| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*
Division of Rheumatology and Clinical Immunogenetics and
Division of Medical Genetics, Department of Internal Medicine, University of Texas Medical School, Houston, TX 77030;
Human Genetics Center, University of Texas School of Public Health, Houston, TX 77030;
Division of Rheumatology and Clinical Immunology, Department of Medicine, University of Pittsburgh, Pittsburgh, PA 15261; and
¶ Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The present studies using a 4000-element cDNA microarray to profile gene expression in cultured dermal fibroblasts from SSc patients demonstrated that several autoantigen genes specifically targeted in SSc were overexpressed compared with dermal fibroblasts from normal controls. Therefore, we surveyed the expression of 72 known autoantigen genes from a variety of human autoimmune diseases that were represented on the array. Indeed, in SSc fibroblasts, several SSc-specific autoantigen genes appeared to be selectively overexpressed compared with those targeted in other autoimmune diseases. Transcript overexpression of these genes was confirmed using RT-PCR. Muscle tissue and PBMC from SSc patients did not show gene expression changes for the SSc-specific autoantigens compared with their normal counterparts, nor did dermal fibroblasts from patients with other fibrosing diseases. These findings may provide clues to the origins of autoimmune responses and pathogenetic mechanisms in SSc.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For the microarray and quantitative-RT-PCR, 3-mm punch skin biopsies of clinically affected and/or unaffected skin were obtained from 11 SSc patients with disease duration of <5 yr. Two patients were Choctaw Native Americans, three were African Americans, one was Mexican-American, and five were Caucasians. Three patients had limited SSc, and the remainder had diffuse skin disease as defined by Leroy et al. (5). All SSc patients fulfilled the American College of Rheumatology Criteria for the classification of scleroderma (6). As controls with other fibrosing diseases, two patients each with scleromyxedema and eosinophilic fasciitis also were biopsied. These biopsies were obtained when the patients had active disease from lesional skin. Normal control skin samples were obtained from seven age- (±5 yr) and sex-matched patients with no history of autoimmune diseases who were undergoing routine dermatological surgery.
Anti-coagulated blood was obtained from three SSc patients (these three patients also had fibroblasts explanted from skin biopsies) and from three age- and sex-matched normal controls. PBMC were isolated from the anti-coagulated blood by Ficoll-Hypaque gradient centrifugation and were washed three times through centrifugation.
Stored frozen skeletal muscle biopsies were obtained from three different SSc patients who had under gone diagnostic biopsy and from three age- and sex-matched controls. These SSc patients had symptoms of muscle weakness and/or pain. Two of the biopsies were normal histologically, while the third showed changes compatible with a noninflammatory myopathy. Three matched controls with stored frozen muscle biopsies who had muscle complaints but histopathologically normal muscle biopsies and other normal diagnostic studies (creatine kinase levels and electromyography) were similarly studied. Study subjects provided written informed consent, and the protocol was approved by the University of Texas committee for the protection of human subjects.
Tissue culture
A 3-mm skin biopsy was stored in DMEM with 10% FCS supplemented with an antibiotic and antimycotic. The tissue sample was subsequently washed in 70% ethanol, PBS, and 10% FCS/DMEM. Cultured fibroblast cell strains were established by mincing and placing tissues into 60-mm culture dishes secured by glass coverslips. The primary cultures were maintained in DMEM with 10% FCS and supplemented with antibiotic and antimycotic. Low passage fibroblasts cell strains were plated at a density of 2.5 x 105 cells in a 35-mm dish and incubated for RNA isolations.
Microarrays
Total RNA was isolated from cultured fibroblast cell strains,
muscle biopsies, and PBMC using TRIzol reagent (Life Technologies,
Gaithersburg, MD) and treated with DNase I (Ambion, Austin, TX).
Double-strand cDNA probe with [33P]dCTP was
generated from 1 µg total RNA using the Superscript cDNA system (Life
Technologies). Labeled probe was purified by a chromatograph column (5
Prime
3 Prime, Boulder, CO), and then suspended in 100 µl
hybridization buffer. The sp. act. of the probe was determined in a
scintillation counter. A total of 3 x 106
cpm probe was denatured at 95°C for 8 min before hybridization.
Microarray filters spotted with 4000 human cDNAs (GF-211, Research Genetics, Huntsville, AL) were prehybridized in 5 ml hybridization buffer with 5 µl poly(A) (1 mg/ml) and 5 µl denatured Cot-1 DNA at 42°C with gentle rotation for 3 h. The denatured probe was loaded into the same buffer, then the rotating hybridization was continued at 42°C for 16 h. The hybridized filter was washed twice in 2x SSC/1% SDS at 50°C for 20 min, followed by 15 min at room temperature. The hybridization signal was detected by the Cyclone Phosphor System (Packard Bioscience, Downers Grove, IL). Duplicate RNA samples were tested in all but four samples. Array images were analyzed with Pathways software (Research Genetics). Genes that gave a signal at or below background levels were discarded.
Array analysis
To account for gene expression changes due to experimental variation, gene expression data were normalized as follows. One control sample array was randomly selected as the reference. The reciprocal of the coefficient of the regression of the gene expression of subsequent arrays over the reference array was taken as a normalizing factor. For each array, the normalization factor was derived in this manner, and the expression of each gene in the array was multiplied by this factor to result in normalized gene expressions. The normalized data were transformed into logarithms and clustered using a hierarchical clustering algorithm (7). Student’s paired t tests were used to measure differences in the degree of gene expression in the normal vs disease tissues. The t statistic provides an estimate of the difference (and the precision of the difference) in mean expression ratios (or fold differences) of the two groups. Categorical differences were tested using Fisher’s exact tests. The level of statistical significance was set at p < 0.05.
Quantitative RT-PCR
Quantitative real-time RT-PCR was performed using an ABI 7700
Sequence Detector (Applied Biosystems, Foster City, CA)
(8) for the transcripts of DNA topoisomerase I,
fibrillarin, CENP-B, and centromere autoantigen p27 (CENP-p27).
Specific quantitative assays were developed using Primer Express
software (PE Biosystems) following the recommended guidelines based on
sequences from GenBank. The primers and probes for each gene are listed
in Table I
. Total RNA was extracted from
study tissues as described previously, and they were the same RNA
samples as those used in the microarray assays. cDNA was synthesized in
a 10-µl total volume by the addition of 6 µl/well RT master mix,
consisting of 400 nM assay-specific reverse primer, 500 µM
deoxynucleotides, Superscript II buffer, DTT, and 10 U Superscript II
reverse transcriptase (Life Technologies), to a 7700 96-well plate,
followed by a 4-µl volume of sample (25 ng/µl). Each sample was
measured in triplicate plus a control without reverse transcriptase.
Each plate also contained an assay-specific sDNA (synthetic amplicon
oligo) standard spanning a 5-log range and a no template control.
Samples were incubated in a thermocycler (MJ Research, Waltham, MA) for
30 min at 50°C, followed by 72°C for 10 min. Subsequently, 40 µl
PCR master mix (400 nM forward and reverse primers, 100 nM fluorogenic
probe, 3 mM MgCl2, 200 µM deoxynucleotides, PCR
buffer, and 1.25 U Taq polymerase (Life Technologies)) were
added directly to each well of the cDNA plate. Each assembled plate was
then capped and run in the 7700 using the following cycling conditions:
95°C for 1 min, and 40 cycles of 95°C for 12 s and 60°C for
1 min. The resulting data were analyzed using SDS software (Applied
Biosystems, Foster City, CA) with TAMRA as the reference dye.
|
Due to the inherent inaccuracies in quantitating total RNA by
absorbance, the amount of RNA added to an RT-PCR from each sample was
more accurately determined by measuring the 
-actin transcript levels
in each sample. The final data were normalized to -actin and are
presented as the molecules of transcript/molecules of -actin x
100 (percentage of -actin).
A semiquantitative RT-PCR method was used for confirmation of microarray data for the RNA polymerase II and PM-Scl transcripts. The primers and probe for RNA polymerase II are: forward primer (2534+), CATCGAGAAGGCACACAACA; reverse primer (2615-), GCGGTTCACCTGATTCTCAA; and probe (2573-), CGTCTGCCGCAGAGTGTTCCCT. The primers and probe for PM-Scl are: forward primer (1852+), TCTCTTTGGACCTCACGACTG; reverse primer (1916-), CACTGGTTGGGATGATTGGA; and probe (1874+), TCCCATGCCCCTCCGGATG. RNA samples were run as described above without a standard (sDNA). Molecules of transcript for each sample were determined mathematically in Microsoft Excel from the slope and y-intercept of a transcript-specific standard curve (sDNA) run on a separate plate. Although this method is not preferred for absolute quantitation, it will give correct relative values for comparison of the samples to one another.
Autoantibody testing
All patient sera were tested for antinuclear Abs by indirect immunofluorescence using HEp-2 cells as Ag substrate (Antibodies, Davis, CA). Anti-centromere was determined visually by their distinctive indirect immunofluorescence patterns on HEp-2 cells. Anti-topoisomerase I (Scl-70) Abs were detected by passive immunodiffusion against calf thymus extracts using commercial kits (INOVA, Diagnostics, Inc., San Diego, CA). Anti-fibrillarin (9) and anti-RNA polymerases I, II, and III (10) were detected by immunoprecipitation as described previously. Anti-PM-Scl Abs were detected by immunoprecipitation and confirmed by Ouchterlony double immunodiffusion (11).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Thirty-two genes of approximately 4000 genes on the array showed
altered expression levels that were statistically significantly
different (p 
0.05) from those of controls
and showed an adequate signal above
background. These included seven autoantigen genes and 25
nonautoantigen genes (Tables II and III).
The cluster analysis of all SSc and control fibroblast strains based on
the expressions of these genes resulted in a clear distinction between
patients and controls (Fig. 1).
|
|
|
). The remaining 56 autoantigens occurred specifically
in other connective tissue diseases, such as systemic lupus
erythematosus, Sjögren’s syndrome, poly- or dermatomyositis, and
certain organ-specific autoimmune disorders, or as nonspecific
autoantigens in a variety of disease states. Among the 16 SSc-specific or -associated autoantigen genes, five demonstrated an average increased expression of 1.44-fold or higher in the SSc patients than in the controls. The average expression levels of four of these five autoantigen genes were statistically significantly different between patients and controls using t statistics, including CENP-B, CENP-p27, U3-RNP (fibrillarin), and the 220-kDa subunit of RNA polymerase II. The PM-Scl (100 kDa) autoantigen gene also showed an average 1.44-fold increased expression, but in fewer patients (p = 0.091). Only 3 of the 56 non-SSc-specific autoantigen genes showed statistically significantly increased expression levels. Two of these, laminin S (ratio, 1.58; p = 0.008) and vimentin (ratio, 1.52; p = 0.008), have been reported as nonspecific autoantigens in SSc previously (12, 13). The third, nucleolar autoantigen No55 (ratio, 1.67; p = 0.053) has not been studied in SSc to our knowledge. A statistical comparison of the number of overexpressed SSc autoantigen genes in SSc fibroblasts (4 of 16 SSc autoantigens, excluding PM-Scl (100 kDa), vs 3 of 56 non-SSc autoantigens) resulted in a p value of 0.039 and an odds ratio of 5.9, while inclusion of PM-Scl yielded a p value of 0.01 and an odds ratio of 8.0. If vimentin and laminin S were considered as SSc-related autoantigens, then the likelihood that these observations were occurring by chance alone is 7 of 16 vs 1 of 56 (p = 0.00005; odds ratio, 42.8).
The altered expression of autoantigen genes in SSc skin fibroblast
strains did not show significant differences in expression when
fibroblasts from clinically affected and unaffected skin were studied
in the same patients (data not show). Increased expression levels
(ratios = 1.4 or higher) of two or more of the five autoantigen
genes was found in 10 of the 11 SSc patients (Table IV). However, the pattern of SSc
autoantigen gene expression did not correlate with the type of
SSc-specific autoantibody expressed by each patient (Table IV).
|
). The first group included 8 of the 11
SSc fibroblast strains whose gene expression patterns were marked by
overexpression of SSc autoantigen genes. The other three SSc fibroblast
strains and all seven control fibroblast strains were classified into a
second major group, but two of the three SSc fibroblast strains were
classified under different subgroups (Fig. 2).
|
). Of potential interest, however, the
70-kDa U1-RNP gene showed 2-fold increased expression levels in all
three of the muscle biopsies from SSc patients.
|
).
|
). Although some ratios between SSc patients and controls are less
than 2-fold, these genes demonstrated consistent patterns and adequate
signal above background levels. The functions of these genes included
extracellular matrix composition and regulation, apoptosis, gene
transcription, inflammation, metabolic regulation, and others. The
expression of some collagen genes, e.g., collagen type I 
-2 and
collagen type III -1 genes, were increased in some SSc patients.
Over 2-fold increased gene expression of HLA-C and HLA-DRA1 also was
observed in four SSc patients. Quantitative RT-PCR
Quantitative RT-PCR was used to confirm the gene expression levels
for SSc-specific autoantigens in skin fibroblast strains. Because
topoisomerase I is a major autoantigen in SSc (but was not detected in
our microarray assays as its signal was not much higher than
background), it also was specifically assayed using RT-PCR. The overall
gene expression levels for CENP-B, CENP-p27, fibrillarin, RNA
polymerase II, and PM-Scl (100 kDa) in this assay were reasonably
concordant with those seen on the cDNA microarrays, although several
genes showed 2- to 3-fold higher levels by RT-PCR. The topoisomerase I
gene displayed an average 4.5-fold increase in expression level using
RT-PCR (Table IV).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1.44 in the SSc fibroblasts compared with normal fibroblasts. In
some cases, these ratios were >2-fold. Although it is difficult to
predict which ratio of these increases may be biologically important,
comparisons between all SSc patients and controls showed that these
alterations in gene expressions were statistically significant. Whether
these changes ultimately prove to be clinically or pathogenetically
relevant remains to be seen. Another comparison examining the number of
SSc-related autoantigens showing altered expression (4 of 16) in SSc
fibroblasts as opposed to non-SSc-related autoantigens (3 of 56)
indicated that the likelihood that these observations were due to
chance alone was small (p = 0.039). In
addition, another SSc autoantigen gene, PM-Scl (100 kDa), also
appeared to show increased expression levels averaging 1.44-fold in six
of the 11 SSc patients, although the overall comparison of expression
levels between patients and controls was not statistically significant
(p = 0.09).
The majority of SSc patients demonstrated increased expression of two
or more autoantigen genes, but there was no correlation between the
patterns of autoantigen gene expression and autoantibody profiles of
individual patients. RT-PCR confirmed increased transcripts of these
autoantigens in the majority of SSc patients’ fibroblasts and, in
addition, showed increased levels of DNA topoisomerase I transcripts in
SSc fibroblasts (1.5-fold in 10 of 11, 4.5-fold on the average). The
reason for our inability to detect changes in topoisomerase I on the
arrays may be due to the fact that the sensitivity of array-based
assays is lower than that of quantitative RT-PCR.
Moreover, autoantigen transcripts were not altered in the fibroblasts of four patients with other fibrosing diseases (two each with scleromyxedema and eosinophilic fasciitis). Finally, microarray analyses of muscle tissue and PBMC from SSc patients also failed to detect any alterations in autoantigen gene expression as seen in the fibroblasts, thus suggesting that this phenomenon was selective for SSc dermal fibroblasts (of those tissues studied).
All the autoantigens detected here are targeted in SSc. Anti-centromere Abs are highly specific for scleroderma, most typically the limited form of the disease or the calcinosis, Raynaud phenomenon, esophageal dysmotility, sclerodactyly, and telangiectasia syndrome. Although centromeric autoantigens include CENP-A, CENP-B, CENP-C, and others, CENP-B is considered the major one, since Abs in high titer to CENP-B are consistently found in anti-centromere-positive sera (14). More recently using autoimmune sera from a patient with anti-centromere Abs, Muro et al. (15) identified a novel 27-kDa protein (p27) to which approximately 2% of anti-centromere Abs reacted. All cases with anti-p27 had SSc and/or Sjögren’s syndrome.
Fibrillarin is a component of a small nucleolar RNP particle thought to participate in the first step in processing preribosomal RNA. In humans, fibrillarin is associated with U3, U8, and U13 small nuclear RNAs. Anti-fibrillarin Abs are highly specific for SSc, typically occurring in a small subset with diffuse skin thickening and telangiectasia, and visceral involvement in men and African Americans (9).
DNA topoisomerase I catalyzes the breaking and joining of DNA strands. Autoantibodies to topoisomerase I are specific for SSc patients and are associated with diffuse skin involvement and pulmonary fibrosis (16, 17).
DNA-dependent RNA polymerase II, a complex multisubunit enzyme, is responsible for the transcription of protein-coding genes. Autoantibodies to RNA polymerases I, II, and III occur frequently in SSc, often in various combinations; however, anti-RNA polymerase III Abs are most common and can be used to predict a high likelihood of diffuse skin disease and severe visceral involvement in SSc (18). Anti-RNA polymerase II Abs have been reported most often in systemic lupus erythematosus; however, Abs to phosphorylated RNA polymerase II occur frequently in Japanese SSc patients who also have anti-topoisomerase I Abs (19) as well as in Choctaw Native Americans, who have a high prevalence of SSc and anti-topoisomerase I Abs (20) (F. C. Arnett, unpublished observations).
Finally, PM-Scl is another nucleolar particle. It consists of several polypeptides, of which two proteins of 75 and 100 kDa have been identified as the major antigenic components. Anti-PM-Scl Abs occur almost exclusively in a small percentage of Caucasians with SSc, myositis, or both (21).
Thus, the SSc autoantigens represent a variety of different proteins with differing cellular locations and functions. The reason that they should be targeted by an autoimmune response primarily in scleroderma and singly in individual patients is unclear, although several hypotheses recently have been proposed. Tan (22) has pointed out that the majority of SSc-specific autoantigens localize to the nucleolus during some phase of their cell cycles. Building upon this observation, Rosen and colleagues (23) have noted that heavy metals also are concentrated in the nucleolus and may catalyze oxidative reactions or in other ways fragment these proteins and reveal cryptic epitopes vulnerable to initiating an autoimmune response. It is likely that CD4-positive T lymphocytes are involved, because each of these autoantibody responses is associated with specific and largely different MHC class II alleles (2, 24, 25).
The findings in the present study that several of these SSc-related autoantigens are specifically and selectively overexpressed in SSc fibroblasts are provocative and raise the possibility that activated fibroblasts may represent the cellular source of the autoantigens driving the immune responses leading to the characteristic SSc-specific autoantibodies. Although the clear relationships between expression levels of specific autoantigen genes and corresponding autoantibodies in patients’ sera were not seen, it is possible that multiple Ags can be associated with a particular autoimmune disease. For example, a primary autoantigen may be responsible for the initiation of the autoimmune process and others become involved later in the course of the disease, i.e., epitope spreading (26). It is also important to know that autoantibody responses to specific autoantigen are associated with certain HLA class II alleles (9), and many of the epitopes are influenced by modification in various ways, such as metal-catalyzed oxidation (23, 27). This hypothesis would also suppose that these autoantigens would of necessity need to be externalized via cellular destruction or apoptosis or expressed on the cell surface, where they could be presented to the immune system. Alternatively, the activated fibroblast itself might serve as an APC. In the microarrays of SSc fibroblasts studied here, significantly increased expression of both class I and class II MHC genes was observed in some patients; however, it is unknown whether actual MHC molecules appear on the fibroblast cell surface in SSc and function normally.
The present results represent a first attempt at using multiple gene expression assays to understand molecular pathogenesis in SSc fibroblasts. It provides important preliminary evidence that the primary target tissue in SSc may play potential roles in initiation or perpetuation of autoimmunity by the potential overexpression of SSc-related autoantigen genes. Further studies of protein levels of these autoantigens will be necessary in the future. In addition, the possibility that the SSc-specific autoantibodies might target autoantigens expressed on the fibroblast cell surface or released into the extracellular matrix should be explored. The endogenous and/or exogenous stimuli leading to fibroblast activation and fibrosis are currently unknown. Moreover, similar studies of endothelial cells in SSc, another major cell type involved in pathogenesis, are needed and are in progress.
As a hypothesis, the overexpression of disease-specific autoantigens in the target tissues of other autoimmune diseases also should be explored. In recent microarray studies of affected muscle biopsies in poly- and dermatomyositis patients, several were found to overexpress certain aminoacyl tRNA synthetase genes (28). Autoantibodies to tRNA synthetases are characteristic of these autoimmune muscle diseases (29). The application of genomic technology to complex and poorly understood diseases, such as SSc, by virtue of a more comprehensive view of gene expression and molecular pathways may help unite seemingly disparate observations.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Xiaodong Zhou, Division of Rheumatology and Clinical Immunogenetics, University of Texas Medical School, 6431 Fannin, MSB5.270, Houston, TX 77030. E-mail address: xiaodong.zhou{at}uth.tmc.edu
3 Abbreviations used in this paper: SSc, systemic sclerosis; CENP-B, centromeric protein B; sDNA, synthetic DNA; RNP, ribonucleoprotein; PM-Scl, polymyositis/scleroderma autoantigen.
Received for publication July 27, 2001. Accepted for publication October 18, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  W. Ning, Y. Dong, J. Sun, C. Li, M. A. Matthay, C. A. Feghali-Bostwick, and A. M. K. Choi Cigarette Smoke Stimulates Matrix Metalloproteinase-2 Activity via EGR-1 in Human Lung Fibroblasts Am. J. Respir. Cell Mol. Biol., April 1, 2007; 36(4): 480 - 490. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhou, F. K. Tan, D. M. Milewicz, X. Guo, C. A. Bona, and F. C. Arnett Autoantibodies to Fibrillin-1 Activate Normal Human Fibroblasts in Culture through the TGF-{beta} Pathway to Recapitulate the "Scleroderma Phenotype" J. Immunol., October 1, 2005; 175(7): 4555 - 4560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T Bohgaki, Y Amasaki, N Nishimura, M Bohgaki, Y Yamashita, M Nishio, K-i Sawada, S Jodo, T Atsumi, and T Koike Up regulated expression of tumour necrosis factor {alpha} converting enzyme in peripheral monocytes of patients with early systemic sclerosis Ann Rheum Dis, August 1, 2005; 64(8): 1165 - 1173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. P. Denton, G. E. Lindahl, K. Khan, X. Shiwen, V. H. Ong, N. J. Gaspar, K. Lazaridis, D. R. Edwards, A. Leask, M. Eastwood, et al. Activation of Key Profibrotic Mechanisms in Transgenic Fibroblasts Expressing Kinase-deficient Type II Transforming Growth Factor-{beta} Receptor (T{beta}RII{Delta}k) J. Biol. Chem., April 22, 2005; 280(16): 16053 - 16065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chapuy-Regaud, M. Sebbag, D. Baeten, C. Clavel, C. Foulquier, F. De Keyser, and G. Serre Fibrin Deimination in Synovial Tissue Is Not Specific for Rheumatoid Arthritis but Commonly Occurs during Synovitides J. Immunol., April 15, 2005; 174(8): 5057 - 5064. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Lagan, P. Pantelidis, E. A. Renzoni, C. Fonseca, P. Beirne, A. B. Taegtmeyer, C. P. Denton, C. M. Black, A. U. Wells, R. M. du Bois, et al. Single-nucleotide polymorphisms in the SPARC gene are not associated with susceptibility to scleroderma Rheumatology, February 1, 2005; 44(2): 197 - 201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Ning, C.-J. Li, N. Kaminski, C. A. Feghali-Bostwick, S. M. Alber, Y. P. Di, S. L. Otterbein, R. Song, S. Hayashi, Z. Zhou, et al. Comprehensive gene expression profiles reveal pathways related to the pathogenesis of chronic obstructive pulmonary disease PNAS, October 12, 2004; 101(41): 14895 - 14900. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yasuoka, H. Ihn, T. A. Medsger Jr, M. Hirakata, Y. Kawakami, Y. Ikeda, and M. Kuwana A Novel Protein Highly Expressed in Testis Is Overexpressed in Systemic Sclerosis Fibroblasts and Targeted by Autoantibodies J. Immunol., December 15, 2003; 171(12): 6883 - 6890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Whitfield, D. R. Finlay, J. I. Murray, O. G. Troyanskaya, J.-T. Chi, A. Pergamenschikov, T. H. McCalmont, P. O. Brown, D. Botstein, and M. K. Connolly Systemic and cell type-specific gene expression patterns in scleroderma skin PNAS, October 14, 2003; 100(21): 12319 - 12324. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
