The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, X.
Right arrow Articles by Arnett, F. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, X.
Right arrow Articles by Arnett, F. C.
The Journal of Immunology, 2001, 167: 7126-7133.
Copyright © 2001 by The American Association of Immunologists

Systemic Sclerosis (Scleroderma): Specific Autoantigen Genes Are Selectively Overexpressed in Scleroderma Fibroblasts1

Xiaodong Zhou2,*, Filemon K. Tan*, Momiao Xiong{ddagger}, Dianna M. Milewicz{dagger}, Carol A. Feghali§, Marvin J. Fritzler, John D. Reveille* and Frank C. Arnett*

* Division of Rheumatology and Clinical Immunogenetics and {dagger} Division of Medical Genetics, Department of Internal Medicine, University of Texas Medical School, Houston, TX 77030; {ddagger} Human Genetics Center, University of Texas School of Public Health, Houston, TX 77030; § Division of Rheumatology and Clinical Immunology, Department of Medicine, University of Pittsburgh, Pittsburgh, PA 15261; and Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The pathogenesis of systemic sclerosis (SSc) involves complex interactions between activated fibroblasts eventually leading to fibrosis, and impaired immune tolerance characterized by a variety of circulating SSc-specific autoantibodies. The expression of autoantigens in fibroblasts, a key target tissue in SSc, may play an important role in this process. To obtain a global view of this process, we examined gene expression profiles of SSc dermal fibroblasts using cDNA microarrays. The results show that dermal fibroblasts from SSc patients obtained from either affected or unaffected skin displayed a characteristic pattern of increased SSc autoantigen gene expression compared with that from normal controls. In particular, fibrillarin (p = 0.028), centromeric protein B (p = 0.01), centromeric autoantigen P27 (p = 0.042), and RNA polymerase II (220 kDa; p = 0.02) were significantly overexpressed in SSc fibroblasts. Quantitative RT-PCR confirmed overexpression of these autoantigens and also revealed increased levels of DNA topoisomerase I transcripts in SSc fibroblasts compared with normal control fibroblasts (p = 0.0318). The polymyositis/scleroderma autoantigen gene was overexpressed in some SSc patients (p = 0.09). To examine the specificity of these overexpressed autoantigen genes for SSc and its tissue specificity for fibroblasts, cDNA microarrays of dermal fibroblasts from patients with eosinophilic fasciitis and scleromyxedema were studied as well as PBMC and muscle biopsies from SSc patients. None of these tissues showed significant alterations in gene expression of SSc-specific autoantigens. Therefore, SSc-associated autoantigen genes are selectively overexpressed in SSc dermal fibroblasts, a major tissue involved in disease pathogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Systemic sclerosis (SSc)3 is a multisystem disorder of connective tissue characterized by extensive cutaneous and visceral fibrosis and small vessel vasculopathy. While the etiopathogenesis of SSc is unknown, pathological findings indicate that fibroblasts are activated to produce excessive amounts of collagen and other extracellular matrix components. Moreover, endothelial cell damage causing capillary loss and neo-intimal proliferation in small vessels plays a prominent role in tissue damage (1). Autoimmune mechanisms also are believed to be operative, because patients with SSc spontaneously elaborate a variety of highly disease-specific circulating autoantibodies to nuclear and nucleolar Ags (2). The most common of these autoantibodies are directed against DNA topoisomerase I; centromeric proteins, especially centromeric protein B (CENP-B); and RNA polymerases I, II, and/or III. Less frequent autoantibody specificities include anti-U3-ribonucleoprotein (RNP) (fibrillarin), polymyositis/scleroderma autoantigen (PM-Scl), Th/To, and U1-RNP (3). Each SSc patient typically produces only one of these autoantibodies, which, in turn, correlates with certain disease manifestations and prognosis. It is unknown, however, whether autoantibodies directly participate in any of the pathological manifestations. SSc-specific Abs also are associated with specific class II alleles of the MHC. Considerable evidence suggests that such autoantibodies result from autoantigen-driven Th cell-mediated immune responses (4).

The present studies using a 4000-element cDNA microarray to profile gene expression in cultured dermal fibroblasts from SSc patients demonstrated that several autoantigen genes specifically targeted in SSc were overexpressed compared with dermal fibroblasts from normal controls. Therefore, we surveyed the expression of 72 known autoantigen genes from a variety of human autoimmune diseases that were represented on the array. Indeed, in SSc fibroblasts, several SSc-specific autoantigen genes appeared to be selectively overexpressed compared with those targeted in other autoimmune diseases. Transcript overexpression of these genes was confirmed using RT-PCR. Muscle tissue and PBMC from SSc patients did not show gene expression changes for the SSc-specific autoantigens compared with their normal counterparts, nor did dermal fibroblasts from patients with other fibrosing diseases. These findings may provide clues to the origins of autoimmune responses and pathogenetic mechanisms in SSc.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Study subjects

For the microarray and quantitative-RT-PCR, 3-mm punch skin biopsies of clinically affected and/or unaffected skin were obtained from 11 SSc patients with disease duration of <5 yr. Two patients were Choctaw Native Americans, three were African Americans, one was Mexican-American, and five were Caucasians. Three patients had limited SSc, and the remainder had diffuse skin disease as defined by Leroy et al. (5). All SSc patients fulfilled the American College of Rheumatology Criteria for the classification of scleroderma (6). As controls with other fibrosing diseases, two patients each with scleromyxedema and eosinophilic fasciitis also were biopsied. These biopsies were obtained when the patients had active disease from lesional skin. Normal control skin samples were obtained from seven age- (±5 yr) and sex-matched patients with no history of autoimmune diseases who were undergoing routine dermatological surgery.

Anti-coagulated blood was obtained from three SSc patients (these three patients also had fibroblasts explanted from skin biopsies) and from three age- and sex-matched normal controls. PBMC were isolated from the anti-coagulated blood by Ficoll-Hypaque gradient centrifugation and were washed three times through centrifugation.

Stored frozen skeletal muscle biopsies were obtained from three different SSc patients who had under gone diagnostic biopsy and from three age- and sex-matched controls. These SSc patients had symptoms of muscle weakness and/or pain. Two of the biopsies were normal histologically, while the third showed changes compatible with a noninflammatory myopathy. Three matched controls with stored frozen muscle biopsies who had muscle complaints but histopathologically normal muscle biopsies and other normal diagnostic studies (creatine kinase levels and electromyography) were similarly studied. Study subjects provided written informed consent, and the protocol was approved by the University of Texas committee for the protection of human subjects.

Tissue culture

A 3-mm skin biopsy was stored in DMEM with 10% FCS supplemented with an antibiotic and antimycotic. The tissue sample was subsequently washed in 70% ethanol, PBS, and 10% FCS/DMEM. Cultured fibroblast cell strains were established by mincing and placing tissues into 60-mm culture dishes secured by glass coverslips. The primary cultures were maintained in DMEM with 10% FCS and supplemented with antibiotic and antimycotic. Low passage fibroblasts cell strains were plated at a density of 2.5 x 105 cells in a 35-mm dish and incubated for RNA isolations.

Microarrays

Total RNA was isolated from cultured fibroblast cell strains, muscle biopsies, and PBMC using TRIzol reagent (Life Technologies, Gaithersburg, MD) and treated with DNase I (Ambion, Austin, TX). Double-strand cDNA probe with [33P]dCTP was generated from 1 µg total RNA using the Superscript cDNA system (Life Technologies). Labeled probe was purified by a chromatograph column (5 Prime->3 Prime, Boulder, CO), and then suspended in 100 µl hybridization buffer. The sp. act. of the probe was determined in a scintillation counter. A total of 3 x 106 cpm probe was denatured at 95°C for 8 min before hybridization.

Microarray filters spotted with 4000 human cDNAs (GF-211, Research Genetics, Huntsville, AL) were prehybridized in 5 ml hybridization buffer with 5 µl poly(A) (1 mg/ml) and 5 µl denatured Cot-1 DNA at 42°C with gentle rotation for 3 h. The denatured probe was loaded into the same buffer, then the rotating hybridization was continued at 42°C for 16 h. The hybridized filter was washed twice in 2x SSC/1% SDS at 50°C for 20 min, followed by 15 min at room temperature. The hybridization signal was detected by the Cyclone Phosphor System (Packard Bioscience, Downers Grove, IL). Duplicate RNA samples were tested in all but four samples. Array images were analyzed with Pathways software (Research Genetics). Genes that gave a signal at or below background levels were discarded.

Array analysis

To account for gene expression changes due to experimental variation, gene expression data were normalized as follows. One control sample array was randomly selected as the reference. The reciprocal of the coefficient of the regression of the gene expression of subsequent arrays over the reference array was taken as a normalizing factor. For each array, the normalization factor was derived in this manner, and the expression of each gene in the array was multiplied by this factor to result in normalized gene expressions. The normalized data were transformed into logarithms and clustered using a hierarchical clustering algorithm (7). Student’s paired t tests were used to measure differences in the degree of gene expression in the normal vs disease tissues. The t statistic provides an estimate of the difference (and the precision of the difference) in mean expression ratios (or fold differences) of the two groups. Categorical differences were tested using Fisher’s exact tests. The level of statistical significance was set at p < 0.05.

Quantitative RT-PCR

Quantitative real-time RT-PCR was performed using an ABI 7700 Sequence Detector (Applied Biosystems, Foster City, CA) (8) for the transcripts of DNA topoisomerase I, fibrillarin, CENP-B, and centromere autoantigen p27 (CENP-p27). Specific quantitative assays were developed using Primer Express software (PE Biosystems) following the recommended guidelines based on sequences from GenBank. The primers and probes for each gene are listed in Table IGo. Total RNA was extracted from study tissues as described previously, and they were the same RNA samples as those used in the microarray assays. cDNA was synthesized in a 10-µl total volume by the addition of 6 µl/well RT master mix, consisting of 400 nM assay-specific reverse primer, 500 µM deoxynucleotides, Superscript II buffer, DTT, and 10 U Superscript II reverse transcriptase (Life Technologies), to a 7700 96-well plate, followed by a 4-µl volume of sample (25 ng/µl). Each sample was measured in triplicate plus a control without reverse transcriptase. Each plate also contained an assay-specific sDNA (synthetic amplicon oligo) standard spanning a 5-log range and a no template control. Samples were incubated in a thermocycler (MJ Research, Waltham, MA) for 30 min at 50°C, followed by 72°C for 10 min. Subsequently, 40 µl PCR master mix (400 nM forward and reverse primers, 100 nM fluorogenic probe, 3 mM MgCl2, 200 µM deoxynucleotides, PCR buffer, and 1.25 U Taq polymerase (Life Technologies)) were added directly to each well of the cDNA plate. Each assembled plate was then capped and run in the 7700 using the following cycling conditions: 95°C for 1 min, and 40 cycles of 95°C for 12 s and 60°C for 1 min. The resulting data were analyzed using SDS software (Applied Biosystems, Foster City, CA) with TAMRA as the reference dye.


View this table:
[in this window]
[in a new window]
 
Table I. Primers used in quantitative RT-PCR and quality control data for each assay1

 
Synthetic DNA oligos used as standards (sDNA) encompassed exactly the entire 5'–3' amplicon for the assay (BioSource, Camarillo, CA). The sDNA standards were quantified by absorbance at 260 nm. Standard curves were run from 2 to 200 pg sDNA on each plate. The number of molecules per sDNA mass was then calculated from the length of the sDNA for each assay. Each set of standards yielded a linear curve (r2 > 0.992), and efficiencies calculated from the slope of each standard curve were >95%.

Due to the inherent inaccuracies in quantitating total RNA by absorbance, the amount of RNA added to an RT-PCR from each sample was more accurately determined by measuring the {beta}-actin transcript levels in each sample. The final data were normalized to {beta}-actin and are presented as the molecules of transcript/molecules of {beta}-actin x 100 (percentage of {beta}-actin).

A semiquantitative RT-PCR method was used for confirmation of microarray data for the RNA polymerase II and PM-Scl transcripts. The primers and probe for RNA polymerase II are: forward primer (2534+), CATCGAGAAGGCACACAACA; reverse primer (2615-), GCGGTTCACCTGATTCTCAA; and probe (2573-), CGTCTGCCGCAGAGTGTTCCCT. The primers and probe for PM-Scl are: forward primer (1852+), TCTCTTTGGACCTCACGACTG; reverse primer (1916-), CACTGGTTGGGATGATTGGA; and probe (1874+), TCCCATGCCCCTCCGGATG. RNA samples were run as described above without a standard (sDNA). Molecules of transcript for each sample were determined mathematically in Microsoft Excel from the slope and y-intercept of a transcript-specific standard curve (sDNA) run on a separate plate. Although this method is not preferred for absolute quantitation, it will give correct relative values for comparison of the samples to one another.

Autoantibody testing

All patient sera were tested for antinuclear Abs by indirect immunofluorescence using HEp-2 cells as Ag substrate (Antibodies, Davis, CA). Anti-centromere was determined visually by their distinctive indirect immunofluorescence patterns on HEp-2 cells. Anti-topoisomerase I (Scl-70) Abs were detected by passive immunodiffusion against calf thymus extracts using commercial kits (INOVA, Diagnostics, Inc., San Diego, CA). Anti-fibrillarin (9) and anti-RNA polymerases I, II, and III (10) were detected by immunoprecipitation as described previously. Anti-PM-Scl Abs were detected by immunoprecipitation and confirmed by Ouchterlony double immunodiffusion (11).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Microarrays

Thirty-two genes of approximately 4000 genes on the array showed altered expression levels that were statistically significantly different (p <= 0.05) from those of controls and showed an adequate signal above background. These included seven autoantigen genes and 25 nonautoantigen genes (Tables IIGo and IIIGo). The cluster analysis of all SSc and control fibroblast strains based on the expressions of these genes resulted in a clear distinction between patients and controls (Fig. 1Go).


View this table:
[in this window]
[in a new window]
 
Table II. Comparisons of average gene expression ratios of 72 autoantigens in 11 SSc vs 7 normal control skin cultured fibroblasts1

 

View this table:
[in this window]
[in a new window]
 
Table III. Twenty-five nonautoantigen genes show altered expression levels between 11 SSc and 7 normal control fibroblasts1

 


View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 1. Cluster analysis of gene expression levels of 32 genes that showed statistically significant alterations and adequate signals above background between SSc patients and controls. Gene names and accession numbers are listed on the right of the cluster. Colors from green to red assignment represent gene expression levels from lower to higher, respectively, based on individual data. The genes expressed in similar patterns are clustered on the left of the diagram. Based on the individual gene expression profile, SSc patients and controls are clustered on the top of the diagram. hnRNP, Heterogeneous RNP.

 
There were 72 cDNAs on the microarray that have been reported as autoantigen genes in various autoimmune diseases. Sixteen of these autoantigens were SSc specific or occurred frequently in SSc patients (Table IIGo). The remaining 56 autoantigens occurred specifically in other connective tissue diseases, such as systemic lupus erythematosus, Sjögren’s syndrome, poly- or dermatomyositis, and certain organ-specific autoimmune disorders, or as nonspecific autoantigens in a variety of disease states.

Among the 16 SSc-specific or -associated autoantigen genes, five demonstrated an average increased expression of 1.44-fold or higher in the SSc patients than in the controls. The average expression levels of four of these five autoantigen genes were statistically significantly different between patients and controls using t statistics, including CENP-B, CENP-p27, U3-RNP (fibrillarin), and the 220-kDa subunit of RNA polymerase II. The PM-Scl (100 kDa) autoantigen gene also showed an average 1.44-fold increased expression, but in fewer patients (p = 0.091). Only 3 of the 56 non-SSc-specific autoantigen genes showed statistically significantly increased expression levels. Two of these, laminin S (ratio, 1.58; p = 0.008) and vimentin (ratio, 1.52; p = 0.008), have been reported as nonspecific autoantigens in SSc previously (12, 13). The third, nucleolar autoantigen No55 (ratio, 1.67; p = 0.053) has not been studied in SSc to our knowledge. A statistical comparison of the number of overexpressed SSc autoantigen genes in SSc fibroblasts (4 of 16 SSc autoantigens, excluding PM-Scl (100 kDa), vs 3 of 56 non-SSc autoantigens) resulted in a p value of 0.039 and an odds ratio of 5.9, while inclusion of PM-Scl yielded a p value of 0.01 and an odds ratio of 8.0. If vimentin and laminin S were considered as SSc-related autoantigens, then the likelihood that these observations were occurring by chance alone is 7 of 16 vs 1 of 56 (p = 0.00005; odds ratio, 42.8).

The altered expression of autoantigen genes in SSc skin fibroblast strains did not show significant differences in expression when fibroblasts from clinically affected and unaffected skin were studied in the same patients (data not show). Increased expression levels (ratios = 1.4 or higher) of two or more of the five autoantigen genes was found in 10 of the 11 SSc patients (Table IVGo). However, the pattern of SSc autoantigen gene expression did not correlate with the type of SSc-specific autoantibody expressed by each patient (Table IVGo).


View this table:
[in this window]
[in a new window]
 
Table IV. Autoantibody and autoantigen gene profiles for 11 SSc patients1

 
The cluster analysis of all SSc and control fibroblast strains based on the expressions of the 72 autoantigen genes resulted in classification of the fibroblast strains into two major groups (Fig. 2Go). The first group included 8 of the 11 SSc fibroblast strains whose gene expression patterns were marked by overexpression of SSc autoantigen genes. The other three SSc fibroblast strains and all seven control fibroblast strains were classified into a second major group, but two of the three SSc fibroblast strains were classified under different subgroups (Fig. 2Go).



View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 2. Cluster analysis of gene expression levels of 72 autoantigens in 11 SSc vs 7 control skin fibroblasts. Gene names and accession numbers are listed on the right of the cluster. Colors from green to red assignment represent gene expression levels from lower to higher, respectively, based on individual data. The genes expressed in the similar patterns are clustered on the left of the diagram. Based on the individual gene expression profile, patients and controls are clustered on the top of the diagram. snRNP, Small nuclear RNP

 
To assess the specificity of SSc autoantigen overexpression, we examined muscle biopsies and PBMC from three SSc patients and three controls using the same assays. We found no such altered expression of these genes in either tissue of any of these patients (Fig. 3Go). Of potential interest, however, the 70-kDa U1-RNP gene showed 2-fold increased expression levels in all three of the muscle biopsies from SSc patients.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 3. Transcript levels of autoantigens in three different tissues of SSc patients compared with normal controls. Error bars indicate SD. RNAPII, RNA polymerase II.

 
To further determine the disease specificity of autoantigen gene overexpression for SSc, we examined gene profiles of cultured dermal fibroblasts from skin biopsies of two eosinophilic fasciitis and two scleromyxedema patients. None of them showed increased gene expressions of SSc autoantigens, but the No55 gene showed increased expression in one of each of these cases (Fig. 4Go).



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 4. Transcript levels of autoantigens in skin fibroblasts from three fibrotic diseases compared with seven normal controls. Scl-Myx, Scleromyxedema; EF, eosinophilic fasciitis; RNAPII, RNA polymerase II.

 
Finally, an additional 25 genes also displayed statistically significantly (p < 0.05) altered expression levels in SSc fibroblasts compared with control fibroblasts (Table IIIGo). Although some ratios between SSc patients and controls are less than 2-fold, these genes demonstrated consistent patterns and adequate signal above background levels. The functions of these genes included extracellular matrix composition and regulation, apoptosis, gene transcription, inflammation, metabolic regulation, and others. The expression of some collagen genes, e.g., collagen type I {alpha}-2 and collagen type III {alpha}-1 genes, were increased in some SSc patients. Over 2-fold increased gene expression of HLA-C and HLA-DRA1 also was observed in four SSc patients.

Quantitative RT-PCR

Quantitative RT-PCR was used to confirm the gene expression levels for SSc-specific autoantigens in skin fibroblast strains. Because topoisomerase I is a major autoantigen in SSc (but was not detected in our microarray assays as its signal was not much higher than background), it also was specifically assayed using RT-PCR. The overall gene expression levels for CENP-B, CENP-p27, fibrillarin, RNA polymerase II, and PM-Scl (100 kDa) in this assay were reasonably concordant with those seen on the cDNA microarrays, although several genes showed 2- to 3-fold higher levels by RT-PCR. The topoisomerase I gene displayed an average 4.5-fold increase in expression level using RT-PCR (Table IVGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
While using cDNA microarrays containing 4000 known human genes to investigate transcript expression in cultured dermal fibroblasts of patients with SSc, we noted that several genes known to be autoantigens in SSc were overexpressed compared with normal fibroblasts. The average increased folds of expressions of four autoantigen genes (CENP-B, CENP-p27, fibrillarin, and the 220-kDa subunit of RNA polymerase II) were >=1.44 in the SSc fibroblasts compared with normal fibroblasts. In some cases, these ratios were >2-fold. Although it is difficult to predict which ratio of these increases may be biologically important, comparisons between all SSc patients and controls showed that these alterations in gene expressions were statistically significant. Whether these changes ultimately prove to be clinically or pathogenetically relevant remains to be seen. Another comparison examining the number of SSc-related autoantigens showing altered expression (4 of 16) in SSc fibroblasts as opposed to non-SSc-related autoantigens (3 of 56) indicated that the likelihood that these observations were due to chance alone was small (p = 0.039). In addition, another SSc autoantigen gene, PM-Scl (100 kDa), also appeared to show increased expression levels averaging 1.44-fold in six of the 11 SSc patients, although the overall comparison of expression levels between patients and controls was not statistically significant (p = 0.09).

The majority of SSc patients demonstrated increased expression of two or more autoantigen genes, but there was no correlation between the patterns of autoantigen gene expression and autoantibody profiles of individual patients. RT-PCR confirmed increased transcripts of these autoantigens in the majority of SSc patients’ fibroblasts and, in addition, showed increased levels of DNA topoisomerase I transcripts in SSc fibroblasts (>=1.5-fold in 10 of 11, 4.5-fold on the average). The reason for our inability to detect changes in topoisomerase I on the arrays may be due to the fact that the sensitivity of array-based assays is lower than that of quantitative RT-PCR.

Moreover, autoantigen transcripts were not altered in the fibroblasts of four patients with other fibrosing diseases (two each with scleromyxedema and eosinophilic fasciitis). Finally, microarray analyses of muscle tissue and PBMC from SSc patients also failed to detect any alterations in autoantigen gene expression as seen in the fibroblasts, thus suggesting that this phenomenon was selective for SSc dermal fibroblasts (of those tissues studied).

All the autoantigens detected here are targeted in SSc. Anti-centromere Abs are highly specific for scleroderma, most typically the limited form of the disease or the calcinosis, Raynaud phenomenon, esophageal dysmotility, sclerodactyly, and telangiectasia syndrome. Although centromeric autoantigens include CENP-A, CENP-B, CENP-C, and others, CENP-B is considered the major one, since Abs in high titer to CENP-B are consistently found in anti-centromere-positive sera (14). More recently using autoimmune sera from a patient with anti-centromere Abs, Muro et al. (15) identified a novel 27-kDa protein (p27) to which approximately 2% of anti-centromere Abs reacted. All cases with anti-p27 had SSc and/or Sjögren’s syndrome.

Fibrillarin is a component of a small nucleolar RNP particle thought to participate in the first step in processing preribosomal RNA. In humans, fibrillarin is associated with U3, U8, and U13 small nuclear RNAs. Anti-fibrillarin Abs are highly specific for SSc, typically occurring in a small subset with diffuse skin thickening and telangiectasia, and visceral involvement in men and African Americans (9).

DNA topoisomerase I catalyzes the breaking and joining of DNA strands. Autoantibodies to topoisomerase I are specific for SSc patients and are associated with diffuse skin involvement and pulmonary fibrosis (16, 17).

DNA-dependent RNA polymerase II, a complex multisubunit enzyme, is responsible for the transcription of protein-coding genes. Autoantibodies to RNA polymerases I, II, and III occur frequently in SSc, often in various combinations; however, anti-RNA polymerase III Abs are most common and can be used to predict a high likelihood of diffuse skin disease and severe visceral involvement in SSc (18). Anti-RNA polymerase II Abs have been reported most often in systemic lupus erythematosus; however, Abs to phosphorylated RNA polymerase II occur frequently in Japanese SSc patients who also have anti-topoisomerase I Abs (19) as well as in Choctaw Native Americans, who have a high prevalence of SSc and anti-topoisomerase I Abs (20) (F. C. Arnett, unpublished observations).

Finally, PM-Scl is another nucleolar particle. It consists of several polypeptides, of which two proteins of 75 and 100 kDa have been identified as the major antigenic components. Anti-PM-Scl Abs occur almost exclusively in a small percentage of Caucasians with SSc, myositis, or both (21).

Thus, the SSc autoantigens represent a variety of different proteins with differing cellular locations and functions. The reason that they should be targeted by an autoimmune response primarily in scleroderma and singly in individual patients is unclear, although several hypotheses recently have been proposed. Tan (22) has pointed out that the majority of SSc-specific autoantigens localize to the nucleolus during some phase of their cell cycles. Building upon this observation, Rosen and colleagues (23) have noted that heavy metals also are concentrated in the nucleolus and may catalyze oxidative reactions or in other ways fragment these proteins and reveal cryptic epitopes vulnerable to initiating an autoimmune response. It is likely that CD4-positive T lymphocytes are involved, because each of these autoantibody responses is associated with specific and largely different MHC class II alleles (2, 24, 25).

The findings in the present study that several of these SSc-related autoantigens are specifically and selectively overexpressed in SSc fibroblasts are provocative and raise the possibility that activated fibroblasts may represent the cellular source of the autoantigens driving the immune responses leading to the characteristic SSc-specific autoantibodies. Although the clear relationships between expression levels of specific autoantigen genes and corresponding autoantibodies in patients’ sera were not seen, it is possible that multiple Ags can be associated with a particular autoimmune disease. For example, a primary autoantigen may be responsible for the initiation of the autoimmune process and others become involved later in the course of the disease, i.e., epitope spreading (26). It is also important to know that autoantibody responses to specific autoantigen are associated with certain HLA class II alleles (9), and many of the epitopes are influenced by modification in various ways, such as metal-catalyzed oxidation (23, 27). This hypothesis would also suppose that these autoantigens would of necessity need to be externalized via cellular destruction or apoptosis or expressed on the cell surface, where they could be presented to the immune system. Alternatively, the activated fibroblast itself might serve as an APC. In the microarrays of SSc fibroblasts studied here, significantly increased expression of both class I and class II MHC genes was observed in some patients; however, it is unknown whether actual MHC molecules appear on the fibroblast cell surface in SSc and function normally.

The present results represent a first attempt at using multiple gene expression assays to understand molecular pathogenesis in SSc fibroblasts. It provides important preliminary evidence that the primary target tissue in SSc may play potential roles in initiation or perpetuation of autoimmunity by the potential overexpression of SSc-related autoantigen genes. Further studies of protein levels of these autoantigens will be necessary in the future. In addition, the possibility that the SSc-specific autoantibodies might target autoantigens expressed on the fibroblast cell surface or released into the extracellular matrix should be explored. The endogenous and/or exogenous stimuli leading to fibroblast activation and fibrosis are currently unknown. Moreover, similar studies of endothelial cells in SSc, another major cell type involved in pathogenesis, are needed and are in progress.

As a hypothesis, the overexpression of disease-specific autoantigens in the target tissues of other autoimmune diseases also should be explored. In recent microarray studies of affected muscle biopsies in poly- and dermatomyositis patients, several were found to overexpress certain aminoacyl tRNA synthetase genes (28). Autoantibodies to tRNA synthetases are characteristic of these autoimmune muscle diseases (29). The application of genomic technology to complex and poorly understood diseases, such as SSc, by virtue of a more comprehensive view of gene expression and molecular pathways may help unite seemingly disparate observations.


    Footnotes
 
1 This work was supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Specialized Center of Research in Scleroderma Grant IP50AR4488, National Institutes of Health National Center for Research Resources Grant 3M01RR02558-12S1 (to F.K.T.), and a grant from the RGK Foundation (Austin, TX). Back

2 Address correspondence and reprint requests to Dr. Xiaodong Zhou, Division of Rheumatology and Clinical Immunogenetics, University of Texas Medical School, 6431 Fannin, MSB5.270, Houston, TX 77030. E-mail address: xiaodong.zhou{at}uth.tmc.edu Back

3 Abbreviations used in this paper: SSc, systemic sclerosis; CENP-B, centromeric protein B; sDNA, synthetic DNA; RNP, ribonucleoprotein; PM-Scl, polymyositis/scleroderma autoantigen. Back

Received for publication July 27, 2001. Accepted for publication October 18, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jr Medsger, T. A.. 2000. Systemic sclerosis (scleroderma): clinical aspects. W. J. Koopman, ed. Arthritis and Allied Conditions 14th Ed.1590. Lippincott Williams & Wilkins, Philadelphia.
  2. Arnett, F. C.. 1995. HLA and autoimmunity in scleroderma (systemic sclerosis). Int. Rev. Immunol. 12:107.[Medline]
  3. Bunn, C. C., C. M. Black. 1999. Systemic sclerosis: an autoantibody mosaic. Clin. Exp. Immunol. 117:207.[Medline]
  4. Kuwana, M., Jr T. A. Medsger, T. M. Wright. 1995. T cell proliferative response induced by DNA topoisomerase I in patients with systemic sclerosis and healthy donors. J. Clin. Invest. 96:586.
  5. LeRoy, E. C., C. Black, R. Fleischmajer, S. Jablonska, T. Krieg, Jr T. A. Medsger, N. Rowell, F. Wollheim. 1988. Scleroderma (systemic sclerosis): classification, subsets and pathogenesis. J. Rheumatol. 15:202.[Medline]
  6. Subcommittee for Scleroderma. 1980. Criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee: preliminary criteria for the classification of systemic sclerosis (scleroderma). Arthritis Rheum. 23:581.[Medline]
  7. Eisen, M. B., P. T. Spellman, P. O. Brown, D. Botstein. 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95:14863.[Abstract/Free Full Text]
  8. Heid, C. A., J. Stevens, K. J. Livak, P. M. Williams. 1996. Real time quantitative PCR. Genome Res. 6:986.[Abstract/Free Full Text]
  9. Arnett, F. C., J. D. Reveille, R. Goldstein, K. M. Pollard, K. Leaird, E. A. Smith, E. C. Leroy, M. J. Fritzler. 1996. Autoantibodies to fibrillarin in systemic sclerosis (scleroderma). An immunogenetic, serologic, and clinical analysis. Arthritis Rheum. 39:1151.[Medline]
  10. Okano, Y., V. D. Steen, Jr T. A. Medsger. 1993. Autoantibody reactive with RNA polymerase III in systemic sclerosis. Ann. Intern. Med. 119:1005.[Abstract/Free Full Text]
  11. Oddis, C. V., Y. Okano, W. A. Rudert, M. Trucco, R. J. Duquesnoy, Jr T. A. Medsger. 1992. Serum autoantibody to the nucleolar antigen PM-Scl. Clinical and immunogenetic associations. Arthritis Rheum. 35:1211.[Medline]
  12. Gabrielli, A., M. Montroni, S. Rupoli, M. L. Caniglia, F. DeLustro, G. Danieli. 1988. A retrospective study of antibodies against basement membrane antigens (type IV collagen and laminin) in patients with primary and secondary Raynaud’s phenomenon. Arthritis Rheum. 31:1432.[Medline]
  13. Tsuneda, Y., Y. Kitajima, S. Mori. 1988. Autoantibodies to vimentin-type intermediate filament in patients with progressive systemic sclerosis. J. Dermatol. 15:128.[Medline]
  14. Earnshaw, W., B. Bordwell, C. Marino, N. Rothfield. 1986. Three human chromosomal autoantigens are recognized by sera from patients with anti-centromere antibodies. J. Clin. Invest. 77:426.
  15. Muro, Y., T. Yamada, M. Himeno, K. Sugimoto. 1998. cDNA cloning of a novel autoantigen targeted by a minor subset of anti-centromere antibodies. Clin. Exp. Immunol. 111:372.[Medline]
  16. Kuwana, M., J. Kaburaki, Y. Okano, T. Tojo, M. Homma. 1994. Clinical and prognostic associations based on serum antinuclear antibodies in Japanese patients with systemic sclerosis. Arthritis Rheum. 37:75.[Medline]
  17. Diot, E., B. Giraudeau, P. Diot, D. Degenne, L. Ritz, J. L. Guilmot, E. Lemarie. 1999. Is anti-topoisomerase I a serum marker of pulmonary involvement in systemic sclerosis?. Chest 116:715.[Abstract/Free Full Text]
  18. Harvey, G. R., S. Butts, A. L. Rands, Y. Patel, N. J. McHugh. 1999. Clinical and serological associations with anti-RNA polymerase antibodies in systemic sclerosis. Clin. Exp. Immunol. 117:395.[Medline]
  19. Satoh, M., M. Kuwana, T. Ogasawara, A. K. Ajmani, J. J. Langdon, D. Kimpel, J. Wang, W. H. Reeves. 1994. Association of autoantibodies to topoisomerase I and the phosphorylated (IIO) form of RNA polymerase II in Japanese scleroderma patients. J. Immunol. 153:5838.[Abstract]
  20. Arnett, F. C., R. F. Howard, F. Tan, J. M. Moulds, W. B. Bias, E. Durban, H. D. Cameron, G. Paxton, T. J. Hodge, P. E. Weathers, et al 1996. Increased prevalence of systemic sclerosis in a Native American tribe in Oklahoma: association with an Amerindian HLA haplotype. Arthritis Rheum. 39:1362.[Medline]
  21. Kuwana, M., J. Kaburaki, F. C. Arnett, R. F. Howard, Jr T. A. Medsger, T. M. Wright. 1999. Influence of ethnic background on clinical and serologic features in patients with systemic sclerosis and anti-DNA topoisomerase I antibody. Arthritis Rheum. 42:465.[Medline]
  22. Tan, E. M.. 1991. Autoantibodies in pathology and cell biology. Cell 67:841.[Medline]
  23. Casciola-Rosen, L., F. Wigley, A. Rosen. 1997. Scleroderma autoantigens are uniquely fragmented by metal-catalyzed oxidation reactions: implications for pathogenesis. J. Exp. Med. 185:71.[Abstract/Free Full Text]
  24. Fanning, G. C., K. I. Welsh, C. Bunn, R. Du Bois, C. M. Black. 1998. HLA associations in three mutually exclusive autoantibody subgroups in UK systemic sclerosis patients. Br. J. Rheumatol. 37:201.[Abstract/Free Full Text]
  25. Kuwana, M., H. Inoko, H. Kameda, T. Nojima, S. Sato, K. Nakamura, T. Ogasawara, M. Hirakata, Y. Ohosone, J. Kaburaki, et al 1999. Association of human leukocyte antigen class II genes with autoantibody profiles, but not with disease susceptibility in Japanese patients with systemic sclerosis. Intern. Med. 38:336.[Medline]
  26. Mocci, S., K. Lafferty, M. Howard. 2000. The role of autoantigens in autoimmune disease. Curr. Opin. Immunol. 12:725.[Medline]
  27. Rodenburg, R. J., J. M. Raats, G. J. Pruijn, W. J. van Venrooij. 2000. Cell death: a trigger of autoimmunity?. BioEssays 22:627.[Medline]
  28. Zhou, X. D., F. K. Tan, M. Xiong, M. Dimachke, F. C. Arnett. 2000. Gene expression profile of muscle biopsies from patients with inflammatory myopathies. Arthritis Rheum. 43:S275. (Abstr.).
  29. Targoff, I. N.. 2000. Update on myositis-specific and myositis-associated autoantibodies. Curr. Opin. Rheumatol. 12:475.[Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
W. Ning, Y. Dong, J. Sun, C. Li, M. A. Matthay, C. A. Feghali-Bostwick, and A. M. K. Choi
Cigarette Smoke Stimulates Matrix Metalloproteinase-2 Activity via EGR-1 in Human Lung Fibroblasts
Am. J. Respir. Cell Mol. Biol., April 1, 2007; 36(4): 480 - 490.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Zhou, F. K. Tan, D. M. Milewicz, X. Guo, C. A. Bona, and F. C. Arnett
Autoantibodies to Fibrillin-1 Activate Normal Human Fibroblasts in Culture through the TGF-{beta} Pathway to Recapitulate the "Scleroderma Phenotype"
J. Immunol., October 1, 2005; 175(7): 4555 - 4560.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
T Bohgaki, Y Amasaki, N Nishimura, M Bohgaki, Y Yamashita, M Nishio, K-i Sawada, S Jodo, T Atsumi, and T Koike
Up regulated expression of tumour necrosis factor {alpha} converting enzyme in peripheral monocytes of patients with early systemic sclerosis
Ann Rheum Dis, August 1, 2005; 64(8): 1165 - 1173.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. P. Denton, G. E. Lindahl, K. Khan, X. Shiwen, V. H. Ong, N. J. Gaspar, K. Lazaridis, D. R. Edwards, A. Leask, M. Eastwood, et al.
Activation of Key Profibrotic Mechanisms in Transgenic Fibroblasts Expressing Kinase-deficient Type II Transforming Growth Factor-{beta} Receptor (T{beta}RII{Delta}k)
J. Biol. Chem., April 22, 2005; 280(16): 16053 - 16065.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Chapuy-Regaud, M. Sebbag, D. Baeten, C. Clavel, C. Foulquier, F. De Keyser, and G. Serre
Fibrin Deimination in Synovial Tissue Is Not Specific for Rheumatoid Arthritis but Commonly Occurs during Synovitides
J. Immunol., April 15, 2005; 174(8): 5057 - 5064.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
A. L. Lagan, P. Pantelidis, E. A. Renzoni, C. Fonseca, P. Beirne, A. B. Taegtmeyer, C. P. Denton, C. M. Black, A. U. Wells, R. M. du Bois, et al.
Single-nucleotide polymorphisms in the SPARC gene are not associated with susceptibility to scleroderma
Rheumatology, February 1, 2005; 44(2): 197 - 201.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Ning, C.-J. Li, N. Kaminski, C. A. Feghali-Bostwick, S. M. Alber, Y. P. Di, S. L. Otterbein, R. Song, S. Hayashi, Z. Zhou, et al.
Comprehensive gene expression profiles reveal pathways related to the pathogenesis of chronic obstructive pulmonary disease
PNAS, October 12, 2004; 101(41): 14895 - 14900.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Yasuoka, H. Ihn, T. A. Medsger Jr, M. Hirakata, Y. Kawakami, Y. Ikeda, and M. Kuwana
A Novel Protein Highly Expressed in Testis Is Overexpressed in Systemic Sclerosis Fibroblasts and Targeted by Autoantibodies
J. Immunol., December 15, 2003; 171(12): 6883 - 6890.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. L. Whitfield, D. R. Finlay, J. I. Murray, O. G. Troyanskaya, J.-T. Chi, A. Pergamenschikov, T. H. McCalmont, P. O. Brown, D. Botstein, and M. K. Connolly
Systemic and cell type-specific gene expression patterns in scleroderma skin
PNAS, October 14, 2003; 100(21): 12319 - 12324.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, X.
Right arrow Articles by Arnett, F. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, X.
Right arrow Articles by Arnett, F. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS