|
|
||||||||
1


*
Pharmazentrum Frankfurt and
Second Department of Medicine, Klinikum der Johann Wolfgang Goethe-Universität, Frankfurt am Main, Germany
| Abstract |
|---|
|
|
|---|
induces expression and release of IL-18BPa from DLD-1 cells.
mRNA induction and secretion of IL-18BPa immunoreactivity were
associated with an activity that significantly impaired release of
IFN-
by IL-12/IL-18-stimulated PBMC. Inducibility of IL-18BPa by
IFN-
was also observed in LoVo, Caco-2, and HCT116 human colon
carcinoma cell lines and in the human keratinocyte cell line HaCaT.
Induction of IL-18BPa in colon carcinoma/epithelial cell lines was
suppressed by coincubation with sodium butyrate. IFN-
-mediated
IL-18BPa and its suppression by sodium butyrate were confirmed in organ
cultures of intestinal colonic biopsy specimens. In contrast, sodium
butyrate did not modulate expression of IL-18. The present data suggest
that IFN-
may limit biological functions of IL-18 at sites of
colonic immune activation by inducing IL-18BPa production.
Down-regulation of IL-18BPa by sodium butyrate suggests that
reinforcement of local IL-18 activity may contribute to actions of this
short-chain fatty acid in the colonic
microenvironment. | Introduction |
|---|
|
|
|---|
by >90% (6). Serum levels of IL-18BP are
up-regulated in patients with septic shock (10). The
significance of IL-18BP in pathophysiology is further underscored by
the observation that the poxvirus family of DNA viruses secretes active
viral forms of IL-18BP besides soluble receptors for IL-1
, IFNs, and
certain chemokines (6, 11). Colon epithelial cells have been identified as a potential source of IL-18, and expression of this cytokine is up-regulated in Crohns disease (12, 13). Interestingly, reduction of IL-18 bioactivity by neutralizing Abs is protective in murine experimental colitis (14). In addition, IL-18 appears to be modulated in colorectal cancer (15). In the present study, we investigated expression of IL-18BPa in the colon carcinoma/epithelial cell line DLD-1.
| Materials and Methods |
|---|
|
|
|---|
IFN-
and IL-18 were from PeproTech (Frankfurt,
Germany). Brefeldin A (BFA), sodium butyrate, and actinomycin D were
from Sigma (Deisenhofen, Germany). IL-12 was purchased from R&D Systems
(Wiesbaden, Germany), and okadaic acid was from Calbiochem-Novabiochem
(Bad Soden, Germany).
Cultivation of DLD-1, Caco-2, LoVo, HCT116, and HaCaT cells
Human DLD-1 (Center for Applied Microbiology and Research, Salisbury, U.K.), HCT116 (American Type Culture Collection, Manassas, VA), Caco-2 (German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany), colon carcinoma cells, and HaCaT keratinocytes (provided by N. E. Fusenig, Deutsches Krebsforschungszentrum, Heidelberg, Germany) (16) were grown in DMEM supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% heat-inactivated FCS (Life Technologies, Eggenstein, Germany). LoVo (American Type Culture Collection) colon carcinoma cells were maintained in RPMI 1640 supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% heat-inactivated FCS (Life Technologies). For the experiments, cells on polystyrene plates (Greiner, Frickenhausen, Germany) were washed twice with PBS and incubated in the aforementioned DMEM medium without FCS. Cell viability was determined by a lactate dehydrogenase (LDH) activity assay, according to the manufacturers instructions (Roche Molecular Biochemicals, Mannheim, Germany). All cultures were incubated for the indicated time periods at 37°C in a humidified atmosphere containing 5% CO2.
Isolation and cultivation of PBMC
The study protocol and consent documents were approved by the Ethik Kommission of the Klinikum der Johann Wolfgang Goethe-Universität (Frankfurt am Main, Germany). Informed consent was obtained from volunteers. Healthy donors abstained from using any drugs during the 2 wk before the study. PBMC were isolated as previously described (17). PBMC were resuspended in conditioned media from DLD-1 cell cultures supplemented with 1% (v/v) heat-inactivated human AB serum (Sigma) and seeded at 2 x 106 cells/ml in round-bottom polypropylene tubes (Greiner).
IFN-
production by IL-12/IL-18-stimulated PBMC cultivated in
DLD-1 cell-derived conditioned media
To investigate whether conditioned medium from
IFN-
-stimulated DLD-1 cells may contain IL-18BPa activity, the
following experimental protocol was performed: DLD-1 cells were kept as
unstimulated control, or were stimulated with IFN-
(20 ng/ml), with
sodium butyrate alone (5 mM), or with IFN-
plus sodium butyrate for
14 h using DMEM medium (containing 10% FCS) to induce expression
of IL-18BPa. Thereafter, cultures were thoroughly washed three times
with PBS. After an additional 48-h incubation period in control DMEM
without FCS, cells were lysed for isolation of total RNA (see also
scheme of experimental design in Fig. 6
A). Cell-free culture
supernatants were either TCA precipitated (for SDS-PAGE) or
concentrated 5-fold using Ultrafree-4 Biomax 10K centrifugal filters
(Millipore, Bedford, MA). Concentrated conditioned media were
preincubated for 30 min without stimuli or with IL-12 (20 ng/ml)/IL-18
(20 ng/ml) at 37°C. PBMC were then resuspended in these conditioned
media and, after an additional 24 h of incubation, IFN-
production was assessed by ELISA.
|
The study protocol and consent documents were approved by the Ethik Kommission of the Klinikum der Johann Wolfgang Goethe-Universität. Informed consent was obtained from the donors. All patients required a colonoscopy for medical reasons. For the experiments, a macroscopically nondiseased biopsy site was chosen. Cultivation was performed as recently described (18). Within a maximal lag of 0.5 h after biopsy, specimens were washed carefully in PBS (Life Technologies). Thereafter, tissues were placed in 24-well tissue culture plates (Greiner) and maintained in DMEM without phenol red (Life Technologies; 1 ml/well) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin (Life Technologies), and 1% (v/v) heat-inactivated human AB serum (Sigma). Stimuli were added and, after the indicated incubation periods, cells were harvested for RNA isolation.
Analysis of mRNA for IL-18BPa, IL-18, and GAPDH
Total RNA was isolated using TRIzol reagent according to the manufacturers instructions (Life Technologies). One microgram of RNA was used for RT-PCR (GeneAmp RNA PCR kit, Amplitaq Gold; Perkin-Elmer, Weiterstadt, Germany), as described previously (19). Primers: IL-18BPa (forward), cctctactggctgggcaatgg; IL-18BPa (reverse), ttaaccctgctgctgtggac (annealing temperature, 58°C; number of cycles, 31); IL-18 (forward), accaagttctcttcattgacc; IL-18 (reverse), ttgcatcttattatcatgtcc (annealing temperature, 58°C; number of cycles, 30); GAPDH (forward), accacagtccatgccatcac; GAPDH (reverse), tccaccaccctgttgctgta (annealing temperature, 60°C; number of cycles, 23 for DLD-1, 28 for organ cultures). Identity of PCR products (length: 295 bp for IL-18BPa; 293 bp for IL-18; 452 bp for GAPDH) was confirmed by sequencing (310 Genetic Analyzer; Perkin-Elmer). RNase protection assay was performed as previously described: 20 µg total RNA was used. Human IL-18, IL-18BPa, and GAPDH probes were cloned by PCR. The cloned fragments correspond to nt 335627 for IL-18, 457644 for IL-18BPa, and 148302 for GAPDH (19, 20).
Detection of IL-18BPa and IL-18 by immunoblotting
Cell-free supernatants (5 ml/PS-10 plate) were TCA precipitated, as previously described (20). Briefly, 1/10 vol of TCA was added to cell-free supernatants. After 30 min at 0°C and a 30-min centrifugation step at 13,000 x g, pellets were washed in acetone and resuspended in Laemmli buffer. Unless otherwise indicated, TCA-precipitated proteins from 3.5 ml were separated by 10% SDS-PAGE. After blotting, IL-18BPa was detected by a rabbit polyclonal antiserum (immunizing peptide, TQEALPSSHSSPQQQG; Eurogentec, Seraing, Belgium). For detection of intracellular IL-18 and IL-18BPa, cells were lysed in 300 mM NaCl, 50 mM TrisCl, pH 7.6, and 0.5% Triton X-100, supplemented with protease inhibitor mixture (Roche Molecular Biochemicals). Protein (40 µg) and a 12% SDS-PAGE were used for analysis of IL-18 using rabbit polyclonal Abs (PeproTech). A total of 100 µg protein was used for analysis of IL-18BPa.
Transient expression of human IL-18BPa in DLD-1 cells
DLD-1 cells cultivated on six-well plates in DMEM medium
containing 10% FCS were transiently transfected with pORF-hil18bpa
(InvivoGen, San Diego, CA) using Fugene (Roche Diagnostics, Mannheim,
Germany), according to the manufacturers instructions. A total of 3
µl Fugene and 2.25 µg DNA was used per well. After 30 h, cells
were washed with PBS and incubated for 30 h in DMEM without FCS (2
ml/well). Supernatants (6 ml) were TCA precipitated and used in Fig. 2
A.
|
Levels of IFN-
in cell-free culture supernatants of PBMC
cultures were determined by ELISA according to the manufacturers
instructions (BD PharMingen, Heidelberg, Germany).
Statistical analysis
Data are shown as mean ± SD (experiments using DLD-1 cells), or mean ± SEM (experiments using PBMC), and are presented as percentage of viability, as percentage of inhibition, or as picograms per milliliter. Data were analyzed by unpaired Students t test on raw data using Sigma Plot (Jandel Scientific, San Rafael, CA).
| Results |
|---|
|
|
|---|
induces expression and release of IL-18BPa in the colon
carcinoma cell lines DLD-1 and Caco-2, as well as in HaCaT
keratinocytes
We recently reported on induction of IL-18BPa gene
expression by IFN-
in human nonleukocytic cells (19).
In the present study, we focused on the colon carcinoma/epithelial cell
line DLD-1 and sought to extend the abovementioned observations by
including the level of IL-18BPa protein release and function.
IFN-
-induced IL-18BPa mRNA (Fig. 1
A, lower panel)
was paralleled by secretion of the corresponding protein, as detected
by immunoblotting analysis of TCA-precipitated cell culture
supernatants (Fig. 1
, A and B). IL-18BPa appeared
as IFN-
-inducible immunoreactivity in the expected molecular
mass range between 40 and 50 kDa (6, 8). This
heterogeneity in the molecular mass agrees with a high degree of
glycosylation, as has been reported (6). Strong
immunoreactivity was observed when human IL-18BPa was transiently
expressed in DLD-1 cells (Fig. 2
A). In contrast, control
transfection with empty vector did not result in any immunoreactivity
(data not shown). IL-18BPa immunoreactivity induced by IFN-
consisted of two major bands. This was particularly evident when lower
amounts of proteins were separated on a 12% SDS-PAGE (Figs. 1
A and 2B, lane 2). The doublet was
also observed when lower amounts of IL-18BPa transiently expressed in
DLD-1 cells were subjected to SDS-PAGE (data not shown). Addition of
immunizing peptide to the antiserum impaired immunodetection of
IL-18BPa (Fig. 2
C). No immunoreactivity was detectable when
preimmune serum was used (data not shown). To exclude that effects of
IFN-
were due to endotoxin that is heat stable, IFN-
was heat
inactivated by boiling (99°C, 30 min) before use. Immunoreactivity
disappeared after heat inactivation of IFN-
(Fig. 2
D). In
addition, LPS (10 µg/ml) did not induce IL-18BPa in DLD-1 cells (data
not shown). IL-18BP is synthesized with a 28-residue signal peptide,
and is supposed to be secreted via the endoplasmatic/Golgi pathway
(6). Accordingly, BFA abrogated release of IL-18BPa (Fig. 2
E). However, despite readily detectable immunoreactivity of
IL-18BPa in supernatants of IFN-
-treated cells, we could not
demonstrate intracellular IL-18BPa by immunoblotting when whole cell
lysates were analyzed from IFN-
-treated cells (Fig. 2
F)
or from cells treated with IFN-
/BFA (data not shown). This
discrepancy between cell lysates and TCA-precipitated supernatants is
likely to be due to the huge enrichment factor immanent to the method
of TCA precipitation.
|
-treated
cultures as examined by determination of LDH activity in culture
supernatants: viability was 98.3 ± 0.4% vs 97.5 ± 0.4%
for control vs IFN-
-treated cells (20 ng/ml, 42 h,
n = 3). Ponceau S staining of membranes after blotting
revealed no differences in the total amounts of proteins loaded onto
the gels (Fig. 1
-induced cytotoxicity, with passive release of cellular
proteins as the driving force behind IL-18BPa immunoreactivity in
TCA-precipitated supernatants.
To investigate whether IFN-
-induced secretion of IL-18BPa is
restricted to DLD-1 cells or is of more general relevance, experiments
were performed using additional colon carcinoma/epithelial cell lines.
As shown in Fig. 3
, IFN-
-induced
IL-18BPa mRNA accumulation (A and B, left
panel) was associated with secreted IL-18BPa immunoreactivity
(A and B, right panel) in the
respective culture supernatants of LoVo (A) and Caco-2
(B) colon carcinoma cells. Similar data were obtained using
HCT116 colon carcinoma cells (data not shown). We also investigated the
keratinocyte cell line HaCaT (Fig. 3
C). Induction of
IL-18BPa mRNA (Fig. 3
C, left panel) was
paralleled by appearance of IL-18BPa in IFN-
-conditioned culture
supernatants (Fig. 3
C, right panel).
|
-induced IL-18BPa in colon
carcinoma cell lines
Butyrate is a short-chain fatty acid that is produced
by intestinal bacteria and is supposed to be an important regulator of
colonic epithelial cell biology (21). Sodium butyrate (B)
at 5 mM efficiently suppressed IFN-
-induced IL-18BPa protein release
as well as mRNA induction (Fig. 4
, A and B). It is important to take into account
that peak concentrations of butyrate in the colon can reach 20 mM
(21). Sodium butyrate alone did not change background
expression of IL-18BPa. Biological activity of IL-18 is supposed to be
determined by local concentrations of IL-18 vs IL-18BP. Therefore, we
determined the effect of sodium butyrate on expression of IL-18 in
these same experiments. Notably, sodium butyrate (5 mM) did not change
IL-18 expression in DLD-1 cells exposed to IFN-
(Fig. 4
C). Sodium butyrate is supposed to trigger apoptosis in
colon carcinoma cells (21). Thus, cell viability was
determined in these experiments. Sodium butyrate at 5 mM alone or in
combination with IFN-
did not modulate cell viability in DLD-1 cells
during a 24-h incubation period (Fig. 4
D). In contrast, cell
death was detectable when DLD-1 cells were incubated for 48 h with
sodium butyrate at 25 mM. Again, cell death was not associated with
appearance of IL-18BPa immunoreactivity in these supernatants.
Inhibition of IFN-
-induced IL-18BPa expression by sodium butyrate
was also observed in the colon carcinoma cell lines HCT116 (Fig. 4
E), LoVo, and Caco-2 (data not shown).
|
-stimulated DLD-1 cells release an activity that
impairs IFN-
production by IL-12/IL-18-stimulated PBMC
As shown in Fig. 5
A, compared with conditioned
media obtained from unstimulated cells, conditioned media from
IFN-
-stimulated DLD-1 cells impaired production of
IFN-
in PBMC exposed to IL-12/IL-18. To confirm that IL-18BPa is
actually detectable in these conditioned media, immunoblot analysis was
performed. As shown in Fig. 5
B, a 14-h stimulation with
IFN-
was sufficient to trigger detectable release of IL-18BPa during
an additional 48-h incubation period in control medium. Notably, in
these DLD-1 cells, augmented levels of IL-18BPa mRNA were still
detectable after this 48-h incubation in control medium. This is
consistent with a long
t1/2 (>8 h) of IFN-
-induced
IL-18BPa mRNA in DLD-1 cells, as detected in actinomycin D experiments
(data not shown). We also investigated effects of sodium butyrate using
this experimental protocol. However, conditioned media from DLD-1 cells
stimulated with sodium butyrate alone significantly reduced later
IFN-
production of IL-12/IL-18-activated PBMC by 60.1 ± 12.4%
(n = 3, p < 0.05). This indirect
inhibitory effect of sodium butyrate interfered with efficient recovery
of IL-12/IL-18-induced IFN-
in PBMC by use of conditioned media from
DLD-1 cells exposed to the combination IFN-
plus sodium butyrate
(data not shown).
|
mediates gene expression of IL-18BPa in organ cultures of
colonic intestinal biopsy specimens
Colonic intestinal biopsy specimens obtained from five different
donors were cultivated as unstimulated control, or exposed to either
IFN-
alone, or the combination IFN-
/sodium butyrate.
Up-regulation of IL-18BPa mRNA by IFN-
was observed after an
8-h incubation period (Fig. 6
). Transcripts sustained elevated for at
least another 15 h of stimulation (data not shown). In accordance
with data obtained using colon carcinoma cell lines, sodium butyrate
suppressed IFN-
-induced IL-18BPa expression in all organ culture
experiments performed (n = 5). In contrast, expression
of IL-18 mRNA in these same IFN-
-treated organ cultures was not
modulated by coincubation with sodium butyrate (Fig. 6
).
| Discussion |
|---|
|
|
|---|
-activated DLD-1 colon carcinoma/epithelial cells. IFN-
induction of IL-18BPa was not restricted to DLD-1 cells, but was
confirmed using LoVo, Caco-2, and HCT116 colon carcinoma cells, as well
as HaCaT keratinocytes. Secretion of IL-18BPa immunoreactivity
coincided with induction of IL-18BPa mRNA and with appearance of an
activity associated with IFN-
-treated DLD-1 cells that was able to
impair IL-12/IL-18-induced IFN-
in PBMC. Gene induction of IL-18BPa
by IFN-
was also observed in cultures of colonic biopsy specimens.
These latter results demonstrate up-regulation of IL-18BPa gene
expression in an ex vivo setting, and underscore the potential
significance of the data obtained using colon carcinoma/epithelial cell
lines. The present data are consistent with work by Fantuzzi et al.
(22) demonstrating reduced expression of IL-18BP in IFN
regulatory factor-1-deficient mice. These observations may have
important implications for the action of IFN-
and IL-18 under
pathophysiological conditions. By inducing IL-18BP, IFN-
appears to
trigger a negative feedback loop that limits IFN-
-dependent and
IFN-
-independent actions of IL-18. Accordingly, overproduction of
IFN-
has been observed in IFN-
receptor-deficient mice used in
models of hapten-induced colitis (23) and collagen-induced
arthritis (24). The present data are compatible with data
on IL-18BP expression in graft vs host disease, in which production of
IL-18BP increases in parallel with IFN-
(25). Moreover,
in adult Stills disease, serum levels of IL-18 correlate with the
presence of an inhibitory activity that impairs binding of IL-18 to its
membrane receptor (26). Up-regulation of IL-18BP might
also be involved in the diminished capability of IFN-
production in
ex vivo whole blood cultures obtained from patients with septic shock
(27). In fact, Novick et al. (10) recently
demonstrated augmented serum levels of IL-18BP in septic shock
patients. Therapeutic use of IL-18BPa may restore a hypothetically
disturbed IL-18/IL-18BP balance in diseases that are associated with
augmented production of Th1 cytokines, such as Crohns disease. In
addition, induction of IL-18BP may contribute to protective functions
of IFN-
, as seen in murine models for rheumatoid and septic
arthritis (28, 29), and in rheumatoid arthritis patients
(30).
Evidence suggests that IL-18 is an inhibitor of tumor growth. In this
context, suppression of a proposed IL-18BP activity should be
beneficial. IL-18 acts as inhibitor of angiogenesis (31)
and augments Fas/Fas ligand-dependent CD4+ T cell
and NK cell cytotoxicity (32, 33, 34). Previous reports
demonstrate that butyrate can protect against the development of colon
cancer (21). The present data imply that intestinal
butyrate may have the capability to strengthen the bioactivity of IL-18
at the colonic microenvironment by modulating IL-18BPa expression.
Taking into account the antitumor functions of IL-18, this is in
accordance with the tumor-suppressive potential of butyrate. Actually,
sodium butyrate augments the sensitivity of colon carcinoma cells
toward Fas-mediated apoptosis (35), and Fas-related
CD4+ T cell and NK cell cytotoxicity is
characteristically enhanced by IL-18 (32, 33, 34). Although
IFN-
should contribute to tumor-suppressive actions of IL-18 in
vivo, antitumor functions of IL-18 have been observed in an
IFN-
-independent manner (31, 32, 34). It is noteworthy
that under defined conditions, IFN-
in fact appears to be capable of
enhancing growth of colon carcinomas (36). Induction of
IL-18BP by IFN-
might contribute to this observation. Altogether,
sodium butyrate appears to shift the IL-18/IL-18BP balance in colon
carcinoma cells in favor of IL-18, which may contribute to local tumor
protection by this compound, most likely via IFN-
-independent
tumor-suppressive actions of IL-18. However, IL-18 may also augment
expression of genes that have been associated with cancer progression.
For example, IL-18 can up-regulate hepatic melanoma metastasis via
induction of VCAM-1 expression (37). In addition, IL-18
can mediate production of NO (38, 39), which has been
shown to facilitate growth of certain tumors, among them melanoma
(40) and colorectal cancer (41). The role of
IL-18 in tumor biology might depend on the particular setting.
Nonetheless, in addition to IL-18, regulation of its opponent IL-18BP
could prove to be a further parameter that determines tumor growth.
| Footnotes |
|---|
2 M.B. and M.N. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Heiko Mühl, Pharmazentrum Frankfurt, Klinikum der Johann Wolfgang Goethe-Universität Frankfurt am Main, Theodor-Stern-Kai 7, D-60590 Frankfurt am Main, Germany. E-mail address: H. Muehl{at}em.uni-frankfurt.de ![]()
4 Abbreviations used in this paper: IL-18BP, IL-18 binding protein; BFA, brefeldin A; LDH, lactate dehydrogenase. ![]()
Received for publication July 19, 2001. Accepted for publication October 11, 2001.
| References |
|---|
|
|
|---|
inducing factor. J. Leukocyte Biol. 63:658.[Abstract]
production by T cells. Nature 378:88.[Medline]
-inducing factor) induces IL-8 and IL-1
via TNF
production from non-CD14+ human blood mononuclear cells. J. Clin. Invest. 101:711.[Medline]
induction by human poxvirus-encoded proteins. Proc. Natl. Acad. Sci. USA 96:11537.
and TNF-
production. Am. J. Physiol. 281:R1264.
production in lipopolysaccharide-stimulated human adherent blood mononuclear cells is inhibited by the nitric oxide synthase inhibitor N(G)-monomethyl-L-arginine. J. Immunol. 159:5063.[Abstract]
, interleukin-1
, and IL-6 by morphologically normal intestinal biopsies from patients with Crohns disease. Gut 39:684.
mediates gene expression of IL-18 binding protein in nonleukocytic cells. Biochem. Biophys. Res. Commun. 267:960.[Medline]
receptor-deficient mice. Eur. J. Immunol. 30:1486.[Medline]
receptor-deficient mice. Eur. J. Immunol. 28:2143.[Medline]
receptor-deficient mice. J. Immunol. 158:5507.[Abstract]
administration on the severity of experimental group B streptococcal arthritis. Arthritis Rheum. 43:2678.[Medline]
in rheumatoid arthritis. Rheumatol. Int. 12:175.[Medline]
-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell. Immunol. 173:230.[Medline]
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
-inducing factor/IL-18 administration mediates IFN-
- and IL-12-independent antitumor effects. J. Immunol. 160:1742.
. Int. J. Cancer 40:830.[Medline]
-dependent hepatic melanoma metastasis via vascular cell adhesion molecule-1. Proc. Natl. Acad. Sci. USA 97:734.
interferon by natural killer cells. Infect. Immun. 65:3594.[Abstract]
This article has been cited by other articles:
![]() |
T. Ohkusa, T. Yoshida, N. Sato, S. Watanabe, H. Tajiri, and I. Okayasu Commensal bacteria can enter colonic epithelial cells and induce proinflammatory cytokine secretion: a possible pathogenic mechanism of ulcerative colitis J. Med. Microbiol., May 1, 2009; 58(5): 535 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Fortin, T. Ear, and P. P. McDonald Autocrine role of endogenous interleukin-18 on inflammatory cytokine generation by human neutrophils FASEB J, January 1, 2009; 23(1): 194 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ishimaru, R. Arakaki, S. Yoshida, A. Yamada, S. Noji, and Y. Hayashi Expression of the retinoblastoma protein RbAp48 in exocrine glands leads to Sjogren's syndrome-like autoimmune exocrinopathy J. Exp. Med., November 24, 2008; 205(12): 2915 - 2927. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. P. Carroll, V. Paunovic, and M. Gadina Signalling, inflammation and arthritis: Crossed signals: the role of interleukin-15 and -18 in autoimmunity Rheumatology, September 1, 2008; 47(9): 1269 - 1277. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Platis, Q Yu, D Moore, E. Khojeini, P Tsau, and D. Larson The effect of daily administration of IL-18 on cardiac structure and function Perfusion, July 1, 2008; 23(4): 237 - 242. [Abstract] [PDF] |
||||
![]() |
N. Foster, K. Andreadou, L. Jamieson, P.M. Preshaw, and J.J. Taylor VIP Inhibits P. gingivalis LPS-induced IL-18 and IL-18BPa in Monocytes Journal of Dental Research, September 1, 2007; 86(9): 883 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ziesche, M. Bachmann, H. Kleinert, J. Pfeilschifter, and H. Muhl The Interleukin-22/STAT3 Pathway Potentiates Expression of Inducible Nitric-oxide Synthase in Human Colon Carcinoma Cells J. Biol. Chem., June 1, 2007; 282(22): 16006 - 16015. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bachmann, C. Dragoi, M. A. Poleganov, J. Pfeilschifter, and H. Muhl Interleukin-18 directly activates T-bet expression and function via p38 mitogen-activated protein kinase and nuclear factor-{kappa}B in acute myeloid leukemia-derived predendritic KG-1 cells Mol. Cancer Ther., February 1, 2007; 6(2): 723 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Robertson, J. W. Mier, T. Logan, M. Atkins, H. Koon, K. M. Koch, S. Kathman, L. N. Pandite, C. Oei, L. C. Kirby, et al. Clinical and biological effects of recombinant human interleukin-18 administered by intravenous infusion to patients with advanced cancer. Clin. Cancer Res., July 15, 2006; 12(14): 4265 - 4273. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A Dinarello Interleukin 1 and interleukin 18 as mediators of inflammation and the aging process Am. J. Clinical Nutrition, February 1, 2006; 83(2): 447S - 455S. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Klampfer, J. Huang, T. Sasazuki, S. Shirasawa, and L. Augenlicht Inhibition of Interferon {gamma} Signaling by the Short Chain Fatty Acid Butyrate Mol. Cancer Res., September 1, 2003; 1(11): 855 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Plitz, P. Saint-Mezard, M. Satho, S. Herren, C. Waltzinger, M. de Carvalho Bittencourt, M. H. Kosco-Vilbois, and Y. Chvatchko IL-18 Binding Protein Protects Against Contact Hypersensitivity J. Immunol., August 1, 2003; 171(3): 1164 - 1171. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Moller, J. Paulukat, M. Nold, M. Behrens, N. Kukoc-Zivojnov, J. P. Kaltwasser, J. Pfeilschifter, and H. Muhl Interferon-{gamma} induces expression of interleukin-18 binding protein in fibroblast-like synoviocytes Rheumatology, March 1, 2003; 42(3): 442 - 445. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Banda, A. Vondracek, D. Kraus, C. A. Dinarello, S.-H. Kim, A. Bendele, G. Senaldi, and W. P. Arend Mechanisms of Inhibition of Collagen-Induced Arthritis by Murine IL-18 Binding Protein J. Immunol., February 15, 2003; 170(4): 2100 - 2105. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Gracie, S. E. Robertson, and I. B. McInnes Interleukin-18 J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hurgin, D. Novick, and M. Rubinstein The promoter of IL-18 binding protein: Activation by an IFN-gamma -induced complex of IFN regulatory factor 1 and CCAAT/enhancer binding protein beta PNAS, December 24, 2002; 99(26): 16957 - 16962. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Corbaz, T. ten Hove, S. Herren, P. Graber, B. Schwartsburd, I. Belzer, J. Harrison, T. Plitz, M. H. Kosco-Vilbois, S.-H. Kim, et al. IL-18-Binding Protein Expression by Endothelial Cells and Macrophages Is Up-Regulated During Active Crohn's Disease J. Immunol., April 1, 2002; 168(7): 3608 - 3616. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |