The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carlow, D. A.
Right arrow Articles by Ziltener, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carlow, D. A.
Right arrow Articles by Ziltener, H. J.
The Journal of Immunology, 2001, 167: 6841-6848.
Copyright © 2001 by The American Association of Immunologists

IL-2, -4, and -15 Differentially Regulate O-Glycan Branching and P-Selectin Ligand Formation in Activated CD8 T Cells1

Douglas A. Carlow2,*, Stéphane Y. Corbel*, Michael J. Williams* and Hermann J. Ziltener*,{dagger}

* Biomedical Research Centre and {dagger} Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, British Columbia, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The glycosyltransferase core 2 {beta}1–6 N-acetylglucosaminyl transferase (C2GnT1 or C2GlcNAcT1) is responsible for formation of branched structures on O-glycans present on cell surface glycoproteins. The O-glycan branch created by C2GnT1 is physiologically important insofar as only this structure can be extended and modified to yield P-selectin ligands that promote initial interactions between extravasating lymphocytes and endothelia. In mature T cells, C2GnT1 activity is thought to be induced as an intrinsic consequence of T cell activation. Through analysis of C2GnT1-dependent epitopes on CD43 and CD45RB we have found that in activated CD8+ T cells expression of C2GnT1 was dependent upon exposure to specific cytokines rather than being induced as a direct consequence of activation. Activated CD8+ cells became receptive to strong induction of C2GnT1 expression and P-selectin ligand expression in response to IL-2, moderate induction by IL-15, and minimal induction in response to IL-4. Our observations clarify the relationship between T cell activation and C2GnT1 expression, demonstrate the differential impact of distinct cytokines on expression of C2GnT1 activity and P-selectin ligand, and reinforce the concept that the cytokine milieu subsequent to activation can influence adhesion systems that dictate lymphocyte homing properties.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
O-glycans participate substantially in leukocyte homing through interaction of selectins and their ligands expressed on leukocytes and endothelial cells. This interaction occurs only after the core O-glycan structures (core 1) present on selectin ligands are modified by a series of glycosyltransferases, including the branching enzyme core 2 {beta}1–6 N-acetylglucosaminyl transferase (C2GnT),3 sulfotransferases, galactosyl transferases, sialyl transferases, and finally fucosyltransferases (FucT) IV and VII. The carbohydrates and charged residues added by these enzymes contribute the key components recognized by selectin as demonstrated by binding studies with synthetic P-selectin glycoprotein ligand 1 (PSGL-1) ligands (1) and crystal structures of PSGL-1 and sLex complexes (2). It is the coordinated regulation of these enzymes that ultimately determines the stickiness of selectins with their O-glycan-bearing ligands, but the physiological regulation of these enzymes is poorly understood.

Selectins contribute to leukocyte homing by mediating enhanced leukocyte tethering and slow rolling. Despite the subtlety of this initial step in the cascade to leukocyte adhesion and extravasation, ineffective engagement of selectins resulted in reduced leukocyte tethering, increased rolling velocities on normal endothelia (3), and impaired leukocyte recruitment to sites of inflammation (4, 5, 6). Furthermore, differences in homing of Th1 vs Th2 polarized CD4 T cells have been ascribed in part to selectin interactions suggesting that tissue localization of responding CD4 T cells may be supported by cytokine-induced changes in O-glycans on selectin ligands (7, 8, 9, 10).

Cytokine regulation of selectin ligand formation has recently gained credence from a series of reports documenting induction of FucT VII and selectin ligand expression in CD4 cells cultured under conditions promoting Th1 polarization but not in those polarized toward Th2 (11, 12, 13, 14, 15, 16). Specifically, both IL-12 and TGF-{beta} have been shown to be effective inducers of FucT VII in CD4 cells (12, 13, 14, 16), whereas IL-4 failed to support FucT VII induction (12, 13, 16). Investigations to date have focused predominantly on CD4+ T cells. When CD8+ Tc1 and Tc2 populations were generated by the same polarizing cytokines, they displayed a similar distinction in expression of selectin ligands (17) that may account for their distinct migratory behavior (18) and therapeutic efficacy (18, 19). These studies collectively implicate IL-12/TGF-{beta} vs IL-4 regulation of FucT VII expression as major determinants of selectin ligand synthesis in activated T cells.

There is good evidence that selectin ligands require modifications by the branching enzyme C2GnT1 for selectin recognition (20, 21, 22). Early studies revealed that C2GnT1 was induced in T cells activated with monoclonal anti-CD3 (OKT3) in the presence of IL-2 (23). Where C2GnT1 expression has been examined during differentiation of Th1/2 CD4 cells its expression was not differentially regulated by polarizing cytokines (13, 14, 15, 16), and to our knowledge there is currently no evidence that C2GnT1 is subject to differential regulation in response to polarizing cytokines in T cells. The results presented below demonstrate that shortly after activation under neutral nonpolarizing conditions CD8 cells enter a state of receptivity to IL-2 vs IL-4 that can either promote C2GnT1 (and perhaps other glycosyltransferases) and selectin ligand expression or not. The differential induction of C2GnT1 and selectin ligand formation under these conditions is rapid and profound.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

Mice aged 9–16 wk were used for analyses. C57BL/6 (B6) mice were bred at the Biomedical Research Centre (University of British Columbia, Vancouver, British Columbia, Canada) from founders obtained originally from The Jackson Laboratory (Bar Harbor, ME). CD43-/- mice (24) backcrossed for eight generations with B6 mice (25) were used. C2GnT1null mice were kindly provided by Drs. J. Marth (Howard Hughes Medical Institute, University of California at San Diego, La Jolla, CA) and L. Ellies (Cancer Research Center, the Burnham Institute, La Jolla, CA) (26).

Media

Cell suspensions were prepared in RPMI 1640 medium (Life Technologies, Burlington, Canada) supplemented with 10% FCS, 5 x 10-5 M 2-ME, 100 U/ml penicillin, 100 U/ml streptomycin (StemCell Technologies, Vancouver, British Columbia, CA), and 2 mM glutamine (Sigma-Aldrich, St. Louis, MO).

Abs and flow cytometry

1B11 for Western blotting was produced from the original hybridoma (27) and 1B11-PE was obtained from BD PharMingen (San Diego, CA) (09695A). Human IgG1-P-selectin fusion protein (28111A; BD PharMingen) was detected with biotinylated anti-human IgG (109-065-098; Jackson ImmunoResearch Laboratories, West Grove, PA) and CyChrome-conjugated streptavidin (554062; BD PharMingen). H18 is a glycosylation-independent polyclonal rabbit antiserum specific for the intracellular portion of CD43 (27). mAb S7 (01601D; BD PharMingen) reacts with the 115-kDa (non-C2GnT-modified) form of CD43. CD8{alpha}-FITC (01044D; BD PharMingen) and CD8{beta}-biotin (CL8938B; Cedarlane Laboratories, Hornby, Ontario, Canada). Neutralizing anti-PSGL-1 Ab 2PH-1 (8) was kindly provided by Dr. D. Vestweber (University of Meunster, Meunster, Germany). Anti-CD45RB mAb 4B4 (28) was purified form hybridoma supernatants by protein G. For cell surface staining, cells were suspended in PBS containing 2% (v/v) FCS and incubated with Abs for 20–40 min on ice in 96-well round-bottom plates (catalog no. 163320, Nalge Nunc, Rochester, NY). Cells were washed twice and analyzed on a FACScan IV flow cytometer (BD Biosciences, Mountain View, CA). P-selectin staining was conducted in DMEM (Life Technologies) supplemented with 3% BSA. DMEM contains Ca2+ required for selectin binding but lacks biotin, which would interfere with detection of biotinylated secondary reagents. For negative controls, either P-selectin-hIg chimera was omitted or EDTA (5 mM) was included during staining with P-selectin-hIg to prevent specific binding. Binding of P-selectin-hIg chimera was detected with biotin-conjugated anti-human Ig and CyChrome-conjugated streptavidin. Geometric mean fluorescence values were used to summarize fluorescence histogram data where indicated.

Lymphocyte cultures

For methylcellulose cultures, IMDM base methylcellulose (MethoCult no. M3134; StemCell Technologies, Vancouver, British Columbia, Canada) was combined 1/1 with cells suspended in RPMI 1640 culture medium supplemented with 20% FCS. Primary stimulations were conducted with lymph node cells or splenocytes cultured at 106 cells/ml in 4 µg/ml Con A (C-0412; Sigma-Aldrich) for 48 h at 37°C in 5% CO2. Two- or 10-ml cultures were prepared in 24-well Falcon 3047 plates or 6-well Falcon 3046 plates respectively (BD Biosciences, Franklin Lakes, NJ). After 48 h cells were harvested, washed, counted, and replated in secondary cultures at 0.25 x 106 cells/ml with 5% IL-2 supernatant or at 0.05 x 106 cells/ml with 5% IL-4 supernatant for optimum differential induction of C2GnT1 unless otherwise indicated.

Cytokines and Western blotting

IL-2 and IL-4 were obtained as conditioned medium from the myeloma X.653 transfected with the cDNAs for murine IL-2 and IL-4, respectively (F. Melchers, Basel Institute of Immunology, Basel, Switzerland). Recombinant human IL-15 (247-IL; R&D Systems, Minneapolis, MN), gave maximal proliferative support for murine CD8+ T cells in secondary culture at >20 ng/ml and was used as 25 ng/ml in the data shown. Western blotting was conducted as previously described (29).

C2GnT activity assay

Cells were washed in PBS and lysed in 150 mM NaCl and 0.25% Triton X-100 with protease inhibitors (10 µg/ml soybean trypsin inhibitor, 40 µg/ml phenylmethyl-sulfonylfluoride, 10 µg/ml leupeptin, 0.5 µg/ml pepstatin) at 4°C. Transferase assays were performed in quadruplicate according to established protocols (30, 31). The reaction mixtures for the C2GnT assay contained 50 mM MES (pH 7.0), 0.5 µCi of uridine diphosphate N-acetyl-D-glucosamine (glucosamine-6-3H(N)) (NEN, Boston, MA), 1 mM uridine 5'-diphospho-N-acetylglucosamine (Sigma-Aldrich), 0.1 M GlcNAc, 1 mM Gal{beta}1–3GalNAc{alpha}-pNp (Toronto Research Chemicals, Toronto, Ontario, Canada), and 25 µl of cell lysate (8–15 mg/ml protein) in a total reaction volume of 50 µl. The mixtures were incubated for 2 h at 37°C then diluted to 5 ml with water and processed by C18 Sep-Pak (Waters, Mississauga, Ontario, Canada) column chromatography. After washing with water, the product was eluted using ethanol and the complete eluates were counted in a scintillation counter.

Semiquantitative RT-PCR

RNA was extracted using TRIzol Reagent (Life Technologies) according to the manufacturer’s instructions. Reverse transcription (RT) was performed with 2 µg of total RNA using Superscript (Life Technologies) in a 20-µl volume. The RT reaction was then diluted in 80 µl of water. Ten microliters of diluted RT was then removed and 2-fold serially diluted into six tubes, each containing 10 µl of water. One PCR control sample was prepared at the highest RNA concentration without RT reaction. Thirty microliters of PCR mix were added to each tube, resulting in final reactant concentrations of 25 U/ml Taq Platinum Polymerase (Life Technologies), 0.33 µM primers, 300 µM of each dNTP, 1.5 mM MgCl2, and 1x PCR buffer (20 mM Tris-HCl (pH 8.4) and 50 mM KCl). Reaction mixtures were subjected to 32 cycles of amplification, each one performed at 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min. After this treatment, 25 µl of RT-PCR products were separated by 2% agarose gel electrophoresis and stained in a solution containing 0.2 µg/ml ethidium bromide (Sigma-Aldrich). Transcriptional levels of different mRNAs were compared with RT-PCR performed with hypoxanthine phosphoribosyltransferase primers as an internal reference. PCR primers were purchased from Life Technologies and were specific for separate exons to avoid amplification of potential contaminating genomic DNA. Primer sequences are given from 5' to 3': C2GnT1 (accession no. D87332) forward, GAACTTGGCAGCACA, and reverse, CAATATATTTGCGTGTCCTGATGAAAGAGG; FucT VII (accession no. U45980) forward, GGACCTTGGGCTGAACCTACA, and reverse, TGGGTATTACTGGGCGATTCC; hypoxanthine phosphoribosyltransferase (accession no. BC004686) forward, CTCGAAGTGTTGGATACAGG, and reverse, TGGCCTATAGGCTCATAGTG.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
mAb 1B11 has dual specificity recognizing C2GnT-dependent epitopes on both CD43 and CD45RB; increased C2GnT1 branching activity or sialylation results in reduced recognition of the CD45RB epitope whereas both of these modifications are required for 1B11 recognition of CD43 (27, 29). This dual specificity of 1B11 for CD43 and CD45 precludes effective analysis of C2GnT1 activity in cells that express both of these molecules; therefore, we have restricted much of our analysis to expression of 1B11-CD45 in CD43null lymphocytes. We refer to these epitopes on CD43 and CD45RB as 1B11-CD43 and 1B11-CD45, respectively. In this study, 1B11 was used to probe cell surface O-glycans on murine CD8+ T cells to identify culture conditions that differentially affect expression of C2GnT1.

Activated CD43null T cells maintained in IL-2 lost reactivity with 1B11-CD45 (Fig. 1Go and Ref. 29), consistent with the C2GnT1 dependence of CD45RB recognition by 1B11 and the high levels of C2GnT1 expected in these cells (23). Our study began with the unexpected observation exemplified in Fig. 1Goa that 1B11-CD45 epitope expression on Con A-stimulated CD8+ T cells was maintained if cells were subcultured in medium without IL-2. This observation suggested that C2GnT1 induction might not be a direct consequence of activation but might instead be determined by IL-2. We considered several possible explanations for the observed loss of 1B11-CD45. First, IL-2 might support C2GnT1 expression indirectly by maintaining optimal cell viability. Second, IL-2 might down-regulate expression of CD45RB. Third, IL-2 might selectively induce C2GnT1 activity with consequent loss of the 1B11-CD45 epitope. Con A-activated T cells were subcultured in medium supplemented with either IL-2 or IL-4. Both cytokines were effective in supporting expansion of CD8+ cells over the 4-day culture period, but only IL-4-supplemented cultures maintained high levels of 1B11-CD45 expression (Fig. 1Gob). A similar influence of IL-2 was also observed in male Ag-specific T cell responses stimulated by male dendritic cells (H-Y peptide plus MHC; data not shown). Using another CD45RB-specific mAb (4B4) we found that expression of CD45RB was maintained in the presence of exogenous IL-2 (data not shown). Thus, the impact of IL-2 appeared to primarily affect the 1B11-CD45 epitope and not CD45RB protein expression per se. The differential effects of IL-2 and IL-4 were most dramatically evident in a simple two-step culture system summarized in Fig. 1Goc.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 1. IL-2 promotes loss of 1B11-CD45 expression on activated CD8+ T cells. CD43null spleen cells were stained with CD8 and 1B11 either ex vivo or after 2 or 4 days of culture. a, CD8–1B11 staining of ex vivo spleen cells, 2-day Con A cultures, or 4-day Con A cultures that had been subcultured 1/1 on day 2 with fresh medium without exogenous cytokine supplements. b, Day-4 Con A cultures were fed on day 2 with medium supplemented with IL-2 or IL-4 as indicated. c, Summary of primary and secondary culture sequence adopted for all experiments shown. *, Geometric mean 1B11 fluorescence on CD8-gated cells.

 
To confirm that C2GnT1 activity was differentially expressed in IL-2- vs IL-4-treated cells and to confirm the validity of our interpretation that differential 1B11-CD45 expression corresponded with core 2 activity we applied two different analyses, as shown in Fig. 2Go. C2GnT1 enzyme activity was assessed in lysates of cells exposed to cytokines. Substantial levels of total cellular C2GnT1 activity were detected in B6 cells exposed to IL-2 but not IL-4, as shown in Fig. 2Goa. Lymphocytes from C2GnT1null mice failed to express detectable C2GnT1 activity even when cultured with IL-2. These results confirm that C2GnT1 enzyme activity is indeed differentially induced by IL-2 and IL-4.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 2. IL-2 and IL-4 differentially regulate cellular C2GnT enzyme activity and O-glycan branching on CD43. Spleen cells prepared from B6, C2null, or CD43null mice were stimulated with Con A for 2 days and then expanded in secondary cultures to achieve the maximum differential expression of 1B11-CD45 as described in Materials and Methods. Cultures were harvested on day 4 and lysed for either C2GnT enzyme assay (a) or CD43 immunoprecipitation and immunoblotting (b) (arrow indicates the approximate location of a 123-kDa molecular mass marker). 2, IL2-supplemented cultures; 4, IL-4 supplemented cultures.

 
To confirm that physiological substrates were differentially subjected to C2GnT1 modification in response to IL-2 vs IL-4, we evaluated properties of CD43. CD43 has served as a model substrate for study of O-glycosylation, and both its electrophoretic mobility and reactivity with glycosylation-sensitive Abs have been used to monitor glycosyltransferase activity (23, 26, 32, 33). CD43 in resting T cells is modified with unbranched core 1 structures, whereas in activated T cells these O-glycans are branched through action of C2GnT (23). The transition to branched O-glycans can be tracked electrophoretically by a shift in apparent molecular mass from 115 kDa to 130 kDa, or with Abs that distinguish these CD43 glycoforms. mAb S7 is specific for the 115-kDa unbranched core 1-modified glycoform of CD43 (33), whereas mAb 1B11 recognizes the 130-kDa form but not the 115-kDa form of CD43 (27). To evaluate the level of C2GnT1 activity in activated cells grown in IL-2 vs IL-4, CD43 was immunoprecipitated and immunoprobed with pan-CD43-specific Ab H18 or with glycoform-specific Abs S7 and 1B11, as shown in Fig. 2Gob. The 115-kDa core 1-modified form of CD43 detected by S7 was predominant in unstimulated lymph node cells as expected. When B6 CD43+ cells were activated and cultured with IL-2, the 130-kDa form of CD43 detected by 1B11 was predominant, with very little 115-kDa form detected by S7. In contrast, cells cultured with IL-4 prominently expressed the 115-kDa lower molecular mass form of CD43 with evidence of some >115-kDa species. CD43 immunoprecipitates of parallel cultures of C2GnT1null lymphocytes expressed only the S7-detected core 1 O-glycan-modified CD43. Collectively our results demonstrated that in activated CD8+ T cells IL-2 selectively promotes expression of C2GnT1 activity while IL-4 does not, observations contrary to the view that C2GnT1 induction occurs as a direct consequence of T cell activation. Clearly, factors in addition to activation determine whether C2GnT1 is expressed. Moreover, these observations affirm the use of 1B11 to monitor C2GnT1 activity in CD8 cells from CD43null mice.

To examine the relative contributions of IL-2 and IL-4 on C2GnT1 activity, both cytokines were added to secondary cultures of CD43null lymphocytes, as shown in Fig. 3Goa. 1B11-CD45 expression was lost on cells exposed to IL-2 plus IL-4, as had been observed for cells exposed to IL-2 alone. This result suggested that the C2GnT-inductive influence of IL-2 was not blocked by IL-4 and contrasted with previous observations by others that IL-4 could inhibit expression of FucT VII, an enzyme acting downstream of C2GnT1 in P-selectin-ligand synthesis. Thus IL-2 appeared to be particularly effective in promoting C2GnT1 activity in activated CD8+ T cells and IL-4 appeared to be devoid of a modulating effect.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 3. IL-4 does not block IL-2-induced C2GnT (a) and effects of tissue origin and culture density on C2GnT expression (b). a, Two-day Con A-activated CD43null spleen cells were subcultured with either IL-2, IL-4, or IL-2 plus IL-4 in 2-day secondary cultures and then stained for CD8 and 1B11. b, Cells derived from either spleen or lymph node were stimulated with Con A as described in Materials and Methods. On day 2 cells were washed, subcultured in 2-ml wells at different cell densities with either IL-2 or IL-4 cytokine supplements for an additional 2 days, and then stained with 1B11 and CD8. Geometric mean 1B11 fluorescence values shown correspond to the CD8 gated cells only. Secondary cultures at 106 cells/well (open bar), 0.5 x 106 cells/well (stippled bar), 2.5 x 105 cells/well (checked bar), and 105 cells/well (filled bar). Results presented are consistent with 12 experiments examining culture density effects or differential responses of spleen vs lymph node.

 
In addition to cytokines we observed two additional factors that influenced the loss of 1B11-CD45 epitope expression. These included the source of T cells and the density of secondary culture. Secondary cultures of spleen cells consistently resulted in lower 1B11-CD45 epitope expression than parallel cultures from lymph node (Fig. 3Gob). Furthermore, secondary cultures maintained at low density expressed higher levels of 1B11-CD45 than parallel cultures maintained at higher cell densities.

The culture density effects and the tissue-specific effects were highly reproducible and had a substantial modifying influence on 1B11-CD45 expression in cytokine-supplemented secondary cultures. These sources of influence might arise if, in addition to IL-2, cell-cell contact or other cytokines were required for C2GnT1 induction. IL-2-supplemented cultures were indeed distinguished by formation of large multicellular aggregates driven by {beta}2 integrin activation (34), and the cytokines TGF-{beta} and IL-12 have been identified as potent inducers of FucT VII expression that act after branch formation by C2GnT1 to complete selectin ligands on CD4 cells (13, 14).

To determine whether CD8+ T cells responded to IL-2 and IL-4 independently of other cells, CD8+ cells from 2-day primary cultures were sorted by flow cytometry on the basis of CD8{alpha} and CD8{beta} coexpression and subcultured in IL-2 or IL-4. Purified CD8 T cells should be effectively depleted of subpopulations that produce IL-12. As shown in Fig. 4Gob, purified CD8 T cells retained full capacity to form homotypic aggregates and lost 1B11-CD45 expression in response to IL-2 (Fig. 4Goa). To evaluate whether TGF-{beta}1 might participate in IL-2-induced loss of 1B11-CD45, high concentrations of neutralizing anti-TGF-{beta}1 were included during the secondary culture without effect (data not shown). To determine whether cell-cell contact between CD8 cells was required for modulation of 1B11-CD45 in IL-2-supplemented cultures, secondary cultures were plated in methylcellulose containing medium. As shown in Fig. 4Goc, IL-2-induced loss of 1B11-CD45 expression was observed in these dispersed cultures. Collectively these results were most consistent with the view that cell-cell contact was not required for IL-2 induction of C2GnT1 and that the influence of tissue source and cell density on C2GnT induction were due to some factor other than IL-12 or TGF-{beta}.



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 4. C2GnT induction by IL-2 is CD8+ cell autonomous and cell-cell contact independent. a, CD8{alpha}+{beta}+ day-2 CD43null Con A blasts were purified by cell sorting and incubated in secondary culture for an additional 2 days with either IL-2 or IL-4 as described in Materials and Methods. On day 4 cells were harvested and stained with CD8-FITC and 1B11-PE for analysis by flow cytometry. b, Day-3 light micrograph of secondary culture of CD8{alpha}+{beta}+ cells from a. c, CD8–1B11 profiles of Con A-stimulated lymphocytes after secondary culture with cytokine supplements in liquid medium or semisolid medium containing methylcellulose. Geometric mean 1B11 fluoresence intensity values of CD8+ cells are indicated in each dot plot.

 
The induction of C2GnT1-mediated branching of O-glycans is the first step in a sequence of modifications required to generate ligands recognized by selectins. Therefore, we evaluated P-selectin ligand expression on cells cultured in the presence of IL-2 or IL-4. As shown in Fig. 5Goa, IL-2-supplemented cultures expressed high levels of P-selectin ligand, whereas cells from IL-4-supplemented cultures exhibited a reduced multiphasic profile of P-selectin staining. This staining pattern was also evident in gated analysis of CD8+ cells (Fig. 5Gob). Cell surface expression of PSGL-1, the primary ligand for P-selectin, was marginally higher in IL-4-cultured cells than in IL-2-cultured cells (data not shown), confirming that cell surface PSGL-1 protein expression was not inhibited by IL-4. Notably, the subpopulation of IL-4-treated cells binding P-selectin was consistently observed using our culture conditions (see Discussion). This binding was C2GnT dependent (Fig. 5Goa) and PSGL-1 dependent (blocked with anti-PSGL-1; data not shown). Thus, short-term exposure of day 2-activated CD8 T cells to IL-2 effectively supported full synthesis of selectin ligand, whereas IL-4 was significantly less effective.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 5. P-selectin ligand is preferentially expressed on CD8+ cells grown in IL-2. a, B6 and C2GnTnull spleen cells were stimulated with Con A as described in Materials and Methods and placed in secondary cultures at 0.25 x 106 cells/ml with IL-2 or at 0.05 x 106 cells/ml with IL-4 and then viable cells were stained for P-selectin ligand expression with P-selectin-hIg. Samples stained without primary P-selectin-hIg (unstained) or with P-selectin-hIg plus EDTA served as negative controls for P-selectin recognition. b, Same as a, except cultures were derived from both spleen and lymph node of CD43null mice. Staining profiles for both P-selectin and 1B11 are shown for CD8+ gated cells only, and IL-2 was used in conjunction with IL-4 where indicated. Geometric mean fluorescence values are shown for each histogram and summarized in c. The data shown are representative of nine experiments evaluating 1B11 expression on IL-2- vs IL-4- vs IL-2 plus IL-4-treated cells, or P-selectin expression on IL-2- vs IL-4- or IL-2 plus IL-4-treated cells.

 
Experiments described above demonstrated that IL-4 did not block the IL-2-driven loss of 1B11-CD45. However, IL-4 has been shown to inhibit FucT VII transcription required for P-selectin ligand formation in CD4+ cells (13). Therefore, we tested whether IL-4 interfered with IL-2-induced P-selectin ligand formation on CD8+ cells by supplementing secondary cultures with either IL-2, IL-4, or IL-2 plus IL-4. The results in Fig. 5Goc show that IL-4 partially blocked formation of P-selectin ligand while not affecting loss of 1B11-CD45 expression. These results are consistent with observations that in CD8+ cells IL-4 can interfere with some step(s) in construction of P-selectin ligand, such as FucT VII induction, but does not appear to block IL-2-induced C2GnT1 expression.

To investigate the specificity of IL-2 in regulating 1B11-CD45 expression, IL-12 and a panel of {gamma}c cytokines including IL-2, IL-4, IL-7, and IL-15 were used to supplement secondary cultures of Con A-activated CD43null lymphocytes. Of these cytokines IL-2, IL-4, and IL-15 provided the best support for cell growth, and IL-2 was most effective in inducing C2GnT1 activity. When compared with IL-4 and IL-2, IL-15 exhibited intermediate activity in supporting C2GnT1 activity as measured by loss of 1B11-CD45 expression, as shown in Fig. 6Go. The relative differences among IL-2, IL-4, and IL-15 in regulating 1B11-CD45 expression were maintained over a range of cytokine concentrations (including those that approached maximal growth support). IL-12 and IL-7 were less effective in supporting expansion of activated CD8 cells and, like IL-4, did not cause appreciable loss of 1B11-CD45 (data not shown). Cells grown in IL-15, IL-2, and IL-4 were also compared for P-selectin ligand binding. Consistent with its intermediate activity at C2GnT1 induction relative to IL-2, IL-15 did not support full synthesis of P-selectin ligand. Thus, despite the similarity of IL-15 and IL-2 as T cell growth factors signaling through common {beta}{gamma} receptor subunits, IL-15 was less effective than IL-2 with respect to both C2GnT1 and P-selectin ligand induction.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. IL-15 has intermediate C2GnT-inducing activity but marginal P-selectin ligand-inducing activity. Mean fluorescence staining with 1B11 (a) or P-selectin-hIg chimera (b) evaluated on CD43null cells derived from 1 ml of secondary cultures including 105 day-2 Con A blasts and either IL-2, IL-4, or IL-15. Open bars in b represent geometric mean fluorescence values for cells that were not exposed to P-selectin-hIg but that were exposed to anti-hIg-biotin and streptavidin-CyChrome. The results presented are representative of seven experiments that addressed either 1B11 or P-selectin ligand expression on IL-2- vs IL-4- vs IL-15-treated cells.

 
The data presented above suggested that C2GnT1 activity was differentially regulated by IL-2 and IL-4. To determine whether IL-2 affected C2GnT1 RNA levels, semiquantitative RT-PCR was performed on RNA isolated from cells maintained in secondary culture with either IL-2 or IL-4. Amplification of titrated RT reactions as shown in Fig. 7Go demonstrated 4-fold differences in C2GnT1 and FucT VII RNA expression between IL-2 and IL-4 treatment groups.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 7. C2GnT1 and FucT VII RNA levels are elevated after treatment with IL-2 when compared with IL-4. RT-PCR was conducted as described in Materials and Methods from RNA samples from IL-2- or IL-4-supplemented secondary cultures of B6 (CD43+) Con A-stimulated splenocytes (lanes 1–7) or C2GnT1null Con A-stimulated splenocytes (lane 8). Lane 1 corresponds to PCR amplification of RT product from 200 ng of starting RNA and lanes 2–6 are PCR amplifications of serial 2-fold dilutions of the RT used for lane 1. Lane 7 samples were PCR amplifications of 200 ng of starting RNA without RT.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The essential finding reported in this manuscript is that induction of C2GnT1 activity and P-selectin ligand expression by CD8+ T cells is not an invariant consequence of T cell activation but is differentially regulated after activation by exposure to the cytokines IL-2 or IL-4. This observation is important because of the essential contribution of branched O-glycans in generating selectin ligands and the contribution of P-selectin ligands to leukocyte migration. Defining the factors that regulate glycosyltransferase activities required for selectin ligand synthesis should aid construction of comprehensive models of lymphocyte migration.

The effects of IL-2 and IL-4 are likely to be of physiological importance for the following reasons. First, the differential effects of IL-2 vs IL-4 on C2GnT1 expression were relatively rapid, occurring over the 2-day secondary culture. Second, the effects were substantial at the level of C2GnT1 enzyme activity and modification of a physiological substrate, CD43. Third, vigorous polarizing treatments typically applied to deviate T cell differentiation toward Th1 vs Th2 were not required. Differential C2GnT1 expression could be demonstrated simply by supplementing media with either IL-2 or IL-4 for 2 days. When we conducted intracellular staining for IFN-{gamma} in cells cultured with either exogenous IL-2 or IL-4, both cell populations exhibited comparable levels of staining, suggesting that classical polarization had not occurred (data not shown). These observations collectively suggested that the differential effects of IL-2 and IL-4 on core 2 O-glycan branch formation were likely to be primary, and physiologically relevant, consequences of these prototype cytokines.

The origins of the view that T cell activation was invariably accompanied by C2GnT1 induction arose from early investigations of human PBL activated by anti-CD3 (OKT3) in the presence of exogenous IL-2 (23); not surprisingly, such cells expressed high levels of C2GnT1 compared with their unstimulated counterparts. In more recent reports, C2GnT1 was said to be induced in response to mitogens (32, 35) despite earlier contrary data (23, 36) and recognition that additional factors may likely regulate C2GnT (37). This led to the general misconception that C2GnT1 was expressed as an invariant consequence of T cell activation. Thus, although the requirement for C2GnT1 activity in formation of selectin ligand on O-glycans is clear (38), the regulatory influence of cytokines on C2GnT1 expression had not been established.

More recent studies focusing on regulation of selectin ligand expression in CD4+ Th1 and Th2 cells have indicated that Th1 cells bind P-selectin, whereas Th2 cells do not. Differences in P-selectin ligand synthesis have been uniformly ascribed to the differential expression of FucT VII driven by Th1 polarizing conditions including IL-12, anti-IFN-{gamma}, and anti-IL-4 (12, 13, 14, 15, 16, 17). In these studies lack of P-selectin ligand expression in Th2 cells was ascribed to inhibition of FucT VII expression by IL-4 (13, 16). When C2GnT1 expression was examined in polarized cells there was no apparent difference between Th1 and Th2 cells (13, 15, 16). However, in these studies and in most other studies on selectin ligand synthesis, IL-2 was used to supplement media during preparation of both Th1- vs Th2-polarized CD4 cells (12, 13, 14, 15, 16, 17). Assuming our observations with CD8+ cells apply to the CD4+ cell analyses described above, we would expect that such inclusion of IL-2 would have induced C2GnT1 and thereby obscured differential regulation of C2GnT1 by IL-2 vs IL-4. The fact that C2GnT1 was induced when secondary cultures included both IL-2 and IL-4 demonstrates that the inhibitory action of IL-4 on the expression of FucT VII in CD4 cells does not extend to inhibition of C2GnT1 expression in CD8+ cells. Recent analysis of P-selectin ligand synthesis in IL-2-supplemented cultures of human CD4 cells have documented the efficiency of IL-12/TGF-{beta} vs IL-4 in regulating FucT VII RNA expression (13, 14). Our studies have dealt with mouse CD8+ cells exclusively, and we did not identify prominent roles for either IL-12 or TGF-{beta} in C2GnT1 induction.

The importance of P-selectin and its primary ligand PSGL-1 on activated T cells (39) has been established in several systems. CD4+ cells polarized to Th1 cells successfully migrate to inflamed skin, whereas Th2 cells do not (7, 8, 9), and the migration of Th1 cells could be blocked with Abs to P-/E-selectin (7, 8, 10) or PSGL-1 (8). Because Th2 also express PSGL-1, Borges et al. (8) concluded that it was the form of PSGL-1 that distinguished migratory behavior of Th1 and Th2 cells. Recent observations with P-selectin-deficient mice have demonstrated that PSGL-1 can also serve as an effective target of E-selectin-mediated migration of Th1 cells into inflamed skin (9). Thus, the cytokine dependence of P-selectin ligand formation we have described in CD8+ T cells may also apply to formation of physiologically relevant E-selectin targets including PSGL-1 itself.

Because Con A stimulation efficiently induces IL-2 expression (40) and IL-2 drives C2GnT1 expression, why was exogenous IL-2 required to observe full C2GnT1 induction? It is known that supernatants of mitogen-stimulated cells reach peak levels of IL-2 within 48 h of mitogen stimulation and decline (40). This primary autonomous growth phase is driven by autocrine IL-2 as described by Harding et al. (41) and more recently by others (42, 43, 44). Thereafter, cells retain the capacity to extract IL-2 from media and proliferate in response to exogenous IL-2. IL-2 produced during the initial 2-day stimulation is not sufficient to fully induce C2GnT1 by day 4 because cells subcultured in medium without exogenous cytokine retain a significant 1B11-CD45 signal. Therefore, our results are most consistent with existence of a time window after day 2 where exogenous IL-2 must be available to achieve full C2GnT1 induction by day 4 and that selectin ligand synthesis is determined by the ambient cytokine environment present during this period. Recent analysis of CD8+ T cell responses activated in a costimulation-dependent process to Ag-bearing tumor cells in the peritoneum, identified a pattern of IL-2 production and subsequent IL-2-dependent migration that may be relevant to the current analysis (45, 46). The implications of our results for in vivo generation of P-selectin ligand formation are that once autocrine IL-2 production is terminated CD8 cells may require sustained exposure to IL-2 to achieve normal selectin-dependent migratory patterns and that insufficient IL-2 would fail to support O-glycan branching with consequent impairment in selectin ligand expression and altered homing ability.

When Con A-activated cells were cultured in IL-4, 1B11-CD45 expression was relatively high while C2GnT1 activity and P-selectin binding were correspondingly low. However, surprisingly high levels of P-selectin binding were consistently evident on a fraction of CD8+ cells in these cultures and could be a physiologically important cell population under conditions of limiting IL-2. Thus, despite the low C2GnT1 enzymatic activity at the population level and IL-4’s reported inhibition of FucT VII RNA expression in CD4 cells, P-selectin ligand synthesis did proceed in some CD8+ cells. This unexpected result suggested that heterogeneity existed among CD8+ cells in culture. Because anti-PSGL-1 Ab effectively blocked all P-selectin binding to IL-4-treated CD8+ cells (data not shown), P-selectin binding was not mediated by alternate ligands. To reconcile P-selectin ligand formation on PSGL-1 on a subpopulation of IL-4-treated CD8+ cells, we refer to early literature documenting autocrine production of IL-2 by a fraction of CD8 cells stimulated with Con A (47), trinitrophenyl-coupled stimulators (48), or in allogeneic MLR (49). Similar heterogeneity in CD8+ cells was more recently documented in mice expressing green fluoresence protein regulated by the IL-2 promoter (50). Therefore, we speculate that autocrine IL-2 production by a fraction of CD8+ cells may support P-selectin ligand synthesis in an otherwise IL-2-depleted secondary culture. Why such heterogeneity in P-selectin binding was not paralleled by heterogeneity in 1B11-CD45 expression is a lingering question that we have not yet resolved.

Our study focused on differential C2GnT1 induction by IL-2, IL-4, and IL-15, because these are primary growth factors for activated T cells. Despite shared {beta} and {gamma}c receptor components, IL-2 and IL-15 differ functionally with respect to their roles in promoting activation-induced cell death and maintenance of memory pools of CD8+ T cells, respectively (51, 52, 53). We found that IL-15 effectively supported CD8+ cell expansion in secondary cultures, but displayed an intermediate ability to induce C2GnT1 expression and P-selectin ligand expression. Thus, in addition to distinct roles in CD8+ cell homeostasis, IL-2 and IL-15 also differentially regulate expression of P-selectin ligand.

In summary, we have shown that in CD8+ T cells C2GnT1 expression is regulated by cytokine and its induction is not a direct invariant consequence of T cell activation. Because IL-2 and IL-4 have dramatically different consequences for a multiplicity of adhesion systems, we anticipate that resolving functional impact in vivo arising from the changes we have documented may not be trivial. Nevertheless, our analysis of C2GnT1 expression has implications for cell migration because C2GnT activity is required to generate selectin ligands that mediate the first phase of leukocyte extravasation.


    Acknowledgments
 
We thank Drs. Lesley Ellies and Jamey Marth for provision of the C2GnTnull mouse and Dr. Dietmar Vestweber for provision of the anti-PSGL-1 Ab 2PH1.


    Footnotes
 
1 This work was supported by Grant MOP 13712 from the Medical Research Council of Canada. S.Y.C. was supported by a fellowship from Association pour la Recherche sur le Cancer, France. Back

2 Address correspondence and reprint requests to Dr. Douglas A. Carlow, Biomedical Research Centre, University of British Columbia, 2222 Health Sciences Mall, Vancouver, British Columbia V6T-1Z3, Canada. E-mail address: doug{at}brc.ubc.ca Back

3 Abbreviations used in this paper: C2GnT, core 2 {beta}1–6 N-acetylglucosaminyl transferase; PSGL-1, P-selectin glycoprotein ligand 1; FucT, fucosyltransferase; RT, reverse transcription. Back

Received for publication August 15, 2001. Accepted for publication October 15, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Leppanen, A., S. P. White, J. Helin, R. P. McEver, R. D. Cummings. 2000. Binding of glycosulfopeptides to P-selectin requires stereospecific contributions of individual tyrosine sulfate and sugar residues. J. Biol. Chem. 275:39569.[Abstract/Free Full Text]
  2. Somers, W. S., J. Tang, G. D. Shaw, R. T. Camphausen. 2000. Insights into the molecular basis of leukocyte tethering and rolling revealed by structures of P- and E-selectin bound to sLex and PSGL-1. Cell 103:467.[Medline]
  3. Weninger, W., L. H. Ulfman, G. Cheng, N. Souchkova, E. J. Quackenbush, J. B. Lowe, U. H. von Andrian. 2000. Specialized contributions by {alpha}(1,3)-fucosyltransferase-IV and FucT-VII during leukocyte rolling in dermal microvessels. Immunity 12:665.[Medline]
  4. Robinson, S. D., P. S. Frenette, H. Rayburn, M. Cummiskey, M. Ullman-Cullere, D. D. Wagner, R. O. Hynes. 1999. Multiple, targeted deficiencies in selectins reveal a predominant role for P-selectin in leukocyte recruitment. Proc. Natl. Acad. Sci. USA 96:11452.[Abstract/Free Full Text]
  5. Levesque, J. P., A. C. Zannettino, M. Pudney, S. Niutta, D. N. Haylock, K. R. Snapp, G. S. Kansas, M. C. Berndt, P. J. Simmons. 1999. PSGL-1-mediated adhesion of human hematopoietic progenitors to P-selectin results in suppression of hematopoiesis. Immunity 11:369.[Medline]
  6. Jung, U., K. Ley. 1999. Mice lacking two or all three selectins demonstrate overlapping and distinct functions for each selectin. J. Immunol. 162:6755.[Abstract/Free Full Text]
  7. Austrup, F., D. Vestweber, E. Borges, M. Lohning, R. Brauer, U. Herz, H. Renz, R. Hallmann, A. Scheffold, A. Radbruch, A. Hamann. 1997. P- and E-selectin mediate recruitment of T-helper-1 but not T-helper-2 cells into inflamed tissues. Nature 385:81.[Medline]
  8. Borges, E., W. Tietz, M. Steegmaier, T. Moll, R. Hallmann, A. Hamann, D. Vestweber. 1997. P-selectin glycoprotein ligand-1 (PSGL-1) on T helper 1 but not on T helper 2 cells binds to P-selectin and supports migration into inflamed skin. J. Exp. Med. 185:573.[Abstract/Free Full Text]
  9. Hirata, T., G. Merrill-Skoloff, M. Aab, J. Yang, B. C. Furie, B. Furie. 2000. P-Selectin glycoprotein ligand 1 (PSGL-1) is a physiological ligand for E-selectin in mediating T helper 1 lymphocyte migration. J. Exp. Med. 192:1669.[Abstract/Free Full Text]
  10. Tietz, W., Y. Allemand, E. Borges, D. von Laer, R. Hallmann, D. Vestweber, A. Hamann. 1998. CD4+ T cells migrate into inflamed skin only if they express ligands for E- and P-selectin. J. Immunol. 161:963.[Abstract/Free Full Text]
  11. van Wely, C. A., A. D. Blanchard, C. J. Britten. 1998. Differential expression of {alpha}3 fucosyltransferases in Th1 and Th2 cells correlates with their ability to bind P-selectin. Biochim. Biophys. Acta 247:307.
  12. Blander, J. M., I. Visintin, Jr C. A. Janeway, R. Medzhitov. 1999. {alpha}(1,3)-Fucosyltransferase VII and {alpha}(2,3)-sialyltransferase IV are up-regulated in activated CD4 T cells and maintained after their differentiation into Th1 and migration into inflammatory sites. J. Immunol. 163:3746.[Abstract/Free Full Text]
  13. Wagers, A. J., C. M. Waters, L. M. Stoolman, G. S. Kansas. 1998. Interleukin 12 and interleukin 4 control T cell adhesion to endothelial selectins through opposite effects on {alpha}1,3-fucosyltransferase VII gene expression. J. Exp. Med. 188:2225.[Abstract/Free Full Text]
  14. Wagers, A. J., G. S. Kansas. 2000. Potent induction of {alpha}(1,3)-fucosyltransferase VII in activated CD4+ T cells by TGF-{beta}1 through a p38 mitogen-activated protein kinase-dependent pathway. J. Immunol. 165:5011.[Abstract/Free Full Text]
  15. Lim, Y. C., L. Henault, A. J. Wagers, G. S. Kansas, F. W. Luscinskas, A. H. Lichtman. 1999. Expression of functional selectin ligands on Th cells is differentially regulated by IL-12 and IL-4. J. Immunol. 162:3193.[Abstract/Free Full Text]
  16. Nakayama, F., Y. Teraki, T. Kudo, A. Togayachi, H. Iwasaki, T. Tamatani, S. Nishihara, Y. Mizukawa, T. Shiohara, H. Narimatsu. 2000. Expression of cutaneous lymphocyte-associated antigen regulated by a set of glycosyltransferases in human T cells: involvement of {alpha}1,3-fucosyltransferase VII and {beta}1,4-galactosyltransferase I. J. Invest. Dermatol. 115:299.[Medline]
  17. Xie, H., Y. C. Lim, F. W. Luscinskas, A. H. Lichtman. 1999. Acquisition of selectin binding and peripheral homing properties by CD4+ and CD8+ T cells. J. Exp. Med. 189:1765.[Abstract/Free Full Text]
  18. Cerwenka, A., T. M. Morgan, A. G. Harmsen, R. W. Dutton. 1999. Migration kinetics and final destination of type 1 and type 2 CD8 effector cells predict protection against pulmonary virus infection. J. Exp. Med. 189:423.[Abstract/Free Full Text]
  19. Wang, B., H. Fujisawa, L. Zhuang, I. Freed, B. G. Howell, S. Shahid, G. M. Shivji, T. W. Mak, D. N. Sauder. 2000. CD4+ Th1 and CD8+ type 1 cytotoxic T cells both play a crucial role in the full development of contact hypersensitivit. J. Immunol. 165:6783.[Abstract/Free Full Text]
  20. Mukasa, R., T. Homma, O. Hosono, S. Yoshino, K. Nishioka, M. Fukuda, C. Morimoto. 1999. Human T lymphocyte populations which bind to P- or E-selectin are enriched with cells expressing core 2 O-glycans. Immunol. Lett. 67:117.[Medline]
  21. Li, F., P. P. Wilkins, S. Crawley, J. Weinstein, R. D. Cummings, R. P. McEver. 1996. Post-translational modifications of recombinant P-selectin glycoprotein ligand-1 required for binding to P- and E-selectin. J. Biol. Chem. 271:3255.[Abstract/Free Full Text]
  22. Kumar, R., R. T. Camphausen, F. X. Sullivan, D. A. Cumming. 1996. Core2 {beta}-1,6-N-acetylglucosaminyltransferase enzyme activity is critical for P-selectin glycoprotein ligand-1 binding to P-selectin. Blood 88:3872.[Abstract/Free Full Text]
  23. Piller, F., V. Piller, R. I. Fox, M. Fukuda. 1988. Human T-lymphocyte activation is associated with changes in O-glycan biosynthesis. J. Biol. Chem. 263:15146.[Abstract/Free Full Text]
  24. Manjunath, N., M. Correa, M. Ardman, B. Ardman. 1995. Negative regulation of T-cell adhesion and activation by CD43. Nature 377:535.[Medline]
  25. Carlow, D. A., S. Y. Corbel, H. J. Ziltener. 2001. Absence of CD43 fails to alter T cell development and responsiveness. J. Immunol. 166:256.[Abstract/Free Full Text]
  26. Ellies, L. G., S. Tsuboi, B. Petryniak, J. B. Lowe, M. Fukuda, J. D. Marth. 1998. Core 2 oligosaccharide biosynthesis distinguishes between selectin ligands essential for leukocyte homing and inflammation. Immunity 9:881.[Medline]
  27. Jones, A. T., B. Federsppiel, L. G. Ellies, M. J. Williams, R. Burgener, V. Duronio, C. A. Smith, F. Takei, H. J. Ziltener. 1994. Characterization of the activation-associated isoform of CD43 on murine T lymphocytes. J. Immunol. 153:3426.[Abstract]
  28. Birkeland, M. L., P. Johnson, I. S. Trowbridge, E. Pure. 1989. Changes in CD45 isoform expression accompany antigen-induced murine T-cell activation. Proc. Natl. Acad. Sci. USA 86:6734.[Abstract/Free Full Text]
  29. Carlow, D. A., B. Ardman, H. J. Ziltener. 1999. A novel CD8 T cell-restricted CD45RB epitope shared by CD43 is differentially affected by glycosylation. J. Immunol. 163:1441.[Abstract/Free Full Text]
  30. Bierhuizen, M. F., M. Fukuda. 1992. Expression cloning of a cDNA encoding UDP-GlcNAc:Gal {beta} 1–3-GalNAc-R (GlcNAc to GalNAc) {beta} 1–6GlcNAc transferase by gene transfer into CHO cells expressing polyoma large tumor antigen. Proc. Natl. Acad. Sci. USA 89:9326.[Abstract/Free Full Text]
  31. Saitoh, O., R. E. Gallagher, M. Fukuda. 1991. Expression of aberrant O-glycans attached to leukosialin in differentiation-deficient HL-60 cells. Cancer Res. 51:2854.[Abstract/Free Full Text]
  32. Tsuboi, S., M. Fukuda. 1997. Branched O-linked oligosaccharides ectopically expressed in transgenic mice reduce primary T-cell immune responses. EMBO J. 16:6364.[Medline]
  33. Barran, P., W. Fellinger, C. E. Warren, J. W. Dennis, H. J. Ziltener. 1997. Modification of CD43 and other lymphocyte O-glycoproteins by core 2 N-acetylglucosaminyltransferase. Glycobiology 7:129.[Abstract/Free Full Text]
  34. Nielsen, M., A. Svejgaard, S. Skov, P. Dobson, K. Bendtzen, C. Geisler, N. Odum. 1996. IL-2 induces {beta}2-integrin adhesion via a wortmannin/LY294002-sensitive, rapamycin-resistant pathway: phosphorylation of a 125-kDa protein correlates with induction of adhesion, but not mitogenesis. J. Immunol. 157:5350.[Abstract]
  35. Tsuboi, S., M. Fukuda. 1998. Overexpression of branched O-linked oligosaccharides on T cell surface glycoproteins impairs humoral immune responses in transgenic mice. J. Biol. Chem. 273:30680.[Abstract/Free Full Text]
  36. Andersson, L. C., C. G. Gahmberg, A. K. Kimura, H. Wigzell. 1978. Activated human T lymphocytes display new surface glycoproteins. Proc. Natl. Acad. Sci. USA 75:3455.[Abstract/Free Full Text]
  37. Yousefi, S., E. Higgins, Z. Daoling, A. Pollex-Kruger, O. Hindsgaul, J. W. Dennis. 1991. Increased UDP-GlcNAc:Gal {beta} 1–3GaLNAc-R (GlcNAc to GaLNAc) {beta}-1,6-N-acetylglucosaminyltransferase activity in metastatic murine tumor cell lines: control of polylactosamine synthesis. J. Biol. Chem. 266:1772.[Abstract/Free Full Text]
  38. Vestweber, D., J. E. Blanks. 1999. Mechanisms that regulate the function of the selectins and their ligands. Physiol. Rev. 79:181.[Abstract/Free Full Text]
  39. Vachino, G., X. J. Chang, G. M. Veldman, R. Kumar, D. Sako, L. A. Fouser, M. C. Berndt, D. A. Cumming. 1995. P-selectin glycoprotein ligand-1 is the major counter-receptor for P-selectin on stimulated T cells and is widely distributed in non-functional form on many lymphocytic cells. J. Biol. Chem. 270:21966.[Abstract/Free Full Text]
  40. Gillis, S., M. M. Ferm, W. Ou, K. A. Smith. 1978. T cell growth factor: parameters of production and a quantitative microassay for activity. J. Immunol. 120:2027.[Abstract/Free Full Text]
  41. Harding, F. A., J. P. Allison. 1993. CD28–B7 interactions allow the induction of CD8+ cytotoxic T lymphocytes in the absence of exogenous help. J. Exp. Med. 177:1791.[Abstract/Free Full Text]
  42. Kaech, S. M., R. Ahmed. 2001. Memory CD8+ T cell differentiation: initial antigen encounter triggers a developmental program in naive cells. Nat. Immunol. 2:415.[Medline]
  43. van Stipdonk, M. J., E. E. Lemmens, S. P. Schoenberger. 2001. Naive CTLs require a single brief period of antigenic stimulation for clonal expansion and differentiation. Nat. Immunol. 2:423.[Medline]
  44. Mercado, R., S. Vijh, S. E. Allen, K. Kerksiek, I. M. Pilip, E. G. Pamer. 2000. Early programming of T cell populations responding to bacterial infection. J. Immunol. 165:6833.[Abstract/Free Full Text]
  45. Shrikant, P., A. Khoruts, M. F. Mescher. 1999. CTLA-4 blockade reverses CD8+ T cell tolerance to tumor by a CD4+ T cell- and IL-2-dependent mechanism. Immunity 11:483.[Medline]
  46. Deeths, M. J., R. M. Kedl, M. F. Mescher. 1999. CD8+ T cells become nonresponsive (anergic) following activation in the presence of costimulation. J. Immunol. 163:102.[Abstract/Free Full Text]
  47. Pfizenmaier, K., P. Scheurich, W. Daubener, M. Kronke, M. Rollinghoff, H. Wagner. 1984. Quantitative representation of all T cells committed to develop into cytotoxic effector cells and/or interleukin 2 activity-producing helper cells within murine T lymphocyte subsets. Eur. J. Immunol. 14:33.[Medline]
  48. Schmitt, J., H. Wagner, K. Heeg. 1988. Reactivity of Ly-2+ T cells against 2,4,6-trinitrophenyl (TNP)-modified syngeneic stimulator cells: specificity, frequency of interleukin 2-producing Ly-2+ helper T cells and clonal segregation from Ly-2+ cytotoxic T lymphocytes. Eur. J. Immunol. 18:325.[Medline]
  49. Heeg, K., C. Steeg, J. Schmitt, H. Wagner. 1987. Frequency analysis of class I MHC-reactive Lyt-2+ and class II MHC-reactive L3T4+ IL-2-secreting T lymphocytes. J. Immunol. 138:4121.[Abstract]
  50. Saparov, A., F. H. Wagner, R. Zheng, J. R. Oliver, H. Maeda, R. D. Hockett, C. T. Weaver. 1999. Interleukin-2 expression by a subpopulation of primary T cells is linked to enhanced memory/effector function. Immunity 11:271.[Medline]
  51. Ma, A., D. L. Boone, J. P. Lodolce. 2000. The pleiotropic functions of interleukin 15: not so interleukin 2-like after all. J. Exp. Med. 191:753.[Free Full Text]
  52. Ku, C. C., M. Murakami, A. Sakamoto, J. Kappler, P. Marrack. 2000. Control of homeostasis of CD8+ memory T cells by opposing cytokines. Science 288:675.[Abstract/Free Full Text]
  53. Waldmann, T. A., S. Dubois, Y. Tagaya. 2001. Contrasting roles of IL-2 and IL-15 in the life and death of lymphocytes: implications for immunotherapy. Immunity 14:105.[Medline]



This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
A. Alavi and J. S. Axford
Sweet and sour: the impact of sugars on disease
Rheumatology, June 1, 2008; 47(6): 760 - 770.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Julien, M. J. Grimshaw, M. Sutton-Smith, J. Coleman, H. R. Morris, A. Dell, J. Taylor-Papadimitriou, and J. M. Burchell
Sialyl-Lewisx on P-Selectin Glycoprotein Ligand-1 Is Regulated during Differentiation and Maturation of Dendritic Cells: A Mechanism Involving the Glycosyltransferases C2GnT1 and ST3Gal I
J. Immunol., November 1, 2007; 179(9): 5701 - 5710.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
D. Park, K.-S. Ryu, D. Choi, J. Kwak, and C. Park
Characterization and role of fucose mutarotase in mammalian cells
Glycobiology, September 1, 2007; 17(9): 955 - 962.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Carlow and H. J. Ziltener
CD43 Deficiency Has No Impact in Competitive In Vivo Assays of Neutrophil or Activated T Cell Recruitment Efficiency
J. Immunol., November 1, 2006; 177(9): 6450 - 6459.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Carlow, M. J. Williams, and H. J. Ziltener
Inducing P-Selectin Ligand Formation in CD8 T Cells: IL-2 and IL-12 Are Active In Vitro but Not Required In Vivo
J. Immunol., April 1, 2005; 174(7): 3959 - 3966.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. S. Merzaban, J. Zuccolo, S. Y. Corbel, M. J. Williams, and H. J. Ziltener
An Alternate Core 2 {beta}1,6-N-Acetylglucosaminyltransferase Selectively Contributes to P-Selectin Ligand Formation in Activated CD8 T Cells
J. Immunol., April 1, 2005; 174(7): 4051 - 4059.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Zipin, M. Israeli-Amit, T. Meshel, O. Sagi-Assif, I. Yron, V. Lifshitz, E. Bacharach, N. I. Smorodinsky, A. Many, P. A. Czernilofsky, et al.
Tumor-Microenvironment Interactions: The Fucose-Generating FX Enzyme Controls Adhesive Properties of Colorectal Cancer Cells
Cancer Res., September 15, 2004; 64(18): 6571 - 6578.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Carlow, M. J. Williams, and H. J. Ziltener
Modulation of O-Glycans and N-Glycans on Murine CD8 T Cells Fails to Alter Annexin V Ligand Induction by Galectin 1
J. Immunol., November 15, 2003; 171(10): 5100 - 5106.
[Abstract] [Full Text] [PDF]


Home page