|
|
||||||||

*
Department of Dermatology, University of Texas Southwestern Medical Center and Dallas Veterans Affairs Medical Center, Dallas, TX 75390; and
Department of Veterinary Pathology, Nippon Veterinary and Animal Science University, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
DC are derived from the bone marrow (2) and express surface molecules (e.g., MHC class II, CD80, and CD86) required for T cell activation. LC are thought to undergo differentiation pathways that distinguish them from other DC (5, 6, 7). Unlike DC, LC express E-cadherin, an adhesion molecule that connects them to keratinocytes (8), and CD1a (in the case of human LC) (9), a molecule important for presenting lipid and glycolipid Ags (10). LC are also unique in expressing Birbeck granules (11), an organelle system consisting of superimposed and zippered membranes that may account for distinct Ag processing properties (12). It would appear that some of these LC-specific features could be used in the development of gene-based manipulation of LC function. However, none of them to date have been so applied.
Our goal has been to identify and characterize genes that distinguish LC from other APCs and to use their regulatory elements to selectively target gene expression to LC. By subtractive cDNA cloning of the LC-like XS cell line derived from the epidermis of newborn BALB/c mice (13), we have previously isolated the dectin-2 gene that encodes for a novel C-type lectin receptor (14) with costimulatory function. Because dectin-2 mRNA is expressed selectively by XS cell line and exclusively by epidermal LC in vivo, we hypothesized that its promoter may be a LC-specific regulatory element. To prove this, we isolated the 5'-flanking region of the dectin-2 gene (Dec2FR) and examined its regulatory role in controlling LC-specific expression. Our findings indicate that Dec2FR possesses unique promoter sequences that drive gene expression specifically in XS cell lines in vitro and at differentially high levels in epidermal LC in transgenic mice.
| Materials and Methods |
|---|
|
|
|---|
XS106 and XS52 cells were obtained from A. Takashima (University of Texas Southwestern Medical Center, Dallas, TX). These cells are long-term DC lines established from the epidermis of newborn BALB/c mice maintained and expanded in complete RPMI 1640 supplemented with mouse rGM-CSF (1 ng/ml) and NS47 fibroblast culture supernatant (10% v/v) as source of CSF-1 (13). The NS47 line of dermal fibroblasts was maintained in complete RPMI 1640 supplemented with 10% FBS (13).
Ab and reagents
The mAb specific for CD8, Mac-1, MHC class II
I-Ad/I-Ed (2G9),
CD45R/B220, CD3
, CD11c, and FcR (CD16/CD32, Fc
III/IIR) were
purchased from BD PharMingen (San Diego, CA). All chemical reagents
used were obtained from Sigma-Aldrich (St. Louis, MO).
Cloning of Dec2FR and nucleotide sequencing
Genomic nucleotide sequences for dectin-2 were isolated from a genomic library prepared from BALB/c mouse (Clontech Laboratories, Palo Alto, CA) by hybridization with the cDNA for dectin-2 (GenBank accession number AF240357) (14). One of the isolated phage clones contained a 3.2-kb fragment of the 5'-flanking region that was amplified by PCR using Expand Long Template PCR System (Roche Diagnostics, Indianapolis, IN) with primers complementary to a 5' end cloning site and a 3' end sequence of 5'-untranslated region. The amplified nucleotide was subcloned into a plasmid vector, pGEM-7zf(-) (pGEM-Dec2FR; Promega, Madison, WI), and its nucleotide sequence was determined at both sense and antisense strands by the automated sequencing of deletion mutants produced by Erase-a-base system (Promega).
Primer extension assay
This assay was used to map mRNA initiation sites on the
5'-flanking region. Fifty femtomoles of the synthetic oligonucleotide,
5'-CCAGAGTTCAGAATCAACTTCCACACACACTT-3', was 5' end-labeled with
[
-32P]ATP and hybridized with 30 µg of
total RNA isolated from XS52 cells. In the presence of the reverse
transcriptase (10 U), Superscript II (Life Technologies, Grand Island,
NY), the cDNA strand was extended from the primer toward the 5' end of
dectin-2 mRNA. This extended strand was separated on 8% urea-PAGE in
parallel with sequencing ladders (C, T, A, and G) synthesized from
genomic DNA by the same primer. The location of the 5' end (mRNA
initiation site) was determined by the position of the nucleotide in
the ladders showing the same size of the extended strand.
Construction of Luc expression vectors
The area containing a 5'-flanking region (nt -3176 to +1,
designated the mRNA initiation site as +1) and the 5'-untranslated
region was excised by digestion of pGEM-Dec2FR with MluI and
XhoI restriction enzymes and introduced upstream a
luciferase (Luc) coding sequence in pGL3-basic (Promega) without
transcriptional control elements (pDec2FR-Luc). A second control was
pGL3-control (or pSV40-Luc) (Promega), which contains SV40 promoter
(SVP) and enhancer upstream and downstream, respectively, of the Luc
gene. A set of deletion mutants lacking 5'-flanking sequences from its
5' end was constructed by PCR-based mutagenesis. Briefly, a nucleotide
fragment spanning the indicated 5' end (Fig. 3
) to the +126 was
PCR-amplified and cloned into a pGL3-basic Luc vector using
MluI and XhoI sites. For deletion mutants
designed to determine repressor and minimum promoter regions, a
putative enhancer fragment (nt -2741 to -1850) was also PCR-amplified
and inserted into some of the previous deletion mutants through
SacI and MluI sites. For experiments examining
whether the dectin-2 enhancer and a minimum promoter region (nt -123
to +126) control LC/DC specificity, we constructed a third set of Luc
expression vectors. Dectin-2 enhancer and minimum promoter fragments
were inserted separately or together into a pGL3-basic vector
(pDec2E-Luc, pDec2P-Luc, and pDec2E/Dec2P-Luc, respectively). The
enhancer fragment was also inserted into a pGL3-promoter (Promega)
containing a SVP sequence, using MluI and XhoI
sites (pSVP/Dec2E-Luc).
|
Luc vector DNA was delivered into various cell lines using liposome-mediated transfection (15). XS106 or NS47 cells, seeded on a 60-mm dish at a density of 1 x 106 1 day before, were cultured in the presence of 1 µg of DNA and 3 µl of Fugene (Roche Diagnostics). Following a 24-h incubation, whole cell extracts were prepared from cells by lysis in 1x Reporter lysis buffer (Promega). For experiments in which tissue Luc activity was examined, proteins were extracted from excised tissues by homogenization in the lysis buffer (1 ml/100 mg of wet weight). An aliquot (1020%) was used to measure Luc activities determined by light emitted for 30 s with an Optocomp I Luminometer (MGM Instruments, Hamden, CT) using Luciferase Assay System (Promega). Protein concentration was determined by the Bradford method, and their values were used to normalize Luc activity (16).
Electromobility shift assay
The nucleotide sequence -123 to -34 was segmented into three duplexed oligonucleotides: DM1 prober (35-mer), 5'-CCACATTAGGAACTGAGAAAGTAATGAGAACATTC-3' (nt -123 to 89); DM2 probe (30-mer), ACATTCTTGACAGAGTTTTTAGGAACAAAT (nt -94 to -65); and DM3 probe (33-mer), AAATTTAGGTATGTTTCTCAATTTCCTCTTTCC (nt -66 to -34). The oligonucleotide probe for SP1 (22-mer; ATTCGATCGGGGCGGGGCGAGC) and a control competitor (GTGTTGGGCGCGTTATTTATCGGAGTTGCA) derived from the coding sequence for Luc version 3 (Promega) were also synthesized. These oligonucleotides were 5' end-labeled with T4 DNA kinase and mixed with 10 µg of nuclear extracts. The preparation of nuclear extracts and electromobility shift assays were performed as described previously (17, 18). For competition experiments, nuclear extracts prepared from XS106 DC were incubated with unlabeled DM2 or control competitor oligonucleotide at various concentrations before addition of radiolabeled DM2 probe.
Generation of transgenic mice
pDec2FR-Luc DNA was depleted of its plasmid sequence by digestion with MluI and BamHI restriction enzymes and was highly purified by agarose electrophoresis and DNA extraction from gel plugs using a Nucleo Spin Extraction kit (Clontech Laboratories). The purified DNA was microinjected into fertilized oozytes obtained from ICR mice (The Jackson Laboratory, Bar Harbor, ME) (performed by the Transgenic Mouse Facility at University of Texas Southwestern Medical Center). Transgenic founders were identified by PCR analysis of genomic DNA (1 µg) extracted from tail biopsies using primers for Luc gene: 5'-GAAGTCGGGGAAGCGGTTGC-3' and 5'-CGGCGTCATCGTCGGGAAGA-3'. After 30-cycle amplification, PCR products were separated on 1.5% agarose gel, transferred onto a membrane, and followed by Southern hybridization with the corresponding DNA probe. The founders whose tail DNA showed expected size of the PCR and specific hybridization were selected and examined for Luc activity in their tails. Consequently, three transgenic founders were generated, and two of them, showing the highest Luc activity, were selected as breeding partners. Their F2 offspring mice were produced by mating with ICR wild-type mice, and the mice aged 420 wk were used for experiments addressing the LC/DC specificity for Dec2FR promoter activity. Animals were housed in the pathogen-free facility of the Animal Resource Center at the University of Texas Southwestern Medical Center. All the experiments were conducted according to guidelines of the National Institutes of Health.
Depletion and purification of epidermal LC
Depletion and purification were performed using immunomagnetic beads. Epidermal cells were prepared from ear skins of eight transgenic mice, as described previously (19). Cells were processed in three ways: one batch (5 x 105 cells) was not treated, whereas the other batches (1.5 x 106 cells per batch) were incubated for 30 min on ice with 10 µg/ml rat mAb specific for CD8 (control) or MHC class II molecule (Ia). After extensive washing, cells were incubated with magnetic beads (2 x 107) coated with anti-rat IgG (Dynal Biotech, Lake Success, NY). Unbound (depleted of Ia+ cells) and bound (purified for Ia+ cells) fractions were resuspended in 200 µl of PBS, and an aliquot (20 µl) was used for the cell counting. Protein was extracted from the rest of cells and assayed for Luc activity using 40% of the total extract. The extent of depletion of Ia+ cells was estimated by reduction in frequency of Ia+ cells after treatment with the magnetic beads. Small aliquots of unfractionated epidermal cells (just before use of magnetic beads) and of a fraction not bound to anti-Ia were stained with 10 µg/ml FITC-conjugated anti-rat IgG. Untreated epidermal cells and cells of anti-CD8-unbound fraction were also stained with anti-Ia mAb. These stained cells were examined for frequency of Ia+ cells by flow cytometry.
Purification of leukocytes
DC, T cells, and B cells were purified from spleen. For DC,
spleen cells were prepared from the same pool of transgenic mice as was
used for preparing epidermal cell suspensions (Fig. 6
). After
pretreatment with anti-FcR Ab (10 µg/ml), the spleen cells
(5 x 106 cells) were incubated with 10
µg/ml biotin-conjugated rat anti-CD11c mAb, followed by treatment
with streptavidin-coated magnetic beads (5 x
107; Dynal Biotech). For T and B cells, after
staining of spleen cells (2 x 106) with 10
µg/ml FITC-conjugated anti-CD3
or anti-B220, T cells
(CD3+) and B cells (B220+)
were purified by flow cytometric sorting. For peritoneal macrophages,
at 4 day after i.p. injection of 3% thioglycolate (in PBS), peritoneal
cells were collected from the transgenic mice and cultured for 3 days
in 10% FCS-RPMI 1640 (20). Following extensive washing of
the culture dishes to remove floating cells and weakly adherent cells,
peritoneal macrophages were harvested by scraping and examined for
expression of Mac-1 and B220+ to estimate
contamination of peritoneal B cells (B220+) using
flow cytometric analysis. Typically, the adherent cells comprise <10%
of B cells. Cell counting and Luc assays were performed as described
above. Selective isolation of DC, macrophages, T cells, and B cells was
confirmed by flow cytometric analyses and by parallel setting with
control Abs.
|
| Results |
|---|
|
|
|---|
To isolate the transcriptional regulatory region of the
dectin-2 gene, we screened a BALB/c mouse genomic
library. Five independent phage clones were isolated, which cover
40
kb of the dectin-2 gene containing six exons and a long
stretch (3.2 kb) of Dec2FR (14). Primer extension assay
and nucleotide sequence analyses revealed that Dec2FR has one major
site for mRNA initiation at 126 bp from the initiation codon and a
putative TATA box at 24 bp upstream of the initiation site (Fig. 1
), both of which are essential elements
for de novo mRNA synthesis.
|
-responsible elements (22), retinoic responsive
element (H-2RIIBP) (23), and an element (GM-CSF-consensus
sequence (CS)) responsible for gene expression of GM-CSF by T
cells in response to Ag stimulation (24) were found (Fig. 1
, retinoic acids, and Ag stimulation. We also noted the presence
of an NF-Y-MHCII site, which controls MHC class II gene expression
(25), suggesting that the Dec2FR may have a relationship
with class II expression. Dec2FR drives gene expression specifically in XS cell lines
Dec2FR or SV40 transcription units were linked separately to the
Luc gene (pDec2FR-Luc and pSV40-Luc, respectively) (Fig. 2
A) and introduced into
various cell lines. pDec2FR-Luc produced 18-fold higher activity
compared with pGL3-basic (promoterless Luc vector) in XS106 DC (Fig. 2
B), a line that resembles epidermal LC phenotypically and
functionally (13, 26). By contrast, the promoter activity
was close to the baseline level in NS47 fibroblasts (Fig. 2
B) and considerably lower or minimal in other cell lines
including macrophage, B cell, T cell, and keratinocyte lines
(48). The control SV40 transcription unit induced
strong Luc activity in both XS106 DC (65-fold) and NS47 fibroblasts
(153-fold higher than the baseline). This XS106 DC-selective expression
of Dec2FR activity is consistent with our previous finding of exclusive
dectin-2 mRNA expression in the same cell line (14).
|
To identify nucleotide sequences controlling Dec2FR promoter
activity, we conducted deletion mutant analyses. Various nucleotide
sequences were deleted from the 5' end of Dec2FR (nt -3176 to +126),
ligated to the pGL3-basic vector, and transfected into XS106 DC or NS47
fibroblasts (Fig. 3
A). Dec2FR
produced high levels of Luc activity (29 ± 6% of Luc activity by
pSV40-Luc) in XS106 DC. Deletion of the region between -2741 and
-1852 dramatically reduced transcriptional activity, suggesting that
it is required for high activity, probably functioning as an enhancer.
Progressive deletion within region -1851 to -507 partially restored
activity, whereas further deletion of region -506 to +1 completely
abrogated activity. To more precisely characterize region -1851 to
-36, segments were progressively deleted and inserted into a Luc
vector containing the putative enhancer fragment -2741 to -1852.
Deletion of region -1851 to -507 markedly enhanced promoter activity
(11-fold; 1681 vs 149 relative Luc activity of wild type), suggesting
that it serves as a repressor (Fig. 3
B). By contrast,
further deletion of region -506 to -277 led to the lowest level of
reduced activity shown by mutant -276. Surprisingly, mutant -123
produced increased activity, indicating the presence of a second
repressor region between -276 and -124. Mutant -35, which contains a
TATA box and its downstream region, lost almost all activity. When
transfected into NS47 fibroblasts, all mutants produced considerably
low activity ranging between 1.0 and 6.4 relative Luc activity to
pGL3-basic. Because even mutant -123 retained selective expression in
XS106 cells, we surmised that region -123 to +1 and the putative
enhancer contain the minimal sequences required for the XS cell
selectivity. Removal of a 5'-untranslated region (5'UTR), spanning nt
+1 to +126, from the wild type and a mutant -123 reduced
transcriptional activity by 72 and 20%, respectively. However, it
should be noted that the 5UTR itself did not produce any detectable Luc
activity even in the presence of an enhancer (data not
shown). These analyses indicate that Dec2FR consists of an
enhancer (-2741 to -1852), two repressors (-1851 to -507 and -276
to -124), and a minimum promoter (-123 to +1) including a TATA box
and an mRNA initiation site (Fig. 3
C).
We next determined the role of the putative enhancer (Dec2E) and/or
minimal promoter (Dec2P) in regulating the XS DC-specific expression.
Dec2E fragment was inserted into a Luc vector with Dec2P or with the
SVP and examined for Luc activity in XS106 DC or NS47 fibroblasts (Fig. 3
D). Neither Dec2E nor Dec2P alone displayed strong activity
in the XS DC, whereas activity was greatly enhanced when the two
fragments were linked, with the level of enhancement much higher in XS
cells than in fibroblasts. Moreover, Dec2E also enhanced the activity
of the heterologous promoter, SV40, more intensely in XS cells than in
fibroblasts (Fig. 3
D). These data verify the presence of
enhancer function in this region and also indicate that enhancer and
minimal promoter coregulate XS DC specificity of dectin-2 gene
expression.
Nuclear proteins that bind to the minimum promoter sequence are expressed abundantly by XS106 cells
Because a nucleotide sequence spanning -123 to -36 (88 bp) in
the minimum promoter was shown to regulate transcriptional activity and
selectivity of cell expression of the dectin-2 promoter, we performed
electromobility shift assays to detect nuclear proteins that bind to
the 88 bp. The sequence was divided into three regions: DM1 (nt -123
to 89), DM2 (nt -94 to -65), and DM3 (nt -66 to -34). DM1 probe
detected several species of DNA-protein complexes in nuclear extracts
isolated from XS106 cells. Three of these species were also expressed
in other cell lines (e.g., Raw macrophage, J558 B cell, BW5147
thymocyte, and S105 fibroblast lines) (Fig. 4
A), whereas two minor species
were expressed only by XS106 cells. However, the respective binding
activities of these two latter species were not blocked with unlabeled
DM1 oligonucleotide, indicating that binding was not specific (data not
shown). DM3 probe detected six species, all of which were also widely
expressed. Finally, DM2 probe detected four species in complexes formed
with XS106 nuclear extracts, two of which (third and fourth species)
were highly expressed in XS106 nuclear extracts, only minimally in
macrophage extracts, and not at all in other cell extracts. The
abundant expression in XS106 cells was not due to a higher
concentration of nuclear proteins in the cells, because expression
levels of complexes with DM1 probe and Sp1 transcription factor (Ref.
27 and data not shown) were similar for XS106 and Raw
macrophage cells. Moreover, binding activity of XS106 nuclear extracts
was almost completely inhibited by 50 ng of unlabeled DM2
(corresponding to a molecular excess of 1:300), but not by control
oligonucleotide (Fig. 4
B). These results indicate that the
Dec2FR minimum promoter contains cis-acting element(s) that
may play a role in regulating preferential expression of
dectin-2 gene in XS cells.
|
To evaluate the cell-type specificity of Dec2FR activity in vivo,
we generated transgenic mice bearing the Dec2FR-driven Luc gene.
Various organs were excised and examined for Luc-specific activity
(relative light units (RLU) per microgram of protein) (Fig. 5
). Luc activity was highest in skin
(from ear), with lower levels in lymphoid organs (spleen, lymph node,
and thymus) known to contain relatively large numbers of DC.
Nonlymphoid organs (e.g., adipose tissue, heart, and kidney) showed
only background levels, although organs (lung, intestine, and testis)
reported to harbor modest LC/DC densities showed similar Luc activity
to lymphoid organ (Fig. 5
) (28, 29, 30). The expression in
skin becomes even more marked when Luc activity was normalized by DNA
concentration. Because the ear is made up of skin (epidermis and
dermis) and cartilage, we determined what tissue is a major source for
the high activity. Luc activity was traced almost entirely to skin,
with 80% in epidermis, 20% in dermis, and negligible activity in
cartilage. Therefore, the highest Dec2FR activity appears linked to
epidermal LC.
|
Epidermal cells prepared from ear skin (pool of eight transgenic
mice) expressed activity (8,023 RLU/104 cells).
Fractionation into Ia+ cells (LC) and
Ia- cells (mostly keratinocytes) by
immunomagnetic beads revealed markedly high activity in the
Ia+ fraction (119,922
RLU/104 cells), 15-fold higher than
unfractionated epidermal cells, whereas the Ia-
fraction possessed only background activity (Fig. 6
A). Selectivity and efficacy
of LC depletion was confirmed by marked reduction in frequency of
Ia+ cells (from 4.8 to 0.05%) following
depletion with anti-Ia treatment, but not with anti-CD8-coated
beads (Fig. 6
B). Therefore, Dec2FR activity is targeted to
epidermal LC in the skin.
Epidermal LC is targeted for high expression of Luc among leukocytes
We next examined Luc expression levels in splenic DC and in non-DC
leukocytes. Spleen cells prepared from the previous pool of transgenic
mice showed 101 RLU/104 cells, 80-fold lower than
in epidermal cells, and this preparation was used to isolate splenic
DC, T cells, and B cells. Splenic DC, purified using anti-CD11c
Ab-magnetic beads, expressed 150-fold lower activity than epidermal LC
(Fig. 7
A). T and B cells,
purified by flow cytometric sorting of CD3+ cells
and CD45R/B220+ cells, respectively, both
expressed mere background activity, documenting lack of Dec2FR
influence in these cells. Finally, macrophages
(Mac-1+) isolated from peritoneal cells elicited
with thioglycolate displayed similar Luc activity as splenic DC. These
findings lead us to conclude that epidermal LC are targeted selectively
for high-level constitutive gene expression by Dec2FR in
transgenic mice.
|
| Discussion |
|---|
|
|
|---|
Dec2FR contains cis-acting regulatory elements in the
proximal region of mRNA initiation site, which are responsible for
transcriptional activation by IFN-
(IFN-stimulated response
element), retinoic acid (H-2RIIBP), phorbol esters (AP-1), and Ag
stimulation (GM-CSF-CS). Their presence raises the possibility that
Dec2FR activity can be enhanced by these stimuli. However, we have
found each of these stimuli to have null effects on constitutive Dec2FR
activity in epidermal LC. By contrast, splenic DC, peritoneal
macrophages, and splenic T cells (but not B cells) showed some
up-regulated Luc activity following treatment with specific stimuli,
although the resultant levels were still much lower than in resting LC
(data not shown). Thus, the cis-acting elements may not
function in LC, or Dec2FR activity in resting LC may be optimally
expressed, with no effects detectable from further stimulation. In
contrast, in searching for NFs that bind to the minimum promoter
region, we found that a nucleotide sequence of nt -94 to -65 detected
two species of DNA-protein complexes abundantly expressed in XS106
cells (Fig. 4
), suggesting that the sequence contains at least one
cis-acting element recognized by the putative transcription
factors. Interestingly, the sequence is AT-rich and does not contain
previously identified NF binding sites. We have not yet determined the
exact binding sites recognized by XS106 nuclear proteins nor have we
functionally characterized the putative sites. However, we are testing
the possibility that nuclear proteins forming the third and fourth
complexes may be responsible for the preferential selectivity of
dectin-2 promoter expression in XS cells.
Transcriptional units of other genes have been used or are potential candidates for DC/LC-targeted gene expression systems. A promoter region of the CD11c gene was used to target DC expression in transgenic mice (34), but this gene is expressed by non-DC such as NK cells (35), intraepithelial cells (36), and eosinophils (37). DEC-205 is expressed by epidermal LC and splenic DC, but also by B cells (20). DC-SIGN is expressed by DC in dermis and other tissues, but not by LC (38). DC-LAMP is expressed by interdigitating DC, but not by LC or dermal DC (39). Finally, Langerin was reported to be expressed selectively by LC (40), but its promoter region has not been isolated or characterized for LC specificity. Thus, limitations related to DC/LC specificity of these markers make Dec2FR the best promoter to date for genetically manipulating LC function in vivo.
We have begun to use a LC-targeted gene expression system to study the in vivo function of LC. DC including LC play critical roles: certainly in initiating primary immune responses through activation of naive T cells; most likely in regulating the nature of T cell responses (e.g., Th1 vs Th2, immunogenic vs tolerogenic); and possibly in inducing innate immunity (e.g., against microorganisms) (41). This diversity of DC function may be reflected in heterogeneity of DC subsets (42). Our epidermal LC-targeted system may allow us to better distinguish between LC and DC (and even among functional subsets of LC), because constitutive Dec2FR activity is markedly higher in LC than in DC. We will use strategies involving gain of function achieved by LC-targeted gene transduction and loss of function through LC-targeted gene disruption via Cre-loxP site-specific recombination (43). Dec2FR can be coupled with inducible gene expression systems (e.g., Tet-ON and Tet-OFF) that will permit conditional regulation of gene expression. Furthermore, we will link our system to a gene producing a readily accessible visual marker (e.g., enhanced green fluorescent protein) that will allow more precise tracking of LC migration in and out of skin, because conventional methods for detecting LC, such as immunostaining using Abs and labeling of epidermal LC with FITC or rhodamine B (44), are limited by loss of the markers during LC migration to lymph nodes and leakage of the fluorescent reagents resulting in nonspecific labeling of DC other than the emigrated LC.
Our LC-targeted system will be used to develop new DNA vaccination strategies. DC (or APC)-targeting delivery of Ags induces rapid Ab responses following single step immunization (45) at 100 to 10,000-fold higher efficiency compared with nontargeted conventional protocols (46, 47). Indeed, we have demonstrated recently that gene gun-mediated DNA delivery of the Dec2FR genetic element leads to efficient induction of immunity against a surrogate Ag (48).
In conclusion, Dec2FR-based LC-targeted gene expression represents a new opportunity to manipulate gene expression in LC, to better understand LC function, and to develop more effective ways of activating and regulating immune responses for preventing and treating diseases.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kiyoshi Ariizumi, Department of Dermatology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-9069. E-mail address: Kiyoshi.Ariizumi{at}UTSouthwestern.edu ![]()
3 Abbreviations used in this paper: DC, dendritic cell; CS, consensus sequence; Dec2FR, 5'-flanking region of the dectin-2 gene; LC, Langerhans cell; Luc, luciferase; RLU, relative light unit; H-2RIIBP, retinoic responsive element in MHC class I gene; SVP, SV40 promoter. ![]()
Received for publication July 6, 2001. Accepted for publication October 15, 2001.
| References |
|---|
|
|
|---|
1 potentiates in vitro development of Langerhans-type dendritic cells and allows single-cell dendritic cell cluster formation under serum-free conditions. Blood 90:1425.
- dendritic cells but not of lymphoid-related CD8
+ dendritic cells. Immunity 9:839.[Medline]
-dependent IL-7 gene regulation in keratinocytes. J. Immunol. 154:6031.[Abstract]
converting enzyme in murine Langerhans cells and epidermal-derived dendritic cell lines. Eur. J. Immunol. 25:2137.[Medline]
This article has been cited by other articles:
![]() |
J.-S. Chung, T. Yudate, M. Tomihari, H. Akiyoshi, P. D. Cruz Jr., and K. Ariizumi Binding of DC-HIL to Dermatophytic Fungi Induces Tyrosine Phosphorylation and Potentiates Antigen Presenting Cell Function J. Immunol., October 15, 2009; 183(8): 5190 - 5198. [Abstract] [Full Text] [PDF] |
||||
![]() |
S T. Hollmig, K. Ariizumi, and P. D Cruz Jr Recognition of non-self-polysaccharides by C-type lectin receptors dectin-1 and dectin-2 Glycobiology, June 1, 2009; 19(6): 568 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Barrett, A. Maekawa, O. M. Rahman, K. F. Austen, and Y. Kanaoka Dectin-2 Recognition of House Dust Mite Triggers Cysteinyl Leukotriene Generation by Dendritic Cells J. Immunol., January 15, 2009; 182(2): 1119 - 1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lopes, M. Dewannieux, U. Gileadi, R. Bailey, Y. Ikeda, C. Whittaker, M. P. Collin, V. Cerundolo, M. Tomihari, K. Ariizumi, et al. Immunization with a Lentivector That Targets Tumor Antigen Expression to Dendritic Cells Induces Potent CD8+ and CD4+ T-Cell Responses J. Virol., January 1, 2008; 82(1): 86 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Aragane, A. Maeda, A. Schwarz, T. Tezuka, K. Ariizumi, and T. Schwarz Involvement of Dectin-2 in Ultraviolet Radiation-Induced Tolerance J. Immunol., October 1, 2003; 171(7): 3801 - 3807. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bros, X.-L. Ross, A. Pautz, A. B. Reske-Kunz, and R. Ross The Human Fascin Gene Promoter Is Highly Active in Mature Dendritic Cells Due to a Stage-Specific Enhancer J. Immunol., August 15, 2003; 171(4): 1825 - 1834. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |