|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037
| Abstract |
|---|
|
|
|---|
2%. DDJ intermediates were also observed,
but at a lower frequency. However, strikingly, no VDDJ rearrangements
were observed in newborn sequences, suggesting the process of assembly
of VDJ rearrangements is fundamentally different in newborn mice vs
adult mice. | Introduction |
|---|
|
|
|---|
In this study we tested an alternative hypothesis to explain the high frequency with which unusual CDR3 regions are created in MRL B cell precursors, namely that many of the putative D-D segments seen in VDJ rearrangements were actually due to a new D gene in the MRL strain of mice, because many of the D-D regions from newborn MRL mice have similar identical core sequences. This putative new gene bears resemblance to the 5' part of a DSP2 gene joined to the 3' part of a DSP2-type gene. It is present, at least in part, in six of the 11 "atypical" rearrangements from MRL mice described by Klonowski et al. (11). The consensus which is derived for this gene from those six sequences is ... . TACTATAGTTACTATAGTTACGAC, making it >24 bp long. Because all known DSP2 genes are very similar (13), and all are 17 bp, it was a priori unclear whether this was a new gene or a bona fide D to D recombination event. In the absence of N regions, junctions are often formed at the site of short sequence homologies, and this homology-directed recombination results in significant junctional homogeneity, especially in DH-JH junctions, due to the repeated presence of TAC and TAT in D and J segments near the region of joining (14, 15). It is thus possible that this particular sequence could be present in high frequency because it represents a D-D join of DSP2.X with a yet undescribed DSP2 gene, yielding a commonly occurring junction due to short stretch of sequence identity of the two D segments resulting in homology-directed recombination during D-D joining. However, we have previously uncovered the existence of two new DH genes, DSP2.10 and DST4, based on our hypothesis that if the same unidentified sequence between a VH and JH segment is observed in several independent CDR3s, it is more likely to be a new D region than a complex D-D join or inverted D (16, 17). Such new D genes are particularly noticeable if the sequences lack N regions such as is observed in fetal or newborn mice, so that the unidentified sequence must be germline encoded by V, D, or J genes.
We show here that mice of the Ighj
haplotype such as MRL and C3H have two previously undescribed DSP
genes, one of which is the unusual one present in many of the apparent
D-D fusions. Other apparent D-D joins can be attributed to a sequence
difference in the Ighj allele of
DFL16.1. Ighj mice also have
different VH7183 genes, one of which has a much
longer portion at its 3' end than most VH7183
genes, thus making a bigger contribution to CDR3. Although all apparent
D-D fusions from newborn sequences of MRL and C3H can be accounted for
by these new DH and VH
alleles, we still observed that MRL and C3H mice have
45% of CDR3
regions in adult bone marrow precursors which contained apparent D-D
rearrangements. Thus, D-D rearrangements are observed in adult, but not
newborn, mice, suggesting major differences in the VDJ recombination
mechanism at these two times in ontogeny.
| Materials and Methods |
|---|
|
|
|---|
MRL/lpr, C3H/HeJ, and BALB/c mice were maintained at the breeding facility at The Scripps Research Institute (La Jolla, CA). Pre-B cells were purified from bone marrow on a FACSVantage after staining with FITC-conjugated anti-B220 (Caltag Laboratories) and biotin-coupled anti-IgM followed by streptavidin-PE.
PCR assay
DNA was prepared as previously described (18). DJ rearrangements were amplified with either AF288 (5'-GCCAAAGCTTTTTGTSAAGGGATCTAC), located at the 5' end of the recombination signal sequence (RSS) including the nonamer and part of the spacer, or with AF216 (5'-GTSAGGAAGCTTYCCAGAAACAGACC), located more 5'. The set of JH primers (JH1 + 4, JH2, JH3), located in FR4, was previously described (16). Germline D genes were amplified with the same upstream primers, and with a primer 3' of DSP, AF289 (5'-CCCCTAGAATTCAAGCTCCTCTTGACT). VDJ rearrangements were amplified with the same set of JH primers and with previously described VH primers (VHS107, AF72 (19); VH7183, AF303; (18); and VHJ558, AF326 (5'-GGGGCTTAAGCTTAGCTGTCCTGCAAGGCT)). Amplifications were performed for 35 cycles, and PCR products were cloned and sequenced as previously described (18). For D-J and VDJ rearrangements, 1014 PCRs were done on each DNA sample, thus minimizing duplicate sequences. Duplicate sequences were only counted once, and no more sequences were obtained from any PCR after the first duplicate sequence was encountered. For the germline DH genes, we amplified 38 sequences from MRL/lpr tail DNA from five independent PCR, 29 sequences from MRL/lpr bone marrow derived from three independent PCRs, and 16 sequences from C3H unsorted bone marrow DNA from three PCRs.
| Results |
|---|
|
|
|---|
To determine whether many of the apparent D-D fusions in
MRL/lpr VDJ rearrangements are due to a previously
undescribed D gene, we amplified germline D genes with a primer, AF288,
which is located in the nonamer and spacer of the 5' RSS of all
DSP and DFL16 genes, and with a primer located
90 bp 3' of DSP2. Although the 5' primer should amplify
most, if not all, DSP and DFL genes, the flanking
region is likely to diverge as one gets further from the coding region,
so the 3' primer may not amplify all DSP genes. Nonetheless,
we were able to amplify several DSP2 genes identical with
BALB/c genes with this primer set, including DSP2.2,
DSP2.5, DSP2.9, DSP2.10, as
well as DSP2.X, a previously described gene present in
Ighb mice such as C57BL/6, but not in
Igha mice such as BALB/c (Fig. 1
) (20). In addition, we
amplified two novel DSP2 genes, including the predicted
gene. This new gene, which we called DSP2.12, has a
duplication of 9 bp, thus making it a 26-bp DSP segment,
whereas all other DSP2 genes are 17 bp long. We also
amplified DSP2.12 from C3H DNA, as would be predicted,
because this strain also has the Ighj
haplotype, and because this DH sequence was also
observed in C3H rearrangements (11). The other new
DSP gene, DSP2.13, is more conventional, having
only two base pair changes from other DSP genes. Finally, we
also found that Ighj mice have an
alternative allele of DFL16.1 (Fig. 1
).
|
Usage of DSP2 genes in D-J rearrangements
We amplified D-J rearrangements for two reasons. First, we still had not observed several DSP2 genes which were present in Igha mice, and divergence of the 3' flanking sequence in the region of the downstream primer might be the reason for our failure to amplify them. By substituting the JH primers for the downstream primers and using them with three different primers for the 5' flanking region, including the one just described, we should detect most DSP and DFL genes. Nonetheless, we did not uncover any additional DSP genes that we had not seen with the flanking primers. Thus, with the caveat that some D genes may vary in the spacer/nonamer sequence, as well as with the more distal primers, it appears that Ighj have only these seven functional DSP genes. Also, we did not see any DFL16.2 rearrangements, thus suggesting that this gene may also be absent in Ighj mice.
Another reason to amplify DJ rearrangements was to observe the relative
frequency with which the D genes rearrange in MRL/lpr vs C3H
pre-B cells, because C3H mice were reported to have fewer D-D fusions
in VDJ rearrangements (11, 12). Hence, they might have a
different relative usage of DSP2 genes. The first primer
that we used, located in the RSS, amplified DFL and
DSP genes. From 80 sequences in MRL/lpr mice, and
from 98 C3H sequences, we determined that 50% of MRL and 38% of C3H
DFL/DSP sequences used DFL16.1. Because the DFL16
gene was used in such a large percentage of the rearrangements, we also
used another primer, AF216, in other amplifications to more accurately
determine the frequency of usage of individual DSP genes. In
BALB mice, the AF216 primer equally amplifies DFL16 and
DSP2 family genes, but in Ighj mice
AF216 does not amplify DFL genes, presumably due to
divergence of the germline DFL.16j gene at the
site of the primer. Thus, we used DSP2 sequences from both
types of amplifications to assess the relative usage of DSP2
genes (Fig. 2
). The frequency of
rearrangement of the individual DSP genes was similar
between the two strains, other than the lower frequency of
DSP2.5 rearrangements in DJ rearrangements from pre-B cells
from MRL/lpr mice. However, we do not see this difference in
usage in sequences derived from C3H and MRL/lpr pro-B cells
(data not shown), nor is it evident in the VDJ rearrangements (Fig. 3
). Hence, we conclude that there is not
any major difference in the frequency of rearrangement of the
DSP2 genes between the two strains. The novel long
DSP2.12 is not one of the more frequently rearranging
DSP2 genes in either C3H or MRL mice (Fig. 2
).
|
|
To determine whether the frequency of individual D gene usage was
altered between DJ rearrangements and VDJ rearrangements in pre-B
cells, and to determine whether any D-D joinings occurred in VDJ
rearrangements, we also analyzed VDJ rearrangements from adult bone
marrow pre-B cell DNA (Fig. 3
). Primers for the
VHJ558, VHS107, and
VH7183 families were used. We have recently
sequenced all of the VH7183 genes in
Igha mice, and all but two of the 20
VH7183 genes have 2 bp in CDR3, either CA or GA
(18). In our analyses of the VH7183
sequences from MRL/lpr mice, we often observed the sequence
CAAGAC at the start of CDR3, and this was always preceded by a 1-bp
variation in the codon after the invariant cysteine (TGT
GTA AGA). The T in the middle codon is unusual for
VH7183 genes. Therefore, we surmised that this
was likely to be a new VH7183 gene in MRL mice.
We amplified DNA from unsorted MRL/lpr bone marrow with
primers located in FR1 and 3' of the RSS and confirmed our prediction
that this was indeed a new germline VH gene, with
the 3' terminal sequence of ... TGT GTA AGA CAA GAC A-RSS
(GenBank accession number AF428078). The RSS differs by only 2 bp in
the spacer from the prototypic VH7183 group I
RSS of the Igha haplotype
(18). We have also begun to sequence other unrearranged
VH7183 genes, all of which so far differ in
coding sequence from the Igha
VH7183 genes, other than 81X.
In general, the DSP2 gene segment usage was
similar from D-J to VDJ (Figs. 2
and 3
). However, DFL16.1
was lower in usage in VDJ rearrangements than in pre-B rearrangements.
The primer used in the DJ rearrangements, AF288, had one degenerate
position in the spacer, because DFL and DSP
varied at that site, and it also had one position in the added
restriction site which was identical with DFL but varied by
1 bp from DSP. Thus, this primer may have slightly favored
amplification of DFL. Because the primers for the VDJ
amplifications are in the VH and
JH regions, the frequency of D gene usage in VDJ
rearrangements is unbiased. The lower frequency of use of
DFL16 in C3H pre-B cells as compared with MRL that we
observed in both DJ and VDJ rearrangements is in agreement with the
lower frequency of usage of DFL16.1 in VDJ rearrangements of
C3H mice previously reported by Klonowski et al. (11). We
found only three D segments which appeared to be inverted D genes from
our 295 VDJ rearrangements. Analysis of VDJ rearrangements allowed us
to determine the frequency of rearrangement of DQ52 and
DST4 genes, which were not amplified by the DSP/DFL primer.
Both are present at low frequency, as they are in BALB/c mice also
(16, 17).
V-D-D-J rearrangements
We did observe some CDR3 regions from adult bone marrow pre-B
cells which had clear-cut examples of the use of two D regions (Fig. 4
). For these analyses, we used the
criteria that each DH gene should have five or
more continuous nucleotides identical with a D region which could not
have been accounted for by VH,
JH, or P nucleotides. Thus, we may have
underestimated some D-D joinings which contained smaller regions of the
D sequences. We observed six of 130 (4.6%) CDR3 from
MRL/lpr pre-B cells which contained apparent D-D
rearrangements, and seven of 165 (4.2%) from C3H. Finally, we analyzed
200 adult bone marrow pre-B cell sequences from BALB/c mice and
observed four examples of apparent D-D joins in the BALB pre-B
sequences (2%). Thus, it appears that all strains of mice have VDDJ
rearrangements in bone marrow pre-B cells.
|
|
|
In contrast to the adult bone marrow pre-B cells, we did
not observe any D-D joins in 30 VDJ sequences from MRL/lpr
newborn liver (Table I
). Also, our reanalysis of the 18 published
examples of D-D joins and atypical CDR3 regions from the published
study of Klonowski et al. (11) revealed only one inverted
D region and no examples of D-D joins from their 141 newborn
MRL/+ rearrangements. Furthermore, we have
previously sequenced over 300 fetal and newborn sequences from BALB/c
mice (Ref. 16 and unpublished data) and have found no VDDJ
rearrangements (Table I
).
| Discussion |
|---|
|
|
|---|
We also observed one VH7183 gene with an unusually long portion in CDR3 region, and this gene was used frequently in our rearranged sequences. However, because we do not know the sequence of all of the VH7183 genes in MRL mice, we cannot be certain whether this gene rearranges more frequently, or whether our VH primer preferentially amplifies it. A search of GenBank for the new VH7183.1j gene did not show any sequences with a perfect match to this new gene.
It has been speculated by many that autoantibodies, particularly anti-dsDNA Abs, may be enriched in atypical CDR3 regions, including inverted D sequences or D-D joinings, although a detailed study of anti-dsDNA Abs in (NZB x NXW)F1 mice indicated that in this strain most of the arginines were encoded by N regions and alternative reading frames, but not inverted D regions or D-D (3, 4, 5, 6, 7, 9, 11, 12). The long DSP2.12 which we describe in this work has in fact been used in a few published sequences of anti-dsDNA and anti-histone autoantibodies and in rheumatoid factor Abs from MRL/lpr mice (3, 22, 23). However, despite the existence of the new D genes/alleles which we describe here, several of the apparent V-D-D-J rearrangements in published sequences of hybridoma autoantibodies appear to be actual D-D rearrangements, although the analysis of autoantibodies in lupus is hampered by the fact that these Abs have undergone extensive somatic hypermutation, adding much ambiguity to the prediction of the original unmutated sequence. The three new alleles described in this report do not directly encode any arginines, and even in alternative reading frames DSP2.12 and DFL16.1j will only encode one arginine each. Thus, the predominant effect of DSP2.12 and of the new VH7183 gene would be to encode a subset of Abs which could have longer CDR3s than average Abs.
Despite the reduction in the estimate of frequency of D-D rearrangements due to the discovery of DSP2.12, MRL/lpr mice still do have some apparent D-D rearrangements, with 4.6% of pre-B cell rearranged sequences displaying CDR3 regions with at least 5 bp of a second D region. Much stricter criteria for the definition of D-D joins have been proposed for human VDJ sequences by Corbett et al. (24). However, these criteria are not directly applicable to murine DH genes, because less than one third of the human DH genes are as short as the murine DSP2 genes. However, we acknowledge that we cannot be certain that these are not N regions which fortuitously match a D sequence, and often one of the two D segments is shorter than average. Nonetheless, these sequences meet most definitions of D-D rearrangements and appear to be bona fide DD joinings. D-D joining break the 12/23 spacer rule for V(D)J recombination; however, studies with recombination substrates show that 12/12 spacer RSSs, or heptamer-only RSSs, can rearrange at 12% of the frequency of consensus RSS (25), and D-D rearrangements have been observed in several studies of unselected human and murine Ab repertoires (15, 16, 26, 27, 28).
VDDJ rearrangements can theoretically be assembled in any of three ways. A D segment could join to a DJ rearrangement, followed by a VH joining to the DDJ. An alternative pathway would be the creation of a VD rearrangement, which would subsequently join to a DJ rearrangement. Finally, the first step could be the rearrangement of two D segments, followed by joining of a JH and then a VH. VD rearrangements and DD rearrangements have previously been described (27, 29). In this work we show evidence for DDJ rearrangements, although we do not know whether they arose by a DD to J or a D to DJ pathway. Because the D and J loci are accessible at earlier stages of B cell development than is the V locus, one might have predicted that DDJ joins might be more likely to be an intermediate than VD rearrangements, particularly because continuing DJ rearrangements are known to occur. We found DDJ rearrangements in our DJ sequences at less than half the frequency of VDDJ rearrangements, suggesting that all of these mechanisms may be operative in the formation of these VDDJ sequences.
One surprising outcome of this analysis was the total lack of VDDJ rearrangements in newborn mice. This suggests fundamental differences in the V(D)J rearrangement process during pre-B cell development in the neonatal period and the adult. It is possible that the transit time for B cell development is faster in the newborn, and so conventional VDJ rearrangements are the only ones which have time to occur. Alternatively, although the sole role of TdT has been thought to be that of adding N regions to VDJ junctions, recent data suggest that it may play a role in specific V gene use (30). Thus, it is possible that another unconventional role for TdT would be to facilitate D-D joinings. These possibilities are being explored.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ann J. Feeney, Department of Immunology, The Scripps Research Institute, IMM-22, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: feeney{at}scripps.edu ![]()
3 Abbreviations used in this paper: CDR3, complementarity-determining region 3; RSS, recombination signal sequence. ![]()
Received for publication July 24, 2001. Accepted for publication October 22, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. C. Watson, C. S. Moffatt-Blue, R. Z. McDonald, E. Kompfner, D. Ait-Azzouzene, D. Nemazee, A. N. Theofilopoulos, D. H. Kono, and A. J. Feeney Paucity of V-D-D-J Rearrangements and VH Replacement Events in Lupus Prone and Nonautoimmune TdT-/- and TdT+/+ Mice J. Immunol., July 15, 2006; 177(2): 1120 - 1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Q. Zhang, C. Okumura, T. McCarty, M. S. Shin, P. Mukhopadhyay, M. Hori, T. A. Torrey, Z. Naghashfar, J. X. Zhou, C. H. Lee, et al. Evidence for Selective Transformation of Autoreactive Immature Plasma Cells in Mice Deficient in Fasl J. Exp. Med., December 6, 2004; 200(11): 1467 - 1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Souto-Carneiro, N. S. Longo, D. E. Russ, H.-w. Sun, and P. E. Lipsky Characterization of the Human Ig Heavy Chain Antigen Binding Complementarity Determining Region 3 Using a Newly Developed Software Algorithm, JOINSOLVER J. Immunol., June 1, 2004; 172(11): 6790 - 6802. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |