|
|
||||||||

*
Biomedical Research Centre and
Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, British Columbia, Canada
| Abstract |
|---|
|
|
|---|
16
N-acetylglucosaminyl transferase (C2GnT1 or C2GlcNAcT1)
is responsible for formation of branched structures on
O-glycans present on cell surface glycoproteins. The
O-glycan branch created by C2GnT1 is physiologically
important insofar as only this structure can be extended and modified
to yield P-selectin ligands that promote initial interactions between
extravasating lymphocytes and endothelia. In mature T cells, C2GnT1
activity is thought to be induced as an intrinsic consequence of T cell
activation. Through analysis of C2GnT1-dependent epitopes on CD43 and
CD45RB we have found that in activated CD8+ T cells
expression of C2GnT1 was dependent upon exposure to specific cytokines
rather than being induced as a direct consequence of activation.
Activated CD8+ cells became receptive to strong induction
of C2GnT1 expression and P-selectin ligand expression in response to
IL-2, moderate induction by IL-15, and minimal induction in response to
IL-4. Our observations clarify the relationship between T cell
activation and C2GnT1 expression, demonstrate the differential impact
of distinct cytokines on expression of C2GnT1 activity and P-selectin
ligand, and reinforce the concept that the cytokine milieu subsequent
to activation can influence adhesion systems that dictate lymphocyte
homing properties. | Introduction |
|---|
|
|
|---|
16 N-acetylglucosaminyl transferase
(C2GnT),3
sulfotransferases, galactosyl transferases, sialyl transferases, and
finally fucosyltransferases (FucT) IV and VII. The carbohydrates and
charged residues added by these enzymes contribute the key
components recognized by selectin as demonstrated by binding studies
with synthetic P-selectin glycoprotein ligand 1 (PSGL-1) ligands
(1) and crystal structures of PSGL-1 and
sLex complexes (2). It is the
coordinated regulation of these enzymes that ultimately determines the
stickiness of selectins with their O-glycan-bearing ligands,
but the physiological regulation of these enzymes is poorly
understood. Selectins contribute to leukocyte homing by mediating enhanced leukocyte tethering and slow rolling. Despite the subtlety of this initial step in the cascade to leukocyte adhesion and extravasation, ineffective engagement of selectins resulted in reduced leukocyte tethering, increased rolling velocities on normal endothelia (3), and impaired leukocyte recruitment to sites of inflammation (4, 5, 6). Furthermore, differences in homing of Th1 vs Th2 polarized CD4 T cells have been ascribed in part to selectin interactions suggesting that tissue localization of responding CD4 T cells may be supported by cytokine-induced changes in O-glycans on selectin ligands (7, 8, 9, 10).
Cytokine regulation of selectin ligand formation has recently gained
credence from a series of reports documenting induction of FucT VII and
selectin ligand expression in CD4 cells cultured under conditions
promoting Th1 polarization but not in those polarized toward Th2
(11, 12, 13, 14, 15, 16). Specifically, both IL-12 and TGF-
have been
shown to be effective inducers of FucT VII in CD4 cells (12, 13, 14, 16), whereas IL-4 failed to support FucT VII induction
(12, 13, 16). Investigations to date have focused
predominantly on CD4+ T cells. When
CD8+ Tc1 and Tc2 populations were generated by
the same polarizing cytokines, they displayed a similar distinction in
expression of selectin ligands (17) that may account for
their distinct migratory behavior (18) and therapeutic
efficacy (18, 19). These studies collectively implicate
IL-12/TGF-
vs IL-4 regulation of FucT VII expression as major
determinants of selectin ligand synthesis in activated T cells.
There is good evidence that selectin ligands require modifications by the branching enzyme C2GnT1 for selectin recognition (20, 21, 22). Early studies revealed that C2GnT1 was induced in T cells activated with monoclonal anti-CD3 (OKT3) in the presence of IL-2 (23). Where C2GnT1 expression has been examined during differentiation of Th1/2 CD4 cells its expression was not differentially regulated by polarizing cytokines (13, 14, 15, 16), and to our knowledge there is currently no evidence that C2GnT1 is subject to differential regulation in response to polarizing cytokines in T cells. The results presented below demonstrate that shortly after activation under neutral nonpolarizing conditions CD8 cells enter a state of receptivity to IL-2 vs IL-4 that can either promote C2GnT1 (and perhaps other glycosyltransferases) and selectin ligand expression or not. The differential induction of C2GnT1 and selectin ligand formation under these conditions is rapid and profound.
| Materials and Methods |
|---|
|
|
|---|
Mice aged 916 wk were used for analyses. C57BL/6 (B6) mice were bred at the Biomedical Research Centre (University of British Columbia, Vancouver, British Columbia, Canada) from founders obtained originally from The Jackson Laboratory (Bar Harbor, ME). CD43-/- mice (24) backcrossed for eight generations with B6 mice (25) were used. C2GnT1null mice were kindly provided by Drs. J. Marth (Howard Hughes Medical Institute, University of California at San Diego, La Jolla, CA) and L. Ellies (Cancer Research Center, the Burnham Institute, La Jolla, CA) (26).
Media
Cell suspensions were prepared in RPMI 1640 medium (Life Technologies, Burlington, Canada) supplemented with 10% FCS, 5 x 10-5 M 2-ME, 100 U/ml penicillin, 100 U/ml streptomycin (StemCell Technologies, Vancouver, British Columbia, CA), and 2 mM glutamine (Sigma-Aldrich, St. Louis, MO).
Abs and flow cytometry
1B11 for Western blotting was produced from the original
hybridoma (27) and 1B11-PE was obtained from BD PharMingen
(San Diego, CA) (09695A). Human IgG1-P-selectin fusion protein (28111A;
BD PharMingen) was detected with biotinylated anti-human IgG
(109-065-098; Jackson ImmunoResearch Laboratories, West Grove,
PA) and CyChrome-conjugated streptavidin (554062; BD
PharMingen). H18 is a glycosylation-independent polyclonal rabbit
antiserum specific for the intracellular portion of CD43
(27). mAb S7 (01601D; BD PharMingen) reacts with the
115-kDa (non-C2GnT-modified) form of CD43. CD8
-FITC (01044D; BD
PharMingen) and CD8
-biotin (CL8938B; Cedarlane Laboratories, Hornby,
Ontario, Canada). Neutralizing anti-PSGL-1 Ab 2PH-1
(8) was kindly provided by Dr. D. Vestweber (University of
Meunster, Meunster, Germany). Anti-CD45RB mAb 4B4
(28) was purified form hybridoma supernatants by protein
G. For cell surface staining, cells were suspended in PBS containing
2% (v/v) FCS and incubated with Abs for 2040 min on ice in 96-well
round-bottom plates (catalog no. 163320, Nalge Nunc, Rochester,
NY). Cells were washed twice and analyzed on a FACScan IV flow
cytometer (BD Biosciences, Mountain View, CA). P-selectin staining was
conducted in DMEM (Life Technologies) supplemented with 3% BSA. DMEM
contains Ca2+ required for selectin binding but
lacks biotin, which would interfere with detection of biotinylated
secondary reagents. For negative controls, either P-selectin-hIg
chimera was omitted or EDTA (5 mM) was included during staining with
P-selectin-hIg to prevent specific binding. Binding of P-selectin-hIg
chimera was detected with biotin-conjugated anti-human Ig and
CyChrome-conjugated streptavidin. Geometric mean fluorescence values
were used to summarize fluorescence histogram data where indicated.
Lymphocyte cultures
For methylcellulose cultures, IMDM base methylcellulose (MethoCult no. M3134; StemCell Technologies, Vancouver, British Columbia, Canada) was combined 1/1 with cells suspended in RPMI 1640 culture medium supplemented with 20% FCS. Primary stimulations were conducted with lymph node cells or splenocytes cultured at 106 cells/ml in 4 µg/ml Con A (C-0412; Sigma-Aldrich) for 48 h at 37°C in 5% CO2. Two- or 10-ml cultures were prepared in 24-well Falcon 3047 plates or 6-well Falcon 3046 plates respectively (BD Biosciences, Franklin Lakes, NJ). After 48 h cells were harvested, washed, counted, and replated in secondary cultures at 0.25 x 106 cells/ml with 5% IL-2 supernatant or at 0.05 x 106 cells/ml with 5% IL-4 supernatant for optimum differential induction of C2GnT1 unless otherwise indicated.
Cytokines and Western blotting
IL-2 and IL-4 were obtained as conditioned medium from the myeloma X.653 transfected with the cDNAs for murine IL-2 and IL-4, respectively (F. Melchers, Basel Institute of Immunology, Basel, Switzerland). Recombinant human IL-15 (247-IL; R&D Systems, Minneapolis, MN), gave maximal proliferative support for murine CD8+ T cells in secondary culture at >20 ng/ml and was used as 25 ng/ml in the data shown. Western blotting was conducted as previously described (29).
C2GnT activity assay
Cells were washed in PBS and lysed in 150 mM NaCl and 0.25%
Triton X-100 with protease inhibitors (10 µg/ml soybean trypsin
inhibitor, 40 µg/ml phenylmethyl-sulfonylfluoride, 10 µg/ml
leupeptin, 0.5 µg/ml pepstatin) at 4°C. Transferase assays were
performed in quadruplicate according to established protocols
(30, 31). The reaction mixtures for the C2GnT assay
contained 50 mM MES (pH 7.0), 0.5 µCi of uridine diphosphate
N-acetyl-D-glucosamine
(glucosamine-6-3H(N)) (NEN, Boston, MA), 1 mM
uridine 5'-diphospho-N-acetylglucosamine (Sigma-Aldrich),
0.1 M GlcNAc, 1 mM Gal
13GalNAc
-pNp (Toronto Research
Chemicals, Toronto, Ontario, Canada), and 25 µl of cell lysate (815
mg/ml protein) in a total reaction volume of 50 µl. The mixtures were
incubated for 2 h at 37°C then diluted to 5 ml with water and
processed by C18 Sep-Pak (Waters, Mississauga, Ontario, Canada) column
chromatography. After washing with water, the product was eluted using
ethanol and the complete eluates were counted in a scintillation
counter.
Semiquantitative RT-PCR
RNA was extracted using TRIzol Reagent (Life Technologies) according to the manufacturers instructions. Reverse transcription (RT) was performed with 2 µg of total RNA using Superscript (Life Technologies) in a 20-µl volume. The RT reaction was then diluted in 80 µl of water. Ten microliters of diluted RT was then removed and 2-fold serially diluted into six tubes, each containing 10 µl of water. One PCR control sample was prepared at the highest RNA concentration without RT reaction. Thirty microliters of PCR mix were added to each tube, resulting in final reactant concentrations of 25 U/ml Taq Platinum Polymerase (Life Technologies), 0.33 µM primers, 300 µM of each dNTP, 1.5 mM MgCl2, and 1x PCR buffer (20 mM Tris-HCl (pH 8.4) and 50 mM KCl). Reaction mixtures were subjected to 32 cycles of amplification, each one performed at 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min. After this treatment, 25 µl of RT-PCR products were separated by 2% agarose gel electrophoresis and stained in a solution containing 0.2 µg/ml ethidium bromide (Sigma-Aldrich). Transcriptional levels of different mRNAs were compared with RT-PCR performed with hypoxanthine phosphoribosyltransferase primers as an internal reference. PCR primers were purchased from Life Technologies and were specific for separate exons to avoid amplification of potential contaminating genomic DNA. Primer sequences are given from 5' to 3': C2GnT1 (accession no. D87332) forward, GAACTTGGCAGCACA, and reverse, CAATATATTTGCGTGTCCTGATGAAAGAGG; FucT VII (accession no. U45980) forward, GGACCTTGGGCTGAACCTACA, and reverse, TGGGTATTACTGGGCGATTCC; hypoxanthine phosphoribosyltransferase (accession no. BC004686) forward, CTCGAAGTGTTGGATACAGG, and reverse, TGGCCTATAGGCTCATAGTG.
| Results |
|---|
|
|
|---|
Activated CD43null T cells maintained in IL-2
lost reactivity with 1B11-CD45 (Fig. 1
and Ref. 29), consistent with the C2GnT1 dependence of
CD45RB recognition by 1B11 and the high levels of C2GnT1 expected in
these cells (23). Our study began with the unexpected
observation exemplified in Fig. 1
a that 1B11-CD45 epitope
expression on Con A-stimulated CD8+ T cells was
maintained if cells were subcultured in medium without IL-2. This
observation suggested that C2GnT1 induction might not be a direct
consequence of activation but might instead be determined by IL-2. We
considered several possible explanations for the observed loss of
1B11-CD45. First, IL-2 might support C2GnT1 expression indirectly by
maintaining optimal cell viability. Second, IL-2 might down-regulate
expression of CD45RB. Third, IL-2 might selectively induce C2GnT1
activity with consequent loss of the 1B11-CD45 epitope. Con A-activated
T cells were subcultured in medium supplemented with either IL-2 or
IL-4. Both cytokines were effective in supporting expansion of
CD8+ cells over the 4-day culture period, but
only IL-4-supplemented cultures maintained high levels of 1B11-CD45
expression (Fig. 1
b). A similar influence of IL-2 was also
observed in male Ag-specific T cell responses stimulated by male
dendritic cells (H-Y peptide plus MHC; data not shown). Using another
CD45RB-specific mAb (4B4) we found that expression of CD45RB was
maintained in the presence of exogenous IL-2 (data not shown). Thus,
the impact of IL-2 appeared to primarily affect the 1B11-CD45 epitope
and not CD45RB protein expression per se. The differential effects of
IL-2 and IL-4 were most dramatically evident in a simple two-step
culture system summarized in Fig. 1
c.
|
|
To examine the relative contributions of IL-2 and IL-4 on C2GnT1
activity, both cytokines were added to secondary cultures of
CD43null lymphocytes, as shown in
Fig. 3
a. 1B11-CD45 expression
was lost on cells exposed to IL-2 plus IL-4, as had been observed for
cells exposed to IL-2 alone. This result suggested that the
C2GnT-inductive influence of IL-2 was not blocked by IL-4 and
contrasted with previous observations by others that IL-4 could inhibit
expression of FucT VII, an enzyme acting downstream of C2GnT1 in
P-selectin-ligand synthesis. Thus IL-2 appeared to be particularly
effective in promoting C2GnT1 activity in activated
CD8+ T cells and IL-4 appeared to be devoid of a
modulating effect.
|
The culture density effects and the tissue-specific effects were highly
reproducible and had a substantial modifying influence on 1B11-CD45
expression in cytokine-supplemented secondary cultures. These sources
of influence might arise if, in addition to IL-2, cell-cell contact or
other cytokines were required for C2GnT1 induction. IL-2-supplemented
cultures were indeed distinguished by formation of large multicellular
aggregates driven by
2 integrin activation
(34), and the cytokines TGF-
and IL-12 have been
identified as potent inducers of FucT VII expression that act after
branch formation by C2GnT1 to complete selectin ligands on CD4 cells
(13, 14).
To determine whether CD8+ T cells responded to
IL-2 and IL-4 independently of other cells, CD8+
cells from 2-day primary cultures were sorted by flow cytometry on the
basis of CD8
and CD8
coexpression and subcultured in IL-2 or
IL-4. Purified CD8 T cells should be effectively depleted of
subpopulations that produce IL-12. As shown in
Fig. 4
b, purified CD8 T cells
retained full capacity to form homotypic aggregates and lost 1B11-CD45
expression in response to IL-2 (Fig. 4
a). To evaluate
whether TGF-
1 might participate in IL-2-induced loss of 1B11-CD45,
high concentrations of neutralizing anti-TGF-
1 were included
during the secondary culture without effect (data not shown). To
determine whether cell-cell contact between CD8 cells was required for
modulation of 1B11-CD45 in IL-2-supplemented cultures, secondary
cultures were plated in methylcellulose containing medium. As shown in
Fig. 4
c, IL-2-induced loss of 1B11-CD45 expression was
observed in these dispersed cultures. Collectively these results were
most consistent with the view that cell-cell contact was not required
for IL-2 induction of C2GnT1 and that the influence of tissue source
and cell density on C2GnT induction were due to some factor other than
IL-12 or TGF-
.
|
|
To investigate the specificity of IL-2 in regulating 1B11-CD45
expression, IL-12 and a panel of
c cytokines including IL-2, IL-4,
IL-7, and IL-15 were used to supplement secondary cultures of Con
A-activated CD43null lymphocytes. Of these
cytokines IL-2, IL-4, and IL-15 provided the best support for cell
growth, and IL-2 was most effective in inducing C2GnT1 activity. When
compared with IL-4 and IL-2, IL-15 exhibited intermediate activity in
supporting C2GnT1 activity as measured by loss of 1B11-CD45 expression,
as shown in Fig. 6
. The relative
differences among IL-2, IL-4, and IL-15 in regulating 1B11-CD45
expression were maintained over a range of cytokine concentrations
(including those that approached maximal growth support). IL-12 and
IL-7 were less effective in supporting expansion of activated CD8 cells
and, like IL-4, did not cause appreciable loss of 1B11-CD45
(data not shown). Cells grown in IL-15, IL-2, and IL-4 were also
compared for P-selectin ligand binding. Consistent with its
intermediate activity at C2GnT1 induction relative to IL-2, IL-15 did
not support full synthesis of P-selectin ligand. Thus, despite the
similarity of IL-15 and IL-2 as T cell growth factors signaling
through common 
receptor subunits, IL-15 was less effective than
IL-2 with respect to both C2GnT1 and P-selectin ligand induction.
|
|
| Discussion |
|---|
|
|
|---|
The effects of IL-2 and IL-4 are likely to be of physiological
importance for the following reasons. First, the differential effects
of IL-2 vs IL-4 on C2GnT1 expression were relatively rapid, occurring
over the 2-day secondary culture. Second, the effects were substantial
at the level of C2GnT1 enzyme activity and modification of a
physiological substrate, CD43. Third, vigorous polarizing treatments
typically applied to deviate T cell differentiation toward Th1 vs Th2
were not required. Differential C2GnT1 expression could be demonstrated
simply by supplementing media with either IL-2 or IL-4 for 2 days. When
we conducted intracellular staining for IFN-
in cells cultured with
either exogenous IL-2 or IL-4, both cell populations exhibited
comparable levels of staining, suggesting that classical polarization
had not occurred (data not shown). These observations collectively
suggested that the differential effects of IL-2 and IL-4 on core 2
O-glycan branch formation were likely to be primary, and
physiologically relevant, consequences of these prototype
cytokines.
The origins of the view that T cell activation was invariably accompanied by C2GnT1 induction arose from early investigations of human PBL activated by anti-CD3 (OKT3) in the presence of exogenous IL-2 (23); not surprisingly, such cells expressed high levels of C2GnT1 compared with their unstimulated counterparts. In more recent reports, C2GnT1 was said to be induced in response to mitogens (32, 35) despite earlier contrary data (23, 36) and recognition that additional factors may likely regulate C2GnT (37). This led to the general misconception that C2GnT1 was expressed as an invariant consequence of T cell activation. Thus, although the requirement for C2GnT1 activity in formation of selectin ligand on O-glycans is clear (38), the regulatory influence of cytokines on C2GnT1 expression had not been established.
More recent studies focusing on regulation of selectin
ligand expression in CD4+ Th1 and Th2 cells have
indicated that Th1 cells bind P-selectin, whereas Th2 cells do not.
Differences in P-selectin ligand synthesis have been uniformly ascribed
to the differential expression of FucT VII driven by Th1 polarizing
conditions including IL-12, anti-IFN-
, and anti-IL-4
(12, 13, 14, 15, 16, 17). In these studies lack of P-selectin ligand
expression in Th2 cells was ascribed to inhibition of FucT VII
expression by IL-4 (13, 16). When C2GnT1 expression was
examined in polarized cells there was no apparent difference between
Th1 and Th2 cells (13, 15, 16). However, in these studies
and in most other studies on selectin ligand synthesis, IL-2 was used
to supplement media during preparation of both Th1- vs Th2-polarized
CD4 cells (12, 13, 14, 15, 16, 17). Assuming our observations with
CD8+ cells apply to the
CD4+ cell analyses described above, we would
expect that such inclusion of IL-2 would have induced C2GnT1 and
thereby obscured differential regulation of C2GnT1 by IL-2 vs IL-4. The
fact that C2GnT1 was induced when secondary cultures included both IL-2
and IL-4 demonstrates that the inhibitory action of IL-4 on the
expression of FucT VII in CD4 cells does not extend to inhibition of
C2GnT1 expression in CD8+ cells. Recent analysis
of P-selectin ligand synthesis in IL-2-supplemented cultures of human
CD4 cells have documented the efficiency of IL-12/TGF-
vs IL-4 in
regulating FucT VII RNA expression (13, 14). Our studies
have dealt with mouse CD8+ cells exclusively, and
we did not identify prominent roles for either IL-12 or TGF-
in
C2GnT1 induction.
The importance of P-selectin and its primary ligand PSGL-1 on activated T cells (39) has been established in several systems. CD4+ cells polarized to Th1 cells successfully migrate to inflamed skin, whereas Th2 cells do not (7, 8, 9), and the migration of Th1 cells could be blocked with Abs to P-/E-selectin (7, 8, 10) or PSGL-1 (8). Because Th2 also express PSGL-1, Borges et al. (8) concluded that it was the form of PSGL-1 that distinguished migratory behavior of Th1 and Th2 cells. Recent observations with P-selectin-deficient mice have demonstrated that PSGL-1 can also serve as an effective target of E-selectin-mediated migration of Th1 cells into inflamed skin (9). Thus, the cytokine dependence of P-selectin ligand formation we have described in CD8+ T cells may also apply to formation of physiologically relevant E-selectin targets including PSGL-1 itself.
Because Con A stimulation efficiently induces IL-2 expression (40) and IL-2 drives C2GnT1 expression, why was exogenous IL-2 required to observe full C2GnT1 induction? It is known that supernatants of mitogen-stimulated cells reach peak levels of IL-2 within 48 h of mitogen stimulation and decline (40). This primary autonomous growth phase is driven by autocrine IL-2 as described by Harding et al. (41) and more recently by others (42, 43, 44). Thereafter, cells retain the capacity to extract IL-2 from media and proliferate in response to exogenous IL-2. IL-2 produced during the initial 2-day stimulation is not sufficient to fully induce C2GnT1 by day 4 because cells subcultured in medium without exogenous cytokine retain a significant 1B11-CD45 signal. Therefore, our results are most consistent with existence of a time window after day 2 where exogenous IL-2 must be available to achieve full C2GnT1 induction by day 4 and that selectin ligand synthesis is determined by the ambient cytokine environment present during this period. Recent analysis of CD8+ T cell responses activated in a costimulation-dependent process to Ag-bearing tumor cells in the peritoneum, identified a pattern of IL-2 production and subsequent IL-2-dependent migration that may be relevant to the current analysis (45, 46). The implications of our results for in vivo generation of P-selectin ligand formation are that once autocrine IL-2 production is terminated CD8 cells may require sustained exposure to IL-2 to achieve normal selectin-dependent migratory patterns and that insufficient IL-2 would fail to support O-glycan branching with consequent impairment in selectin ligand expression and altered homing ability.
When Con A-activated cells were cultured in IL-4, 1B11-CD45 expression was relatively high while C2GnT1 activity and P-selectin binding were correspondingly low. However, surprisingly high levels of P-selectin binding were consistently evident on a fraction of CD8+ cells in these cultures and could be a physiologically important cell population under conditions of limiting IL-2. Thus, despite the low C2GnT1 enzymatic activity at the population level and IL-4s reported inhibition of FucT VII RNA expression in CD4 cells, P-selectin ligand synthesis did proceed in some CD8+ cells. This unexpected result suggested that heterogeneity existed among CD8+ cells in culture. Because anti-PSGL-1 Ab effectively blocked all P-selectin binding to IL-4-treated CD8+ cells (data not shown), P-selectin binding was not mediated by alternate ligands. To reconcile P-selectin ligand formation on PSGL-1 on a subpopulation of IL-4-treated CD8+ cells, we refer to early literature documenting autocrine production of IL-2 by a fraction of CD8 cells stimulated with Con A (47), trinitrophenyl-coupled stimulators (48), or in allogeneic MLR (49). Similar heterogeneity in CD8+ cells was more recently documented in mice expressing green fluoresence protein regulated by the IL-2 promoter (50). Therefore, we speculate that autocrine IL-2 production by a fraction of CD8+ cells may support P-selectin ligand synthesis in an otherwise IL-2-depleted secondary culture. Why such heterogeneity in P-selectin binding was not paralleled by heterogeneity in 1B11-CD45 expression is a lingering question that we have not yet resolved.
Our study focused on differential C2GnT1 induction by IL-2, IL-4, and
IL-15, because these are primary growth factors for activated T cells.
Despite shared
and
c receptor components, IL-2 and IL-15 differ
functionally with respect to their roles in promoting
activation-induced cell death and maintenance of memory pools of
CD8+ T cells, respectively (51, 52, 53).
We found that IL-15 effectively supported CD8+
cell expansion in secondary cultures, but displayed an intermediate
ability to induce C2GnT1 expression and P-selectin ligand expression.
Thus, in addition to distinct roles in CD8+ cell
homeostasis, IL-2 and IL-15 also differentially regulate expression of
P-selectin ligand.
In summary, we have shown that in CD8+ T cells C2GnT1 expression is regulated by cytokine and its induction is not a direct invariant consequence of T cell activation. Because IL-2 and IL-4 have dramatically different consequences for a multiplicity of adhesion systems, we anticipate that resolving functional impact in vivo arising from the changes we have documented may not be trivial. Nevertheless, our analysis of C2GnT1 expression has implications for cell migration because C2GnT activity is required to generate selectin ligands that mediate the first phase of leukocyte extravasation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Douglas A. Carlow, Biomedical Research Centre, University of British Columbia, 2222 Health Sciences Mall, Vancouver, British Columbia V6T-1Z3, Canada. E-mail address: doug{at}brc.ubc.ca ![]()
3 Abbreviations used in this paper: C2GnT, core 2
16 N-acetylglucosaminyl transferase; PSGL-1, P-selectin glycoprotein ligand 1; FucT, fucosyltransferase; RT, reverse transcription. ![]()
Received for publication August 15, 2001. Accepted for publication October 15, 2001.
| References |
|---|
|
|
|---|
(1,3)-fucosyltransferase-IV and FucT-VII during leukocyte rolling in dermal microvessels. Immunity 12:665.[Medline]
3 fucosyltransferases in Th1 and Th2 cells correlates with their ability to bind P-selectin. Biochim. Biophys. Acta 247:307.
(1,3)-Fucosyltransferase VII and
(2,3)-sialyltransferase IV are up-regulated in activated CD4 T cells and maintained after their differentiation into Th1 and migration into inflammatory sites. J. Immunol. 163:3746.
1,3-fucosyltransferase VII gene expression. J. Exp. Med. 188:2225.
(1,3)-fucosyltransferase VII in activated CD4+ T cells by TGF-
1 through a p38 mitogen-activated protein kinase-dependent pathway. J. Immunol. 165:5011.
1,3-fucosyltransferase VII and
1,4-galactosyltransferase I. J. Invest. Dermatol. 115:299.[Medline]
-1,6-N-acetylglucosaminyltransferase enzyme activity is critical for P-selectin glycoprotein ligand-1 binding to P-selectin. Blood 88:3872.
13-GalNAc-R (GlcNAc to GalNAc)
16GlcNAc transferase by gene transfer into CHO cells expressing polyoma large tumor antigen. Proc. Natl. Acad. Sci. USA 89:9326.
2-integrin adhesion via a wortmannin/LY294002-sensitive, rapamycin-resistant pathway: phosphorylation of a 125-kDa protein correlates with induction of adhesion, but not mitogenesis. J. Immunol. 157:5350.[Abstract]
13GaLNAc-R (GlcNAc to GaLNAc)
-1,6-N-acetylglucosaminyltransferase activity in metastatic murine tumor cell lines: control of polylactosamine synthesis. J. Biol. Chem. 266:1772.This article has been cited by other articles:
![]() |
A. Alavi and J. S. Axford Sweet and sour: the impact of sugars on disease Rheumatology, June 1, 2008; 47(6): 760 - 770. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Julien, M. J. Grimshaw, M. Sutton-Smith, J. Coleman, H. R. Morris, A. Dell, J. Taylor-Papadimitriou, and J. M. Burchell Sialyl-Lewisx on P-Selectin Glycoprotein Ligand-1 Is Regulated during Differentiation and Maturation of Dendritic Cells: A Mechanism Involving the Glycosyltransferases C2GnT1 and ST3Gal I J. Immunol., November 1, 2007; 179(9): 5701 - 5710. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Park, K.-S. Ryu, D. Choi, J. Kwak, and C. Park Characterization and role of fucose mutarotase in mammalian cells Glycobiology, September 1, 2007; 17(9): 955 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Carlow and H. J. Ziltener CD43 Deficiency Has No Impact in Competitive In Vivo Assays of Neutrophil or Activated T Cell Recruitment Efficiency J. Immunol., November 1, 2006; 177(9): 6450 - 6459. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Carlow, M. J. Williams, and H. J. Ziltener Inducing P-Selectin Ligand Formation in CD8 T Cells: IL-2 and IL-12 Are Active In Vitro but Not Required In Vivo J. Immunol., April 1, 2005; 174(7): 3959 - 3966. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Merzaban, J. Zuccolo, S. Y. Corbel, M. J. Williams, and H. J. Ziltener An Alternate Core 2 {beta}1,6-N-Acetylglucosaminyltransferase Selectively Contributes to P-Selectin Ligand Formation in Activated CD8 T Cells J. Immunol., April 1, 2005; 174(7): 4051 - 4059. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zipin, M. Israeli-Amit, T. Meshel, O. Sagi-Assif, I. Yron, V. Lifshitz, E. Bacharach, N. I. Smorodinsky, A. Many, P. A. Czernilofsky, et al. Tumor-Microenvironment Interactions: The Fucose-Generating FX Enzyme Controls Adhesive Properties of Colorectal Cancer Cells Cancer Res., September 15, 2004; 64(18): 6571 - 6578. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Carlow, M. J. Williams, and H. J. Ziltener Modulation of O-Glycans and N-Glycans on Murine CD8 T Cells Fails to Alter Annexin V Ligand Induction by Galectin 1 J. Immunol., November 15, 2003; 171(10): 5100 - 5106. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Seppo, P. Matani, M. Sharrow, and M. Tiemeyer Induction of neuron-specific glycosylation by Tollo/Toll-8, a Drosophila Toll-like receptor expressed in non-neural cells Development, April 1, 2003; 130(7): 1439 - 1448. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Rubinstein, A. N. Kadima, M. L. Salem, C. L. Nguyen, W. E. Gillanders, and D. J. Cole Systemic Administration of IL-15 Augments the Antigen-Specific Primary CD8+ T Cell Response Following Vaccination with Peptide-Pulsed Dendritic Cells J. Immunol., November 1, 2002; 169(9): 4928 - 4935. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |