertoire of CD69+ NOD B cells did not differ significantly from that of CD69- B cells in the same animal, suggesting that NOD B cell activation in vivo is stochastic and not Ag restricted. This feature distinguishes NOD CD69+ B cells from the CD5+ B-1 B cell subset, which are of fetal and peritoneal origin and are characterized by a limited VH repertoire (reviewed in Ref. 96). However, like the CD5+ B-1 subset in the NZB and motheaten models of systemic lupus erythematosus (97), the NOD-activated B cell phenotype showed genetic linkage to a disease susceptibility locus, Idd1 (16). Hence, genetic regulation of B cell activation may contribute directly to the development of diabetes and other forms of autoimmune disease.
The activated V
3+ T cell subset, the genetic
linkage of this phenotype to Mtv-3, and the high frequency
of CD69+ NOD B cells could be mechanistically
related if activated B cells present Mtv-3 SAg to the
V
3+ T cells. However, we found that a similar
frequency of
CD25+CD69+V
3+
T cells was observed in NOD.µMT mice that lack mature B cells. Our
data indicate that neither the deletion nor the activation of
V
3+ T cells requires B cells, as these
phenotypes did not differ between NOD and B cell-deficient NOD.µMT
mice. In contrast to evidence that B cells are required for the
negative selection of other subsets of Mtv-reactive T cells (98, 99), presentation by myeloid APC appears adequate to mediate
both clonal deletion and activation of NOD V
3+
T cells. Thus, there may be distinct requirements for B cells in
activation of different islet-reactive T cells specificities in NOD
mice (35, 36, 59).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jayne S. Danska, Program in Developmental Biology, Hospital for Sick Children Research Institute, University of Toronto, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada. E-mail address: danska{at}sickkids.on.ca ![]()
3 Abbreviations used in this paper: T1D, type 1 diabetes mellitus; AV-PE, avidin-PE; LN, lymph node; Mtv, murine mammary tumor virus; NOD, nonobese diabetic; SAg, superantigen; RT, reverse transcriptase. ![]()
Received for publication July 24, 2001. Accepted for publication October 5, 2001.
| References |
|---|
|
|
|---|
-chain diversity. J. Immunol. 154:2969.[Abstract]
-V3+ T cells with Mtv-3. Immunogenetics 34:227.[Medline]

TCR. J. Immunol. 142:3773.[Abstract]
gene expression in pancreatic islet-infiltrating mononuclear cells correlates with autoimmune diabetes in nonobese diabetic mice. J. Immunol. 154:4874.[Abstract]
cells of nonobese diabetic mice. J. Immunol. 163:743.
genes. J. Immunol. 166:2982.
6+ T cells in Mls-1a mice: a role for the third complementarity-determining region (CDR3) of the T cell receptor in superantigen recognition. J. Immunol. 155:4171.[Abstract]
This article has been cited by other articles:
![]() |
A. M. Marleau, K. L. Summers, and B. Singh Differential Contributions of APC Subsets to T Cell Activation in Nonobese Diabetic Mice J. Immunol., April 15, 2008; 180(8): 5235 - 5249. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hussain and T. L. Delovitch Intravenous Transfusion of BCR-Activated B Cells Protects NOD Mice from Type 1 Diabetes in an IL-10-Dependent Manner J. Immunol., December 1, 2007; 179(11): 7225 - 7232. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rolf, V. Motta, N. Duarte, M. Lundholm, E. Berntman, M.-L. Bergman, L. Sorokin, S. L. Cardell, and D. Holmberg The Enlarged Population of Marginal Zone/CD1dhigh B Lymphocytes in Nonobese Diabetic Mice Maps to Diabetes Susceptibility Region Idd11 J. Immunol., April 15, 2005; 174(8): 4821 - 4827. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hussain and T. L. Delovitch Dysregulated B7-1 and B7-2 Expression on Nonobese Diabetic Mouse B Cells Is Associated with Increased T Cell Costimulation and the Development of Insulitis J. Immunol., January 15, 2005; 174(2): 680 - 687. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hussain, K. V. Salojin, and T. L. Delovitch Hyperresponsiveness, Resistance to B-Cell Receptor--Dependent Activation-Induced Cell Death, and Accumulation of Hyperactivated B-Cells in Islets Is Associated With the Onset of Insulitis but not Type 1 Diabetes Diabetes, August 1, 2004; 53(8): 2003 - 2011. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |