The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paulukat, J.
Right arrow Articles by Mühl, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paulukat, J.
Right arrow Articles by Mühl, H.
The Journal of Immunology, 2001, 167: 7038-7043.
Copyright © 2001 by The American Association of Immunologists

Expression and Release of IL-18 Binding Protein in Response to IFN-{gamma}1

Jens Paulukat*, Markus Bosmann2,*, Marcel Nold2,*, Stefanie Garkisch*, Heiko Kämpfer*, Stefan Frank*, Jochen Raedle{dagger}, Stefan Zeuzem{dagger}, Josef Pfeilschifter* and Heiko Mühl3,*

* Pharmazentrum Frankfurt and {dagger} Second Department of Medicine, Klinikum der Johann Wolfgang Goethe-Universität, Frankfurt am Main, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-18 and IL-18 binding protein (IL-18BP) are two newly described opponents in the cytokine network. Local concentrations of these two players may determine biological functions of IL-18 in the context of inflammation, infection, and cancer. As IL-18 appears to be involved in the pathogenesis of Crohn’s disease and may modulate tumor growth, we investigated the IL-18/IL-18BPa system in the human colon carcinoma/epithelial cell line DLD-1. In this study, we report that IFN-{gamma} induces expression and release of IL-18BPa from DLD-1 cells. mRNA induction and secretion of IL-18BPa immunoreactivity were associated with an activity that significantly impaired release of IFN-{gamma} by IL-12/IL-18-stimulated PBMC. Inducibility of IL-18BPa by IFN-{gamma} was also observed in LoVo, Caco-2, and HCT116 human colon carcinoma cell lines and in the human keratinocyte cell line HaCaT. Induction of IL-18BPa in colon carcinoma/epithelial cell lines was suppressed by coincubation with sodium butyrate. IFN-{gamma}-mediated IL-18BPa and its suppression by sodium butyrate were confirmed in organ cultures of intestinal colonic biopsy specimens. In contrast, sodium butyrate did not modulate expression of IL-18. The present data suggest that IFN-{gamma} may limit biological functions of IL-18 at sites of colonic immune activation by inducing IL-18BPa production. Down-regulation of IL-18BPa by sodium butyrate suggests that reinforcement of local IL-18 activity may contribute to actions of this short-chain fatty acid in the colonic microenvironment.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-18 has been introduced as a novel member of the IL-1 family of cytokines. As opposed to IL-1, IL-18 appears to be a pivotal mediator of the Th1 cytokine response (1, 2, 3). However, both cytokines also share a variety of functions such as induction of inflammatory cytokines (4). Recent data imply that IL-18, in the absence of IL-12, may also facilitate the development of Th2 responses (5). Biological activities of IL-1 are controlled by endogenous inhibitory proteins such as IL-1R antagonist or the type II IL-1R (2). With the discovery of IL-18 binding proteins (IL-18BP)4 (6, 7, 8, 9), functional equivalents of soluble type II IL-1Rs have been identified for the IL-18 system. Of the isolated isoforms of human IL-18BP, IL-18BPa and IL-18BPc are able to neutralize IL-18 biological activity with high efficacy. IL-18BPa apparently is the most abundant splice variant in human cDNA libraries (6, 8). In mice, injection of human IL-18BPa inhibits LPS-induced circulating IFN-{gamma} by >90% (6). Serum levels of IL-18BP are up-regulated in patients with septic shock (10). The significance of IL-18BP in pathophysiology is further underscored by the observation that the poxvirus family of DNA viruses secretes active viral forms of IL-18BP besides soluble receptors for IL-1{beta}, IFNs, and certain chemokines (6, 11).

Colon epithelial cells have been identified as a potential source of IL-18, and expression of this cytokine is up-regulated in Crohn’s disease (12, 13). Interestingly, reduction of IL-18 bioactivity by neutralizing Abs is protective in murine experimental colitis (14). In addition, IL-18 appears to be modulated in colorectal cancer (15). In the present study, we investigated expression of IL-18BPa in the colon carcinoma/epithelial cell line DLD-1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

IFN-{gamma} and IL-18 were from PeproTech (Frankfurt, Germany). Brefeldin A (BFA), sodium butyrate, and actinomycin D were from Sigma (Deisenhofen, Germany). IL-12 was purchased from R&D Systems (Wiesbaden, Germany), and okadaic acid was from Calbiochem-Novabiochem (Bad Soden, Germany).

Cultivation of DLD-1, Caco-2, LoVo, HCT116, and HaCaT cells

Human DLD-1 (Center for Applied Microbiology and Research, Salisbury, U.K.), HCT116 (American Type Culture Collection, Manassas, VA), Caco-2 (German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany), colon carcinoma cells, and HaCaT keratinocytes (provided by N. E. Fusenig, Deutsches Krebsforschungszentrum, Heidelberg, Germany) (16) were grown in DMEM supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% heat-inactivated FCS (Life Technologies, Eggenstein, Germany). LoVo (American Type Culture Collection) colon carcinoma cells were maintained in RPMI 1640 supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% heat-inactivated FCS (Life Technologies). For the experiments, cells on polystyrene plates (Greiner, Frickenhausen, Germany) were washed twice with PBS and incubated in the aforementioned DMEM medium without FCS. Cell viability was determined by a lactate dehydrogenase (LDH) activity assay, according to the manufacturer’s instructions (Roche Molecular Biochemicals, Mannheim, Germany). All cultures were incubated for the indicated time periods at 37°C in a humidified atmosphere containing 5% CO2.

Isolation and cultivation of PBMC

The study protocol and consent documents were approved by the Ethik Kommission of the Klinikum der Johann Wolfgang Goethe-Universität (Frankfurt am Main, Germany). Informed consent was obtained from volunteers. Healthy donors abstained from using any drugs during the 2 wk before the study. PBMC were isolated as previously described (17). PBMC were resuspended in conditioned media from DLD-1 cell cultures supplemented with 1% (v/v) heat-inactivated human AB serum (Sigma) and seeded at 2 x 106 cells/ml in round-bottom polypropylene tubes (Greiner).

IFN-{gamma} production by IL-12/IL-18-stimulated PBMC cultivated in DLD-1 cell-derived conditioned media

To investigate whether conditioned medium from IFN-{gamma}-stimulated DLD-1 cells may contain IL-18BPa activity, the following experimental protocol was performed: DLD-1 cells were kept as unstimulated control, or were stimulated with IFN-{gamma} (20 ng/ml), with sodium butyrate alone (5 mM), or with IFN-{gamma} plus sodium butyrate for 14 h using DMEM medium (containing 10% FCS) to induce expression of IL-18BPa. Thereafter, cultures were thoroughly washed three times with PBS. After an additional 48-h incubation period in control DMEM without FCS, cells were lysed for isolation of total RNA (see also scheme of experimental design in Fig. 6GoA). Cell-free culture supernatants were either TCA precipitated (for SDS-PAGE) or concentrated 5-fold using Ultrafree-4 Biomax 10K centrifugal filters (Millipore, Bedford, MA). Concentrated conditioned media were preincubated for 30 min without stimuli or with IL-12 (20 ng/ml)/IL-18 (20 ng/ml) at 37°C. PBMC were then resuspended in these conditioned media and, after an additional 24 h of incubation, IFN-{gamma} production was assessed by ELISA.



View larger version (71K):
[in this window]
[in a new window]
 
FIGURE 6. Induction of IL-18BPa by IFN-{gamma} in cultures of colonic biopsy specimens: modulation by sodium butyrate. Cultures of colonic biopsy specimens from five different donors were kept as unstimulated control, or stimulated with IFN-{gamma} (40 ng/ml) alone, or in combination with sodium butyrate (10 mM) for different time periods (8, 16, and 22 h). Thereafter, IL-18BPa and IL-18 mRNA expression was evaluated by RT-PCR. No differences dependent on the duration of stimulation (8-, 16-, and 22-h incubation) were observed. One representative experiment is shown (8-h stimulation).

 
Cultures of colonic intestinal biopsy specimens

The study protocol and consent documents were approved by the Ethik Kommission of the Klinikum der Johann Wolfgang Goethe-Universität. Informed consent was obtained from the donors. All patients required a colonoscopy for medical reasons. For the experiments, a macroscopically nondiseased biopsy site was chosen. Cultivation was performed as recently described (18). Within a maximal lag of 0.5 h after biopsy, specimens were washed carefully in PBS (Life Technologies). Thereafter, tissues were placed in 24-well tissue culture plates (Greiner) and maintained in DMEM without phenol red (Life Technologies; 1 ml/well) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin (Life Technologies), and 1% (v/v) heat-inactivated human AB serum (Sigma). Stimuli were added and, after the indicated incubation periods, cells were harvested for RNA isolation.

Analysis of mRNA for IL-18BPa, IL-18, and GAPDH

Total RNA was isolated using TRIzol reagent according to the manufacturer’s instructions (Life Technologies). One microgram of RNA was used for RT-PCR (GeneAmp RNA PCR kit, Amplitaq Gold; Perkin-Elmer, Weiterstadt, Germany), as described previously (19). Primers: IL-18BPa (forward), cctctactggctgggcaatgg; IL-18BPa (reverse), ttaaccctgctgctgtggac (annealing temperature, 58°C; number of cycles, 31); IL-18 (forward), accaagttctcttcattgacc; IL-18 (reverse), ttgcatcttattatcatgtcc (annealing temperature, 58°C; number of cycles, 30); GAPDH (forward), accacagtccatgccatcac; GAPDH (reverse), tccaccaccctgttgctgta (annealing temperature, 60°C; number of cycles, 23 for DLD-1, 28 for organ cultures). Identity of PCR products (length: 295 bp for IL-18BPa; 293 bp for IL-18; 452 bp for GAPDH) was confirmed by sequencing (310 Genetic Analyzer; Perkin-Elmer). RNase protection assay was performed as previously described: 20 µg total RNA was used. Human IL-18, IL-18BPa, and GAPDH probes were cloned by PCR. The cloned fragments correspond to nt 335–627 for IL-18, 457–644 for IL-18BPa, and 148–302 for GAPDH (19, 20).

Detection of IL-18BPa and IL-18 by immunoblotting

Cell-free supernatants (5 ml/PS-10 plate) were TCA precipitated, as previously described (20). Briefly, 1/10 vol of TCA was added to cell-free supernatants. After 30 min at 0°C and a 30-min centrifugation step at 13,000 x g, pellets were washed in acetone and resuspended in Laemmli buffer. Unless otherwise indicated, TCA-precipitated proteins from 3.5 ml were separated by 10% SDS-PAGE. After blotting, IL-18BPa was detected by a rabbit polyclonal antiserum (immunizing peptide, TQEALPSSHSSPQQQG; Eurogentec, Seraing, Belgium). For detection of intracellular IL-18 and IL-18BPa, cells were lysed in 300 mM NaCl, 50 mM TrisCl, pH 7.6, and 0.5% Triton X-100, supplemented with protease inhibitor mixture (Roche Molecular Biochemicals). Protein (40 µg) and a 12% SDS-PAGE were used for analysis of IL-18 using rabbit polyclonal Abs (PeproTech). A total of 100 µg protein was used for analysis of IL-18BPa.

Transient expression of human IL-18BPa in DLD-1 cells

DLD-1 cells cultivated on six-well plates in DMEM medium containing 10% FCS were transiently transfected with pORF-hil18bpa (InvivoGen, San Diego, CA) using Fugene (Roche Diagnostics, Mannheim, Germany), according to the manufacturer’s instructions. A total of 3 µl Fugene and 2.25 µg DNA was used per well. After 30 h, cells were washed with PBS and incubated for 30 h in DMEM without FCS (2 ml/well). Supernatants (6 ml) were TCA precipitated and used in Fig. 2GoA.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 2. IL-18BPa immunoreactivity as detected using the polyclonal antiserum. A, DLD-1 cells were transiently transfected with pORF-hil18bpa. TCA-precipitated supernatants of IFN-{gamma}-stimulated (20 ng/ml) cells were run in parallel. B, DLD-1 cells were stimulated with IFN-{gamma} (50 ng/ml) for the indicated time periods. TCA-precipitated supernatants were analyzed by immunoblotting. Arrows indicate IL-18BPa immunoreactivity (lane 2). C, DLD-1 cells were kept as controls or stimulated with IFN-{gamma} (20 ng/ml) for 24 h. TCA-precipitated supernatants were analyzed by immunoblotting. One-half of the blot was stained with IL-18BPa antiserum, the other with IL-18BPa antiserum plus immunizing peptide (2.5 µg/ml). D, DLD-1 cells were kept as controls, stimulated with IFN-{gamma} (20 ng/ml), or with IFN-{gamma} (20 ng/ml), which had been inactivated by boiling. After 42 h, TCA-precipitated supernatants were analyzed by immunoblotting. E, DLD-1 cells were kept as controls, stimulated with IFN-{gamma} (20 ng/ml) alone, with BFA (1 µg/ml), or with IFN-{gamma} (20 ng/ml)/BFA (1 µg/ml). After 24 h, TCA-precipitated supernatants were analyzed by immunoblotting. Similar results were obtained using BFA at 0.25 µg/ml (data not shown). F, DLD-1 cells were kept as controls or stimulated with IFN-{gamma} (20 ng/ml) for 24 h. TCA-precipitated supernatant proteins and whole cell lysates were prepared and analyzed by immunoblotting. G, DLD-1 cells were kept as controls, stimulated with IFN-{gamma} (20 ng/ml), or exposed to okadaic acid (50 nM) for 68 h. TCA-precipitated supernatants were analyzed by immunoblotting. Cell viability was determined in these same experiments by LDH activity analysis.

 
Detection of cytokines by ELISA

Levels of IFN-{gamma} in cell-free culture supernatants of PBMC cultures were determined by ELISA according to the manufacturer’s instructions (BD PharMingen, Heidelberg, Germany).

Statistical analysis

Data are shown as mean ± SD (experiments using DLD-1 cells), or mean ± SEM (experiments using PBMC), and are presented as percentage of viability, as percentage of inhibition, or as picograms per milliliter. Data were analyzed by unpaired Student’s t test on raw data using Sigma Plot (Jandel Scientific, San Rafael, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN-{gamma} induces expression and release of IL-18BPa in the colon carcinoma cell lines DLD-1 and Caco-2, as well as in HaCaT keratinocytes

We recently reported on induction of IL-18BPa gene expression by IFN-{gamma} in human nonleukocytic cells (19). In the present study, we focused on the colon carcinoma/epithelial cell line DLD-1 and sought to extend the abovementioned observations by including the level of IL-18BPa protein release and function. IFN-{gamma}-induced IL-18BPa mRNA (Fig. 1GoA, lower panel) was paralleled by secretion of the corresponding protein, as detected by immunoblotting analysis of TCA-precipitated cell culture supernatants (Fig. 1Go, A and B). IL-18BPa appeared as IFN-{gamma}-inducible immunoreactivity in the expected molecular mass range between 40 and 50 kDa (6, 8). This heterogeneity in the molecular mass agrees with a high degree of glycosylation, as has been reported (6). Strong immunoreactivity was observed when human IL-18BPa was transiently expressed in DLD-1 cells (Fig. 2GoA). In contrast, control transfection with empty vector did not result in any immunoreactivity (data not shown). IL-18BPa immunoreactivity induced by IFN-{gamma} consisted of two major bands. This was particularly evident when lower amounts of proteins were separated on a 12% SDS-PAGE (Figs. 1GoA and 2B, lane 2). The doublet was also observed when lower amounts of IL-18BPa transiently expressed in DLD-1 cells were subjected to SDS-PAGE (data not shown). Addition of immunizing peptide to the antiserum impaired immunodetection of IL-18BPa (Fig. 2GoC). No immunoreactivity was detectable when preimmune serum was used (data not shown). To exclude that effects of IFN-{gamma} were due to endotoxin that is heat stable, IFN-{gamma} was heat inactivated by boiling (99°C, 30 min) before use. Immunoreactivity disappeared after heat inactivation of IFN-{gamma} (Fig. 2GoD). In addition, LPS (10 µg/ml) did not induce IL-18BPa in DLD-1 cells (data not shown). IL-18BP is synthesized with a 28-residue signal peptide, and is supposed to be secreted via the endoplasmatic/Golgi pathway (6). Accordingly, BFA abrogated release of IL-18BPa (Fig. 2GoE). However, despite readily detectable immunoreactivity of IL-18BPa in supernatants of IFN-{gamma}-treated cells, we could not demonstrate intracellular IL-18BPa by immunoblotting when whole cell lysates were analyzed from IFN-{gamma}-treated cells (Fig. 2GoF) or from cells treated with IFN-{gamma}/BFA (data not shown). This discrepancy between cell lysates and TCA-precipitated supernatants is likely to be due to the huge enrichment factor immanent to the method of TCA precipitation.



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 1. Time course and dose-response analysis of IFN-{gamma}-induced IL-18BPa. A, DLD-1 cells were kept as controls or stimulated with IFN-{gamma} (20 ng/ml) for the indicated time periods. TCA-precipitated supernatants were analyzed by immunoblotting. Lower panel, IL-18BPa mRNA was evaluated by RT-PCR in these same experiments. One representative of four independently performed experiments is shown. B, DLD-1 cells were kept as controls or stimulated for 24 h with the indicated concentrations of IFN-{gamma}. TCA-precipitated supernatants were analyzed by immunoblotting. Membranes were stained by Ponceau S (A and B).

 
There was no induction of cytotoxicity in IFN-{gamma}-treated cultures as examined by determination of LDH activity in culture supernatants: viability was 98.3 ± 0.4% vs 97.5 ± 0.4% for control vs IFN-{gamma}-treated cells (20 ng/ml, 42 h, n = 3). Ponceau S staining of membranes after blotting revealed no differences in the total amounts of proteins loaded onto the gels (Fig. 1Go, A and B). Moreover, induction of cell death by okadaic acid did not result in release of immunoreactivity, despite a 36.7% loss of cell viability (Fig. 2GoG). Altogether, these observations argue against IFN-{gamma}-induced cytotoxicity, with passive release of cellular proteins as the driving force behind IL-18BPa immunoreactivity in TCA-precipitated supernatants.

To investigate whether IFN-{gamma}-induced secretion of IL-18BPa is restricted to DLD-1 cells or is of more general relevance, experiments were performed using additional colon carcinoma/epithelial cell lines. As shown in Fig. 3Go, IFN-{gamma}-induced IL-18BPa mRNA accumulation (A and B, left panel) was associated with secreted IL-18BPa immunoreactivity (A and B, right panel) in the respective culture supernatants of LoVo (A) and Caco-2 (B) colon carcinoma cells. Similar data were obtained using HCT116 colon carcinoma cells (data not shown). We also investigated the keratinocyte cell line HaCaT (Fig. 3GoC). Induction of IL-18BPa mRNA (Fig. 3GoC, left panel) was paralleled by appearance of IL-18BPa in IFN-{gamma}-conditioned culture supernatants (Fig. 3GoC, right panel).



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 3. IFN-{gamma}-induced IL-18BPa in LoVo and Caco-2 colon carcinoma cells, as well as in HaCaT keratinocytes. LoVo cells (A), Caco-2 cells (B), or HaCaT keratinocytes (C) were kept as unstimulated controls or incubated with IFN-{gamma} (20 ng/ml). After 24 h, IL-18BPa mRNA was evaluated by RT-PCR (left panel), and TCA-precipitated supernatants were analyzed by immunoblotting (right panel). One representative of two independently performed experiments is shown for each cell line.

 
Sodium butyrate inhibits IFN-{gamma}-induced IL-18BPa in colon carcinoma cell lines

Butyrate is a short-chain fatty acid that is produced by intestinal bacteria and is supposed to be an important regulator of colonic epithelial cell biology (21). Sodium butyrate (B) at 5 mM efficiently suppressed IFN-{gamma}-induced IL-18BPa protein release as well as mRNA induction (Fig. 4Go, A and B). It is important to take into account that peak concentrations of butyrate in the colon can reach 20 mM (21). Sodium butyrate alone did not change background expression of IL-18BPa. Biological activity of IL-18 is supposed to be determined by local concentrations of IL-18 vs IL-18BP. Therefore, we determined the effect of sodium butyrate on expression of IL-18 in these same experiments. Notably, sodium butyrate (5 mM) did not change IL-18 expression in DLD-1 cells exposed to IFN-{gamma} (Fig. 4GoC). Sodium butyrate is supposed to trigger apoptosis in colon carcinoma cells (21). Thus, cell viability was determined in these experiments. Sodium butyrate at 5 mM alone or in combination with IFN-{gamma} did not modulate cell viability in DLD-1 cells during a 24-h incubation period (Fig. 4GoD). In contrast, cell death was detectable when DLD-1 cells were incubated for 48 h with sodium butyrate at 25 mM. Again, cell death was not associated with appearance of IL-18BPa immunoreactivity in these supernatants. Inhibition of IFN-{gamma}-induced IL-18BPa expression by sodium butyrate was also observed in the colon carcinoma cell lines HCT116 (Fig. 4GoE), LoVo, and Caco-2 (data not shown).



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 4. Sodium butyrate suppresses IFN-{gamma}-induced IL-18BPa expression, but not expression of IL-18. DLD-1 cells were kept as controls, stimulated with sodium butyrate (B) (5 mM), with IFN-{gamma} (20 ng/ml), or with IFN-{gamma} (20 ng/ml) plus the indicated concentrations of sodium butyrate. After 24 h, TCA-precipitated supernatants were analyzed by immunoblotting (A), and IL-18BPa mRNA was evaluated by RNase protection assay (B). One representative of three independently performed experiments is shown. C, DLD-1 cells were kept as control, stimulated with IFN-{gamma} (20 ng/ml), with sodium butyrate (5 mM), or with IFN-{gamma} (20 ng/ml)/sodium butyrate (5 mM). After 24 h, cell lysates were analyzed for IL-18 by immunoblotting. IL-18 mRNA expression was evaluated by RNase protection assay. One representative of three independently performed experiments is shown. D, In these experiments, viability was determined by LDH activity analysis. Percentage of viability ± SD is shown (n = 3). E, HCT116 colon carcinoma cells were kept as unstimulated control, or stimulated with IFN-{gamma} (20 ng/ml), with sodium butyrate (5 mM), or with the combination IFN-{gamma} plus sodium butyrate. After 24 h, IL-18BPa mRNA expression was evaluated by RT-PCR. One representative of two independently performed experiments is shown.

 
IFN-{gamma}-stimulated DLD-1 cells release an activity that impairs IFN-{gamma} production by IL-12/IL-18-stimulated PBMC

As shown in Fig. 5GoA, compared with conditioned media obtained from unstimulated cells, conditioned media from IFN-{gamma}-stimulated DLD-1 cells impaired production of IFN-{gamma} in PBMC exposed to IL-12/IL-18. To confirm that IL-18BPa is actually detectable in these conditioned media, immunoblot analysis was performed. As shown in Fig. 5GoB, a 14-h stimulation with IFN-{gamma} was sufficient to trigger detectable release of IL-18BPa during an additional 48-h incubation period in control medium. Notably, in these DLD-1 cells, augmented levels of IL-18BPa mRNA were still detectable after this 48-h incubation in control medium. This is consistent with a long t1/2 (>8 h) of IFN-{gamma}-induced IL-18BPa mRNA in DLD-1 cells, as detected in actinomycin D experiments (data not shown). We also investigated effects of sodium butyrate using this experimental protocol. However, conditioned media from DLD-1 cells stimulated with sodium butyrate alone significantly reduced later IFN-{gamma} production of IL-12/IL-18-activated PBMC by 60.1 ± 12.4% (n = 3, p < 0.05). This indirect inhibitory effect of sodium butyrate interfered with efficient recovery of IL-12/IL-18-induced IFN-{gamma} in PBMC by use of conditioned media from DLD-1 cells exposed to the combination IFN-{gamma} plus sodium butyrate (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 5. IFN-{gamma}-stimulated DLD-1 cells release an activity that impairs IFN-{gamma} production by IL-12/IL-18-stimulated PBMC. A, Control-conditioned and IFN-{gamma}-conditioned media from DLD-1 cell cultures (generated as outlined in Materials and Methods; see also scheme of experimental design in A) were used to resuspend control PBMC and IL-12 (20 ng/ml)/IL-18 (20 ng/ml)-stimulated PBMC, respectively. After a 24-h incubation period, IFN-{gamma} production was determined by ELISA. Data are mean ± SEM (n = 3); **, p < 0.01 vs use of conditioned media from IFN-{gamma}-treated DLD-1 cells. B, Control-conditioned and IFN-{gamma}-conditioned media from DLD-1 cell cultures (generated as outlined in Materials and Methods) were TCA precipitated and analyzed for IL-18BPa expression by immunoblotting. IL-18BPa mRNA of this same experiment was evaluated by RT-PCR analysis.

 
IFN-{gamma} mediates gene expression of IL-18BPa in organ cultures of colonic intestinal biopsy specimens

Colonic intestinal biopsy specimens obtained from five different donors were cultivated as unstimulated control, or exposed to either IFN-{gamma} alone, or the combination IFN-{gamma}/sodium butyrate. Up-regulation of IL-18BPa mRNA by IFN-{gamma} was observed after an 8-h incubation period (Fig. 6Go). Transcripts sustained elevated for at least another 15 h of stimulation (data not shown). In accordance with data obtained using colon carcinoma cell lines, sodium butyrate suppressed IFN-{gamma}-induced IL-18BPa expression in all organ culture experiments performed (n = 5). In contrast, expression of IL-18 mRNA in these same IFN-{gamma}-treated organ cultures was not modulated by coincubation with sodium butyrate (Fig. 6Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we demonstrate that IL-18BPa is released by IFN-{gamma}-activated DLD-1 colon carcinoma/epithelial cells. IFN-{gamma} induction of IL-18BPa was not restricted to DLD-1 cells, but was confirmed using LoVo, Caco-2, and HCT116 colon carcinoma cells, as well as HaCaT keratinocytes. Secretion of IL-18BPa immunoreactivity coincided with induction of IL-18BPa mRNA and with appearance of an activity associated with IFN-{gamma}-treated DLD-1 cells that was able to impair IL-12/IL-18-induced IFN-{gamma} in PBMC. Gene induction of IL-18BPa by IFN-{gamma} was also observed in cultures of colonic biopsy specimens. These latter results demonstrate up-regulation of IL-18BPa gene expression in an ex vivo setting, and underscore the potential significance of the data obtained using colon carcinoma/epithelial cell lines. The present data are consistent with work by Fantuzzi et al. (22) demonstrating reduced expression of IL-18BP in IFN regulatory factor-1-deficient mice. These observations may have important implications for the action of IFN-{gamma} and IL-18 under pathophysiological conditions. By inducing IL-18BP, IFN-{gamma} appears to trigger a negative feedback loop that limits IFN-{gamma}-dependent and IFN-{gamma}-independent actions of IL-18. Accordingly, overproduction of IFN-{gamma} has been observed in IFN-{gamma} receptor-deficient mice used in models of hapten-induced colitis (23) and collagen-induced arthritis (24). The present data are compatible with data on IL-18BP expression in graft vs host disease, in which production of IL-18BP increases in parallel with IFN-{gamma} (25). Moreover, in adult Still’s disease, serum levels of IL-18 correlate with the presence of an inhibitory activity that impairs binding of IL-18 to its membrane receptor (26). Up-regulation of IL-18BP might also be involved in the diminished capability of IFN-{gamma} production in ex vivo whole blood cultures obtained from patients with septic shock (27). In fact, Novick et al. (10) recently demonstrated augmented serum levels of IL-18BP in septic shock patients. Therapeutic use of IL-18BPa may restore a hypothetically disturbed IL-18/IL-18BP balance in diseases that are associated with augmented production of Th1 cytokines, such as Crohn’s disease. In addition, induction of IL-18BP may contribute to protective functions of IFN-{gamma}, as seen in murine models for rheumatoid and septic arthritis (28, 29), and in rheumatoid arthritis patients (30).

Evidence suggests that IL-18 is an inhibitor of tumor growth. In this context, suppression of a proposed IL-18BP activity should be beneficial. IL-18 acts as inhibitor of angiogenesis (31) and augments Fas/Fas ligand-dependent CD4+ T cell and NK cell cytotoxicity (32, 33, 34). Previous reports demonstrate that butyrate can protect against the development of colon cancer (21). The present data imply that intestinal butyrate may have the capability to strengthen the bioactivity of IL-18 at the colonic microenvironment by modulating IL-18BPa expression. Taking into account the antitumor functions of IL-18, this is in accordance with the tumor-suppressive potential of butyrate. Actually, sodium butyrate augments the sensitivity of colon carcinoma cells toward Fas-mediated apoptosis (35), and Fas-related CD4+ T cell and NK cell cytotoxicity is characteristically enhanced by IL-18 (32, 33, 34). Although IFN-{gamma} should contribute to tumor-suppressive actions of IL-18 in vivo, antitumor functions of IL-18 have been observed in an IFN-{gamma}-independent manner (31, 32, 34). It is noteworthy that under defined conditions, IFN-{gamma} in fact appears to be capable of enhancing growth of colon carcinomas (36). Induction of IL-18BP by IFN-{gamma} might contribute to this observation. Altogether, sodium butyrate appears to shift the IL-18/IL-18BP balance in colon carcinoma cells in favor of IL-18, which may contribute to local tumor protection by this compound, most likely via IFN-{gamma}-independent tumor-suppressive actions of IL-18. However, IL-18 may also augment expression of genes that have been associated with cancer progression. For example, IL-18 can up-regulate hepatic melanoma metastasis via induction of VCAM-1 expression (37). In addition, IL-18 can mediate production of NO (38, 39), which has been shown to facilitate growth of certain tumors, among them melanoma (40) and colorectal cancer (41). The role of IL-18 in tumor biology might depend on the particular setting. Nonetheless, in addition to IL-18, regulation of its opponent IL-18BP could prove to be a further parameter that determines tumor growth.


    Footnotes
 
1 This work was supported by the Riese-Stiftung and the Klein-Stiftung. Back

2 M.B. and M.N. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Heiko Mühl, Pharmazentrum Frankfurt, Klinikum der Johann Wolfgang Goethe-Universität Frankfurt am Main, Theodor-Stern-Kai 7, D-60590 Frankfurt am Main, Germany. E-mail address: H. Muehl{at}em.uni-frankfurt.de Back

4 Abbreviations used in this paper: IL-18BP, IL-18 binding protein; BFA, brefeldin A; LDH, lactate dehydrogenase. Back

Received for publication July 19, 2001. Accepted for publication October 11, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dinarello, C. A., D. Novick, A. J. Puren, G. Fantuzzi, L. Shapiro, H. Mühl, D. Y. Yoon, L. L. Reznikov, S. H. Kim, M. Rubinstein. 1998. Overview of interleukin-18: more than an interferon-{gamma} inducing factor. J. Leukocyte Biol. 63:658.[Abstract]
  2. Dinarello, C. A.. 1996. Biological basis for interleukin-1 in disease. Blood 87:2095.[Abstract/Free Full Text]
  3. Okamura, H., H. Tsutsi, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN-{gamma} production by T cells. Nature 378:88.[Medline]
  4. Puren, A. J., G. Fantuzzi, Y. Gu, M. S. Su, C. A. Dinarello. 1998. Interleukin-18 (IFN{gamma}-inducing factor) induces IL-8 and IL-1{beta} via TNF{alpha} production from non-CD14+ human blood mononuclear cells. J. Clin. Invest. 101:711.[Medline]
  5. Nakanishi, K., T. Yoshimoto, H. Tsutsui, H. Okamura. 2001. Interleukin-18 is a unique cytokine that stimulates both Th1 and Th2 responses depending on its cytokine milieu. Cytokine Growth Factor Rev. 12:53.[Medline]
  6. Novick, D., S. H. Kim, G. Fantuzzi, L. L. Reznikov, C. A. Dinarello, M. Rubinstein. 1999. Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity 10:127.[Medline]
  7. Aizawa, Y., K. Akita, M. Taniai, K. Torigoe, T. Mori, Y. Nishida, S. Ushio, Y. Nukada, T. Tanimoto, H. Ikegami, et al 1999. Cloning and expression of interleukin-18 binding protein. FEBS Lett. 445:338.[Medline]
  8. Kim, S. H., M. Eisenstein, L. Reznikov, G. Fantuzzi, D. Novick, M. Rubinstein, C. A. Dinarello. 2000. Structural requirements of six naturally occurring isoforms of the IL-18 binding protein to inhibit IL-18. Proc. Natl. Acad. Sci. USA 97:1190.[Abstract/Free Full Text]
  9. Dinarello, C. A.. 2000. Targeting interleukin 18 with interleukin 18 binding protein. Ann. Rheum. Dis. 59:(Suppl. 1):i17.[Abstract/Free Full Text]
  10. Novick, D., B. Schwartsburd, R. Pinkus, D. Suissa, I. Belzer, Z. Sthoeger, W. F. Keane, Y. Chvatchko, S. H. Kim, G. Fantuzzi, et al 2001. A novel IL-18bp ELISA shows elevated serum IL-18bp in sepsis and extensive decrease of free IL-18. Cytokine 14:334.[Medline]
  11. Xiang, Y., B. Moss. 1999. IL-18 binding and inhibition of interferon {gamma} induction by human poxvirus-encoded proteins. Proc. Natl. Acad. Sci. USA 96:11537.[Abstract/Free Full Text]
  12. Takeuchi, M., T. Okura, T. Mori, K. Akita, T. Ohta, M. Ikeda, H. Ikegami, M. Kurimoto. 1999. Intracellular production of interleukin-18 in human epithelial-like cell lines is enhanced by hyperosmotic stress in vitro. Cell Tissue Res. 297:467.[Medline]
  13. Pizarro, T. T., M. H. Michie, M. Bentz, J. Woraratanadharm, Jr M. F. Smith, E. Foley, C. A. Moskaluk, S. J. Bickston, F. Cominelli. 1999. IL-18, a novel immunoregulatory cytokine, is up-regulated in Crohn’s disease: expression and localization in intestinal mucosal cells. J. Immunol. 162:6829.[Abstract/Free Full Text]
  14. Siegmund, B., G. Fantuzzi, F. Rieder, F. Gamboni-Robertson, H. A. Lehr, G. Hartmann, C. A. Dinarello, S. Endres, A. Eigler. 2001. Neutralization of interleukin-18 reduces severity in murine colitis and intestinal IFN-{gamma} and TNF-{alpha} production. Am. J. Physiol. 281:R1264.[Abstract/Free Full Text]
  15. Pages, F., A. Berger, B. Henglein, B. Piqueras, C. Danel, F. Zinzindohoue, N. Thiounn, P. H. Cugnenc, W. H. Fridman. 1999. Modulation of interleukin-18 expression in human colon carcinoma: consequences for tumor immune surveillance. Int. J. Cancer 84:326.[Medline]
  16. Boukamp, P., R. T. Petrussevska, D. Breitkreutz, J. Hornung, A. Markham, N. E. Fusenig. 1988. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 106:761.[Abstract/Free Full Text]
  17. Mühl, H., C. A. Dinarello. 1997. Macrophage inflammatory protein-1{alpha} production in lipopolysaccharide-stimulated human adherent blood mononuclear cells is inhibited by the nitric oxide synthase inhibitor N(G)-monomethyl-L-arginine. J. Immunol. 159:5063.[Abstract]
  18. Reimund, J. M., C. Wittersheim, S. Dumont, C. D. Muller, J. S. Kenney, R. Baumann, P. Poidron, B. Duclos. 1996. Increased production of tumor necrosis factor-{alpha}, interleukin-1{beta}, and IL-6 by morphologically normal intestinal biopsies from patients with Crohn’s disease. Gut 39:684.[Abstract/Free Full Text]
  19. Mühl, H., H. Kämpfer, M. Bosmann, S. Frank, H. Radeke, J. Pfeilschifter. 2000. Interferon-{gamma} mediates gene expression of IL-18 binding protein in nonleukocytic cells. Biochem. Biophys. Res. Commun. 267:960.[Medline]
  20. Kämpfer, H., H. Mühl, M. Manderscheid, U. Kalina, D. Kauschat, J. Pfeilschifter, S. Frank. 2000. Regulation of IL-18 expression in keratinocytes (HaCaT): implications for early wound healing. Eur. Cytokine Network 114:626.
  21. Wächtershauser, A., J. Stein. 2000. Rationale for the luminal provision of butyrate in intestinal diseases. Eur. J. Nutr. 39:164.[Medline]
  22. Fantuzzi, G., D. A. Reed, M. Qi, S. Scully, C. A. Dinarello, G. Senaldi. 2001. Role of interferon regulatory factor-1 in the regulation of IL-18 production and activity. Eur. J. Immunol. 31:369.[Medline]
  23. Camoglio, L., A. A. te Velde, A. de Boer, F. J. ten Kate, M. Kopf, S. J. van Deventer. 2000. Hapten-induced colitis associated with maintained Th1 and inflammatory responses in IFN-{gamma} receptor-deficient mice. Eur. J. Immunol. 30:1486.[Medline]
  24. Matthys, P., K. Vermeire, T. Mitera, H. Heremans, S. Huang, A. Billiau. 1998. Anti-IL-12 antibody prevents the development and progression of collagen-induced arthritis in IFN-{gamma} receptor-deficient mice. Eur. J. Immunol. 28:2143.[Medline]
  25. Nagler, A., D. Novick, G. Zecchina, S. Slavin, C. A. Dinarello, V. Barak. 2000. Interleukin-18 and interleukin-18 binding protein and acute graft versus host disease. Exp. Hematol. 28:72.
  26. Kawashima, M., M. Yamamura, M. Taniai, H. Yamauchi, T. Tanimoto, M. Kurimoto, S. Miyawaki, T. Amano, T. Takeuchi, H. Makino. 2001. Levels of interleukin-18 and its binding inhibitors in the blood circulation of patients with adult-onset Still’s disease. Arthritis Rheum. 44:550.[Medline]
  27. Oberholzer, A., L. Harter, A. Feilner, U. Steckholzer, O. Trentz, W. Ertel. 2000. Differential effect of caspase inhibition on proinflammatory cytokine release in septic patients. Shock 14:253.[Medline]
  28. Vermeire, K., H. Heremans, M. Vandeputte, S. Huang, A. Billiau, P. Matthys. 1997. Accelerated collagen-induced arthritis in IFN-{gamma} receptor-deficient mice. J. Immunol. 158:5507.[Abstract]
  29. Puliti, M., C. von Hunolstein, F. Bistoni, P. Mosci, G. Orefici, L. Tissi. 2000. Influence of interferon-{gamma} administration on the severity of experimental group B streptococcal arthritis. Arthritis Rheum. 43:2678.[Medline]
  30. German Lymphokine Study Group. 1992. Double blind controlled phase III multicenter clinical trial with interferon-{gamma} in rheumatoid arthritis. Rheumatol. Int. 12:175.[Medline]
  31. Cao, R., J. Farnebo, M. Kurimoto, Y. Cao. 1999. Interleukin-18 acts as an angiogenesis and tumor suppressor. FASEB J. 13:2195.[Abstract/Free Full Text]
  32. Dao, T., K. Ohashi, T. Kayano, M. Kurimoto, H. Okamura. 1996. Interferon-{gamma}-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell. Immunol. 173:230.[Medline]
  33. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, K. Kaneda. 1996. IFN{gamma}-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
  34. Osaki, T., J. M. Peron, Q. Cai, H. Okamura, P. D. Robbins, M. Kurimoto, M. T. Lotze, H. Tahara. 1998. IFN{gamma}-inducing factor/IL-18 administration mediates IFN-{gamma}- and IL-12-independent antitumor effects. J. Immunol. 160:1742.[Abstract/Free Full Text]
  35. Bonnotte, B., N. Favre, S. Reveneau, O. Micheau, N. Droin, C. Garrido, A. Fontana, B. Chauffert, E. Solary, F. Martin. 1998. Cancer cell sensitization to fas-mediated apoptosis by sodium butyrate. Cell Death Differ. 5:480.[Medline]
  36. Ramani, P., F. R. Balkwill. 1987. Enhanced metastasis of a mouse carcinoma after in vitro treatment with murine interferon-{gamma}. Int. J. Cancer 40:830.[Medline]
  37. Vidal-Vanaclocha, F., G. Fantuzzi, L. Mendoza, A. M. Fuentes, M. J. Anasagasti, J. Martin, T. Carrascal, P. Walsh, L. L. Reznikov, S. H. Kim, et al 2000. IL-18 regulates IL-1{beta}-dependent hepatic melanoma metastasis via vascular cell adhesion molecule-1. Proc. Natl. Acad. Sci. USA 97:734.[Abstract/Free Full Text]
  38. Zhang, T., K. Kawakami, M. H. Qureshi, H. Okamura, M. Kurimoto, A. Saito. 1997. Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of {gamma} interferon by natural killer cells. Infect. Immun. 65:3594.[Abstract]
  39. Olee, T., S. Hashimoto, J. Quach, M. Lotz. 1999. IL-18 is produced by articular chondrocytes and induces proinflammatory and catabolic responses. J. Immunol. 162:1096.[Abstract/Free Full Text]
  40. Ekmekcioglu, S., J. Ellerhorst, C. M. Smid, V. G. Prieto, M. Munsell, A. C. Buzaid, E. A. Grimm. 2000. Inducible nitric oxide synthase and nitrotyrosine in human metastatic melanoma tumors correlate with poor survival. Clin. Cancer Res. 6:4768.[Abstract/Free Full Text]
  41. Ambs, S., W. G. Merriam, W. P. Bennett, E. Felley-Bosco, M. O. Ogunfusika, S. M. Oser, S. Klein, P. G. Shields, T. R. Billiar, C. C. Harris. 1998. Frequent nitric oxide synthase-2 expression in human colon adenomas: implication for tumor angiogenesis and colon cancer progression. Cancer Res. 58:334.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
H. P. Carroll, V. Paunovic, and M. Gadina
Signalling, inflammation and arthritis: Crossed signals: the role of interleukin-15 and -18 in autoimmunity
Rheumatology, September 1, 2008; 47(9): 1269 - 1277.
[Abstract] [Full Text] [PDF]


Home page
J. Dent. Res.Home page
N. Foster, K. Andreadou, L. Jamieson, P.M. Preshaw, and J.J. Taylor
VIP Inhibits P. gingivalis LPS-induced IL-18 and IL-18BPa in Monocytes
J. Dent. Res., September 1, 2007; 86(9): 883 - 887.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Ziesche, M. Bachmann, H. Kleinert, J. Pfeilschifter, and H. Muhl
The Interleukin-22/STAT3 Pathway Potentiates Expression of Inducible Nitric-oxide Synthase in Human Colon Carcinoma Cells
J. Biol. Chem., June 1, 2007; 282(22): 16006 - 16015.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Bachmann, C. Dragoi, M. A. Poleganov, J. Pfeilschifter, and H. Muhl
Interleukin-18 directly activates T-bet expression and function via p38 mitogen-activated protein kinase and nuclear factor-{kappa}B in acute myeloid leukemia-derived predendritic KG-1 cells
Mol. Cancer Ther., February 1, 2007; 6(2): 723 - 731.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. J. Robertson, J. W. Mier, T. Logan, M. Atkins, H. Koon, K. M. Koch, S. Kathman, L. N. Pandite, C. Oei, L. C. Kirby, et al.
Clinical and biological effects of recombinant human interleukin-18 administered by intravenous infusion to patients with advanced cancer.
Clin. Cancer Res., July 15, 2006; 12(14): 4265 - 4273.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
C. A Dinarello
Interleukin 1 and interleukin 18 as mediators of inflammation and the aging process
Am. J. Clinical Nutrition, February 1, 2006; 83(2): 447S - 455S.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
L. Klampfer, J. Huang, T. Sasazuki, S. Shirasawa, and L. Augenlicht
Inhibition of Interferon {gamma} Signaling by the Short Chain Fatty Acid Butyrate
Mol. Cancer Res., September 1, 2003; 1(11): 855 - 862.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Plitz, P. Saint-Mezard, M. Satho, S. Herren, C. Waltzinger, M. de Carvalho Bittencourt, M. H. Kosco-Vilbois, and Y. Chvatchko
IL-18 Binding Protein Protects Against Contact Hypersensitivity
J. Immunol., August 1, 2003; 171(3): 1164 - 1171.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
B. Moller, J. Paulukat, M. Nold, M. Behrens, N. Kukoc-Zivojnov, J. P. Kaltwasser, J. Pfeilschifter, and H. Muhl
Interferon-{gamma} induces expression of interleukin-18 binding protein in fibroblast-like synoviocytes
Rheumatology, March 1, 2003; 42(3): 442 - 445.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. K. Banda, A. Vondracek, D. Kraus, C. A. Dinarello, S.-H. Kim, A. Bendele, G. Senaldi, and W. P. Arend
Mechanisms of Inhibition of Collagen-Induced Arthritis by Murine IL-18 Binding Protein
J. Immunol., February 15, 2003; 170(4): 2100 - 2105.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. A. Gracie, S. E. Robertson, and I. B. McInnes
Interleukin-18
J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Hurgin, D. Novick, and M. Rubinstein
The promoter of IL-18 binding protein: Activation by an IFN-gamma -induced complex of IFN regulatory factor 1 and CCAAT/enhancer binding protein beta
PNAS, December 24, 2002; 99(26): 16957 - 16962.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Corbaz, T. ten Hove, S. Herren, P. Graber, B. Schwartsburd, I. Belzer, J. Harrison, T. Plitz, M. H. Kosco-Vilbois, S.-H. Kim, et al.
IL-18-Binding Protein Expression by Endothelial Cells and Macrophages Is Up-Regulated During Active Crohn's Disease
J. Immunol., April 1, 2002; 168(7): 3608 - 3616.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paulukat, J.
Right arrow Articles by Mühl, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow