| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109; and
Laboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-13R1 was markedly reduced,
whereas bronchoalveolar lavage and whole lung levels of IFN-
were
significantly elevated in mice treated with 200 ng of IL-13-PE compared
with the control group. This study demonstrates that a therapy designed
to target IL-13-responsive cells in the lung ameliorates established
fungal-induced allergic airway disease in mice. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(8, 9). Consequently, this paradigm of cytokine
imbalance during allergic airway disease has spawned numerous
therapeutic strategies directed at the attenuation of the Th2 response
and/or the enhancement of the Th1 response (10, 11, 12).
Therapeutic strategies include regulation of the activation of signal
transducers and activators of transcription and NF-
B, as well as Abs
and soluble receptors directed against IgE, IL-4, IL-5, and the
unmethylated CpG oligodeoxynucleotides (13, 14).
Experimental studies have also shown that the systemic administration
of anti-IL-4 (15), anti-IL-13 Ab (5, 16), or the IL-13 inhibitor, soluble IL-13R2-Fc
(6), successfully abolishes the airway hyperresponsiveness
and remodeling associated with allergic airway disease. However, one
concern regarding all of these strategies is that simply targeting a
single transcription or cytokine pathway may not be sufficient to
effectively eradicate asthmatic or allergic symptoms in all patients
(17), particularly in light of recent experimental
evidence that IL-4 and IL-13 appear to have redundant proinflammatory
roles during aeroallergen challenge (18).
IL-4 shares receptor components and signaling pathways with IL-13,
including the -chain of the IL-4R and IL-13R1
(19, 20, 21). However, IL-13 can also selectively bind to
specific IL-13 receptors, including IL-13R1 and IL-13R2
(22, 23). Cells that respond to IL-13 are also excellent
sources of the same cytokine. These cells include activated Th2 cells
(2, 24), B cells (24), mast cells (25, 26), basophils (2), and alveolar macrophages
(3, 27). Given that the number of IL-4- and
IL-13-producing cells are markedly increased during the course of
airway inflammation associated with asthma and allergy
(2), it is conceivable that adequate immunoneutralization
of IL-4 or IL-13 may be difficult to maintain in these chronic
diseases. An alternative strategy for targeting IL-13R-positive cells
during asthma and allergy may involve the use of a fusion protein
comprising IL-13 and a mutated form of Pseudomonas exotoxin,
IL-13-PE38QQR
(IL-13-PE).3 This
fusion protein has been used to selectively target and eradicate solid
tumor cells with endogenous (28) and induced
(29) IL-13R expression. Importantly, mice did not exhibit
any adverse effects from the prolonged systemic in vivo administration
of IL-13-PE during tumor treatment (28). In the present
study, we investigated the dose-dependent therapeutic effects of
IL-13-PE in a model of chronic fungal-induced allergic airway disease
that is characterized by chronic airway hyperreactivity, goblet cell
hyperplasia, peribronchial fibrosis, and elevated pulmonary levels of
IL-4 and IL-13 (7). Our previous studies have shown that
development of these pulmonary features is IL-13 dependent but only
partly IL-4 dependent (16). IL-13-PE was administered via
the intranasal route to mice with established allergic airway disease,
and the findings presented in this paper show that this therapy
effectively ameliorated all the chronic features of this model.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Specific pathogen-free (SPF) female CBA/J mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and were maintained in a SPF facility for the duration of this study. Prior approval for mouse usage was obtained from the University Laboratory of Animal Medicine facility at the University of Michigan Medical School (Ann Arbor, MI). Systemic sensitization of mice to a commercially available preparation of soluble Aspergillus fumigatus Ags was performed as previously described in detail (7). Seven days after the third intranasal challenge, each mouse received 5.0 x 106 A. fumigatus conidia suspended in 30 µl of 0.1% Tween 80 via the intratracheal route (7).
IL-13-PE therapy during fungal-induced allergic airway disease
IL-13-PE is a recombinant chimeric fusion protein comprising
human IL-13 and a mutated Pseudomonas exotoxin, and it has
been previously used to target IL-13R-expressing tumor cells (28, 29). These previous studies have demonstrated that IL-13-PE is
cytotoxic when incorporated into cells that express IL-4R,
IL-13R1, and IL-13R2. Because this chimeric molecule had not been
previously used in a model of allergic airway disease, we conducted a
pilot study to determine a range of doses of IL-13-PE that were
appropriate for in vivo testing. This preliminary study showed that 50
ng of IL-13-PE in 1 ml of tissue culture medium had a minor effect on
the survival of cultured pulmonary fibroblasts, whereas 200 ng/ml of
this chimeric protein markedly attenuated fibroblast survival by >60%
(data not shown). Based on these preliminary observations, groups of
five to ten A. fumigatus-sensitized mice received 50, 100,
or 200 ng of IL-13-PE dissolved in 20 µl of PBS containing 0.25%
human serum albumin (HSA-PBS or diluent) via an intranasal bolus.
IL-13R-positive cells were targeted with IL-13-PE from day 14 to day 28
after the conidia challenge to coincide with marked increases in IL-13R
and protein levels in this model (16). In addition,
because A. fumigatus conidia are typically absent in the
airways of A. fumigatus-sensitized mice at day 14 after an
intratracheal conidia challenge (7), this time was
selected as the starting point for IL-13-PE treatment to avoid any
confounding effects of IL-13-PE on the innate immune response required
for the clearance of conidia from allergic mice (30, 31).
Day 14 after conidia also corresponds with peak peribronchial
accumulations of eosinophils and CD4+ T cell,
significant airway hyperresponsiveness to methacholine, goblet cell
hyperplasia, and subepithelial collagen deposition in A.
fumigatus-sensitized mice (7). Another group of 10
A. fumigatus-sensitized mice received 20 µl of diluent via
the same route beginning at day 14 and concluding on day 28 after
conidia.
Measurement of bronchial hyperresponsiveness
At day 28 after the A. fumigatus conidia challenge,
bronchial hyperresponsiveness in IL-13-PE-treated and control mice was
measured in a Buxco plethysmograph (Buxco Electronics, Troy, NY) as
previously described (7). Sodium pentobarbital (0.04 mg/g
of mouse body weight; Butler, Columbus, OH) was used to anesthetize
each mouse before its intubation for ventilation with a Harvard pump
ventilator (Harvard Apparatus, Reno, NV). The following ventilation
parameters were used: tidal volume = 0.25 ml; breathing
frequency = 120/min; and positive end-expiratory pressure 
3 cm
of H2O. Within the sealed plethysmograph mouse
chamber, transrespiratory pressure (i.e., 
tracheal
pressure - mouse chamber pressure) and inspiratory volume or
flow were continuously monitored online by an adjacent computer, and
airway resistance was calculated by the division of the transpulmonary
pressure by the change in inspiratory volume. Following a baseline
period in the mouse chamber, each mouse received doses of methacholine
ranging from 62.5 to 250 µg/kg of methacholine by tail vein
injection, and airway responsiveness to this bronchoconstrictor was
again calculated online. The data shown in this manuscript are focused
on a dose of 125 µg/kg methacholine because this methacholine dose
failed to elicit a response in nonsensitized mice but elicited maximal
changes in airway hyperresponsiveness in A.
fumigatus-sensitized mice after the conidia challenge. At the
conclusion of the assessment of airway responsiveness, a
bronchoalveolar lavage (BAL) was performed with 1 ml of normal saline.
Approximately 500 µl of blood was then removed from each mouse and
transferred to a microcentrifuge tube. Sera were obtained after the
sample was centrifuged at 10,000 rpm for 5 min. Whole lungs were
finally dissected from each mouse and snap frozen in liquid
N2 or prepared for histological analysis.
Morphometric analysis of leukocyte accumulation in BAL samples
Lymphocytes and macrophages were enumerated in BAL samples cytospun (Thermo Shandon, Runcorn, U.K.) onto coded microscope slides. Each slide was stained with a Wright-Giemsa differential stain and the average number of each cell type was determined after counting a total of 300 cells in 10–20 high-powered fields (x1000) per slide. A total of 1 x 106 BAL cells were cytospun onto each slide to compensate for differences in cell retrieval.
Whole lung histological analysis
Whole lungs from both groups of mice at day 28 after A. fumigatus conidia challenge were fully inflated with 10% formalin, dissected, and placed in fresh formalin for 24 h. Routine histological techniques were used to paraffin-embed the entire lung, and 5-µm sections of whole lung were stained with H&E or with periodic acid Schiff (PAS). Inflammatory infiltrates and structural alterations were examined around small airways and adjacent blood vessels using light microscopy at a magnification of x200.
Preparation of cDNA and RT-PCR amplification
Total RNA was prepared from whole lung samples removed from mice
in the IL-13-PE-treated and control groups at day 28 after the conidia
challenge. RNA was isolated using TRIzol reagent (Life Technologies,
Rockville, MD) according to the manufacturer’s directions. The
purified RNA was subsequently reverse transcribed into cDNA using a
GIBCO reverse transcription kit (Life Technologies, Rockville,
MD) and oligo(dT) 12–18 primers. The amplification buffer contained 50
mM KCl, 10 mM Tris-HCl (pH 8.3), and 2.5 mM
MgCl2. Specific oligonucleotide primers were
added (200 ng/sample) to the buffer along with 5 µl of reverse
transcribed cDNA sample. The following murine oligonucleotide primers
were used: IL-4R sense, GAGTGAGTGGAGTCCTAGCATC; IL-4R
antisense, GCTGAAGTAACAGAACAGGC (32); IL-13R1
sense, GAATTTGAGCGTCTCTGTCGAA; IL-13R1 antisense,
GGTTATGCCAAATGCACTTGAG; IL-13R2 sense,
ATGGCTTTTGTGCATATCAGATGCT; and IL-13R2 antisense,
CAGGTGTGCTCCATTTCATTCTAAT.
These mixtures were then first incubated for 5 min at 94°C and
amplified using the following cycling parameters: IL-4R, cycled 38
times at 94°C for 30 s and at 58°C for 45 s, and
elongated at 72°C for 70 s; IL-131R, cycled 38 times at
94°C for 30 s and at 66°C for 60 s, and elongated at
72°C for 70 s; IL-132R, cycled 38 times at 94°C for 30
s and at 66°C for 60 s, and elongated at 72°C for 70 s.
After amplification the samples were separated on a 2% agarose gel
containing 0.3 µg/ml ethidium bromide and bands were visualized and
photographed using a translucent UV source.
ELISA and total soluble collagen analysis
Murine IL-13, IL-4, IL-12, IFN-, and C10 chemokine levels
were measured in 50-µl samples from whole lung homogenates using a
standardized sandwich ELISA technique previously described in detail
(33). BAL fluids from the diluent and IL-13-PE groups were
also screened for IFN-. Each ELISA was screened to ensure Ab
specificity and recombinant murine cytokines, and chemokines were used
to generate the standard curves from which the concentrations present
in the samples were derived. The limit of ELISA detection for each
cytokine was consistently above 50 pg/ml. The Sircol collagen assay
(Biocolor, Belfast, Ireland) was used to measure the soluble forms of
collagen present in the same lung homogenates. This assay was developed
from the Sirius red-based histochemical procedure. The cytokine and
collagen levels in each sample were normalized to total protein levels
measured using the Bradford assay.
Serum levels of IgE, IgG1, and IgG2a at day 28 after conidia in the diluent and IL-13-PE treatment groups were analyzed using complementary capture and detection Ab pairs for IgE, IgG1, and IgG2a (BD PharMingen, San Diego, CA). Ig ELISAs were performed according to the manufacturer’s directions. Duplicate sera samples were diluted to 1/100 for IgE determination and 1/10 for determination of IgG levels. Ig levels were then calculated from OD readings at 492 nm, and Ig concentrations were calculated from a standard curve generated using rIgE, rIgG1, or rIgG2a (both standard curves ranged from 5 to 2000 pg/ml).
Statistical analysis
All results are expressed as mean ± SEM. A one-way ANOVA and a Dunnett’s multiple comparisons test were used to reveal statistical differences between the control group and the IL-13-PE treatment groups at day 28 after the conidia challenge. A value of p < 0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Airway hyperresponsiveness following a systemic methacholine
challenge is a persistent feature of chronic fungal allergic airway
disease in mice (7). As shown in Fig. 1
, the airway resistance measured in the
group of mice that received diluent from day 14 to day 28 after the
conidia challenge was 19.2 ± 4.6 cm
H2O/ml/sec, and this represented an 
8-fold
increase above the baseline resistance (dashed line shown in Fig. 1).
Mice that received 50 ng of IL-13-PE from day 14 to day 28 after
conidia exhibited airway hyperresponsiveness following methacholine
provocation that was similar to that elicited in the control group at
day 28. However, airway resistance in mice that received 100 ng of
IL-13-PE over the same time period was significantly
(p 
0.05) lower than that measured in the
control group (19.2 ± 4.6 vs 9.4 ± 2.9 cm
H2O/ml/s; Fig. 1). Likewise, mice that received
200 ng of IL-13-PE exhibited significantly lower
(p 0.01) methacholine-induced airway
resistance compared with the control group (19.2 ± 4.6 vs
5.4 ± 1.4 cm H2O/ml/s; Fig. 1). These data
suggested that, in a dose-dependent manner, IL-13-PE inhibited airway
hyperresponsiveness associated with chronic fungal-induced allergic
airway disease.
|
Previous studies have demonstrated that T lymphocytes are the
primary effectors of airway hyperresponsiveness (15) and
that both IL-4 (34) and IL-13 (5) have major,
and possibly distinct, roles in this response. Th2 lymphocytes appear
to be the primary source of IL-4 (15), whereas alveolar
macrophage appears to be the primary lung source of IL-13 during atopic
asthma (3). Because both types of cells also respond to
IL-4 and IL-13 in a receptor-dependent manner (22, 24), we
next examined whether IL-13-PE therapy during chronic allergic airway
responses to Aspergillus affected the numbers of T cells and
macrophages in the airways of these mice. T lymphocytes (Fig. 2A) and macrophages (Fig. 2B) were enumerated in BAL samples from all groups of mice
at day 28 after conidia challenge. Only the 200-ng IL-13-PE treatment
significantly reduced the number of T lymphocytes present in BAL
samples compared with numbers of these cells in similar samples from
the control group (Fig. 2A). None of the IL-13-PE treatments
significantly altered the numbers of BAL macrophages compared with
number of BAL macrophages in the diluent group (Fig. 2B).
Furthermore, few eosinophils and neutrophils were identified in BAL
samples from all groups at day 28 after the conidia challenge (data not
shown), and these findings were consistent with our previous
observations in this model (7, 30, 31, 35). Thus, the
200-ng IL-13-PE treatment significantly reduced T lymphocyte but not
macrophage numbers in the airways of A. fumigatus-sensitized
mice exposed to A. fumigatus conidia.
|
As we have previously reported (7), the introduction
of conidia into A. fumigatus-sensitized mice promotes a
marked and persistent peribronchial accumulation of T lymphocytes and
mononuclear cells. In the present study, pronounced airway inflammation
was observed in allergic mice that received diluent alone (Fig. 3A). In contrast, the airways
of mice in all three IL-13-PE treatment groups exhibited a clear
paucity of inflammatory leukocytes (Fig. 3, B–D), and the greatest reduction in
peribronchial inflammation was observed in whole lung sections from
mice that received 200 ng of IL-13-PE (Fig. 3D). The airways
of SPF mice have few, if any, mucus-producing goblet cells, so an
increase in the number of these cells reflects an induction of
mucin-gene expression (36). In the present study, goblet
cells were easily identified in the bronchial epithelium of allergic
mice that received diluent (Fig. 4A) or 50 ng of IL-13-PE (Fig. 4B). However, only scattered goblet cells were detected in
the airways of mice that received 100 ng of IL-13-PE (Fig. 4C), and the airways of mice treated with the highest dose
of IL-13-PE completely lacked PAS-positive goblet cells (Fig. 4D). Therefore, the therapeutic effects of IL-13-PE were
manifest at a histological level as evidenced by decreased
peribronchial inflammation and goblet cell hyperplasia/mucus
production.
|
|
Peribronchial fibrosis is another prominent feature of the
remodeled airway in mice with chronic fungal-induced allergic airway
disease (7), and previous studies have shown that IL-13 is
a major mediator of fibroblast activation and tissue fibrosis
(37, 38, 39). In the present study, the peribronchial
distribution of extracellular matrix and fibroblasts was pronounced
around the airways of the control group of mice at day 28 after the
conidia challenge (Fig. 5A).
Conversely, peribronchial fibrosis was markedly diminished around the
airways of mice that received 200 ng of IL-13-PE from day 14 to day 28
after the conidia challenge (Fig. 5B). Histological
examination of lungs from the other two IL-13-PE treatment groups
revealed little effect of lower doses of this chimeric protein on
peribronchial fibrosis (data not shown). Analysis of total collagen
levels in whole lung homogenates from the diluent and 200-ng IL-13-PE
treatment groups of mice confirmed that less peribronchial fibrosis was
present in IL-13-PE-treated mice at day 28 after the conidia challenge
(Fig. 6). Again, the two lower doses of
IL-13-PE did not reduce total soluble collagen levels in whole lung
samples (data not shown). Taken together, these data suggest that
targeting lung cells that recognize IL-13 significantly reduced the
degree of peribronchial fibrosis associated with chronic fungal
allergic airway disease in mice.
|
|
1 and IL-4R
We have previously observed whole lung mRNA levels of IL-13R1
and IL-4R at days 21 and 30 after a conidia challenge in A.
fumigatus-sensitized mice (16). Given these previous
findings, it was determined whether the 200-ng IL-13-PE treatment
modulated mRNA levels of these receptors in the lungs of A.
fumigatus-sensitized mice challenged with conidia 28 days
previously. As shown in Fig. 7, whole
lung mRNA levels from control and IL-13-PE-treated A.
fumigatus-sensitized mice were analyzed for IL-13R1,
IL-13R2, and IL-4R (both soluble and membrane-associated isoforms
of IL-4R) expression using RT-PCR (Fig. 7A). The whole lung
levels of IL-13R1 mRNA were markedly reduced, whereas mRNA for
soluble (Fig. 7A, top band) and
membrane-associated (Fig. 7A, bottom band)
IL-4R were absent in mice that received the 200-ng IL-13-PE
treatment from day 14 to day 28 compared with mice that received
diluent over the same time (Fig. 7A). The ratio of cytokine
receptor:
-actin based on densitometry analysis is shown in Fig. 7B. In contrast, the 50- and 100-ng IL-13-PE treatments did
not markedly reduce mRNA levels of IL-13R1 and IL-4R in whole
lung samples compared with the respective diluent alone group (data not
shown). Interestingly, no IL-13R2 was detected in any group at day
28 after the conidia challenge, whereas this IL-13R chain was detected
in whole lungs taken from nonallergic mice (data not shown). Taken
together, these data showed that the IL-13-PE treatment abolished the
whole lung mRNA for IL-13R1 and IL-4R, suggesting that this
chimeric protein therapy markedly reduced the numbers of
IL-13-responsive cells in the lung.
|
Serum levels of total IgE, IgG1, and IgG2a are summarized in Fig. 8. Following the diluent or IL-13-PE
treatment at day 28 after conidia, all groups of mice exhibited similar
levels of serum IgE, suggesting that the IL-13-PE treatments did not
affect the production of IgE in this model. IgG1 and IgG2a levels are
shown in Fig. 8, B and C, respectively. At day 28
after conidia, IgG1 levels were significantly decreased in the 200-ng
IL-13-PE treatment group, but not the other IL-13-PE treatment groups,
compared with the day 28 diluent group (Fig. 8B). However,
IgG2a levels were significantly higher in the 200-ng IL-13-PE treatment
group than IgG2a levels measured at day 28 in the diluent group (Fig. 8C). Thus, these data suggested that the 200-ng IL-13-PE
treatment inhibited the production of IgG1, which is normally
associated with a Th2 immune response, and promoted the production of
IgG2a, which is normally associated with a Th1 immune response.
|
Whole lung levels of IL-13, IL-4, and IL-12 were measured in all
four treatment groups at day 28 after the conidia challenge, and these
ELISA results are summarized in Fig. 9.
All three cytokines were elevated above baseline levels detected in
A. fumigatus-sensitized mice before the conidia challenge
(Fig. 9, dashed lines). Neither the 50-ng IL-13-PE treatment nor the
100-ng IL-13-PE treatment significantly altered whole lung levels of
IL-13 (A), IL-4 (B), and IL-12 (C)
compared with the control group. Whole lung IL-13 levels were
significantly elevated in the 200-ng IL-13-PE treatment group compared
with the control group (Fig. 9A), but IL-4 and IL-12 levels
did not differ between this IL-13-PE treatment group and the control
group (Fig. 9, B and C, respectively). Thus,
these data suggested that IL-13-PE therapy did not inhibit lung levels
of IL-13, IL-4, and IL-12 in this model. In addition, it appeared that
200-ng IL-13-PE treatment reduced the number of IL-13-responsive cells
in the lung, considering that whole lung levels of IL-13 were
significantly increased in this treatment group.
|
Previous studies have shown that IFN- is a potent inhibitor of
many of the physiological and histological features of allergic airway
disease induced by ovalbumin (40) and A.
fumigatus conidia (35). The effect of the diluent and
IL-13-PE therapies on whole lung and BAL levels of IFN- is shown in
Fig. 10. Markedly greater amounts of
IFN- were detected in both compartments at day 28 after the conidia
challenge compared with IFN- levels measured in similar samples from
A. fumigatus-sensitized mice before the conidia challenge.
Whole lung IFN- levels were increased in all of the IL-13-PE
treatment groups, but this elevation reached statistical significance
in the 200-ng IL-13-PE treatment alone (Fig. 10A). Likewise,
immunoreactive IFN- levels were increased in BAL samples from the
100- and 200-ng IL-13-PE treatment groups, but only BAL IFN- levels
in the latter group reached statistical significance compared with BAL
levels from the control group (Fig. 10B). These data
demonstrated that the Th1 cytokine response in A.
fumigatus-sensitized mice was significantly increased at day 28
after the conidia challenge and intranasal IL-13-PE chimeric protein
therapy.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, produced by Th1
lymphocytes (42). Nevertheless, previous attempts to
amplify Th1-mediated responses using rIL-12 (43) or
inhibit Th2-mediated responses using anti-IL-5 therapy
(44) were modestly successful in the treatment of clinical
asthma. Clinical asthmatic responses triggered by A.
fumigatus mirror this abnormal cytokine pattern because pulmonary
levels of Th2 cytokines are substantially higher than levels of Th1
cytokines (45). Because of our recent replication of this
and other features of fungus-induced allergic airway disease in mice
(7), we examined the therapeutic utility of selective
targeting of lung cells that bind IL-13. This was facilitated by the
delivery of a chimeric protein that contained human IL-13 and a
derivative of Pseudomonas exotoxin, PE38QQR. IL-13-PE has
been used successfully in the eradication of IL-13R-positive tumors
(28, 29). In the present study, we observed that IL-13-PE
therapy in mice with established fungal allergic airway disease
markedly reduced IL-13R1 mRNA levels in the lung and
dose-dependently reversed the airway hyperresponsiveness and remodeling
typically associated with this model. Most notably, the intranasal
administration of 200 ng of IL-13-PE from day 14 to day 28 after
conidia challenge markedly increased the lung-associated levels
of IFN-, suggesting that the targeting of IL-13-responsive cells was
effective in promoting levels of this antiallergic cytokine
(40).
Lung cells that bind IL-13 were specifically targeted during chronic
airway response to Aspergillus in mice because of the
evidence that this Th2 cytokine is prominently expressed during
clinical asthma (1, 46) and has a major and distinct role
during experimental allergic airway disease (5, 6, 18). It
is important to note that IL-4 and IL-13 share heteromultimeric
receptor complexes of variable composition. The biologic responses
induced by IL-4 or IL-13 require a complex interaction of signaling
pathways and regulators (47). The classical IL-4R is found
on hematopoietic cells and consists of IL-4R and IL-2R (or
-chain), whereas the alternative form of IL-4R consists of the
IL-4R and IL-13R1 chains (48). Because the
alternative IL-4R contains IL-13R1 it can also recognize IL-13, and
it appears that this receptor is the major IL-13 receptor in
hematopoietic and nonhematopoietic cells (49, 50). An
additional receptor, IL-13R2, binds to IL-13 with 100-fold higher
affinity than IL-13R1 but appears to lack the cytoplasmic domain
necessary for intracellular signaling (51). Previous
studies have demonstrated that IL-13-PE effectively binds to both IL-13
receptors but exhibits a much higher affinity for IL-13R2 than for
IL-13R (52). In the present study, we observed that the
200-ng IL-13-PE therapy markedly reduced mRNA levels of membrane and
soluble IL-4R, as well as IL-13R1, and increased whole lung IL-13
levels in the lungs of allergic mice. These findings suggested that the
200-ng IL-13-PE therapy successfully targeted cells that normally
express IL-13R1 as well as lung-associated cells that are expressing
IL-4R. Interestingly, IL-13R2 mRNA was only detected in whole
lung samples from nonsensitized, SPF mice; mRNA for this IL-13R was not
detected in any lung samples from A. fumigatus-sensitized
mice before or after conidia challenge. This finding is intriguing in
light of growing evidence that IL-13R2 may function as a decoy
receptor for IL-13, thereby limiting the biologic effects of IL-13
(53). Furthermore, the lack of IL-13R2 in the lungs of
allergic mice may be one explanation for the persistence of allergic
airway disease in A. fumigatus-sensitized mice exposed to
fungal conidia.
Given that T lymphocytes are the primary effectors during a wide array
of allergic airway responses (15, 54, 55), it is clear
that this cell and the mediators it produces are appropriate targets
during the treatment of atopic asthma (56). We too have
previously observed that despite the fact that eosinophils are the most
abundant and major effector cell type in the airways up to day 14 after
a conidia challenge in A. fumigatus-sensitized mice, T
lymphocytes are the predominant cellular effectors in this model at
later times (7). Furthermore, enhancing IL-12
(43) or neutralizing IL-5 (44) during
clinical asthma has been shown to have little effect on airway
responsiveness to spasmogen or Ag challenge, despite the fact that
these treatments markedly reduced blood and sputum eosinophil numbers.
In the present study, a prominent consequence of IL-13-PE treatment was
the marked and dramatic reduction in the numbers of T lymphocytes in
and around the airways of A. fumigatus-sensitized mice
challenged with conidia 28 days previously. Activated T lymphocytes
highly express IL-4R, but unlike B lymphocytes and monocytes,
resting or activated T cells exhibit little or no surface expression of
IL-13R1 (22, 24). Therefore, it is not immediately
clear from the current study whether the IL-13-PE treatment directly
killed T lymphocytes present in the lung, altered the apoptotic status
of these cells, or inhibited mechanisms that promote the emigration of
these cells into the lungs. Support for the latter possibility comes in
the form of preliminary observations that the IL-13-PE therapy
significantly inhibited the production of a potent T cell
chemoattractant, C10 chemokine (data not shown). Because C10 chemokine
has a major proinflammatory role during acute A.
fumigatus-induced allergic airway disease (57),
further studies are necessary to determine whether a reduction in C10
levels could account for the decreased numbers of T lymphocytes in this
allergic airway model.
The importance of airway remodeling during clinical asthma remains
controversial (58, 59, 60), but postmortem studies clearly
reveal that airway wall thickening is present in asthmatic patients,
and this observation appears to correlate to the severity of airway
hyperresponsiveness and airflow obstruction (61, 62, 63).
Airway remodeling is normally characterized by the activation of cells
that form the structural and support elements of the airway, including
epithelial cells, smooth muscle, fibroblasts, and endothelial cells
(58). Asthma is also characterized by increased mucus
production that in turn can contribute to airway obstruction
(64). Cohn and colleagues (65) have shown
that although IL-5, eosinophils, or mast cells are not essential,
signaling through the IL-4R is critical for mucus production in the
airways of allergic mice. Furthermore, IL-13 exerts a major role in
many of these events, as evidenced by the profound nonspecific airway
hyperresponsiveness, mucus cell metaplasia, and airway fibrosis and
obstruction in mice with the targeted pulmonary expression of IL-13
(66). Consistent with these findings is the demonstration
that the exogenous delivery of soluble (s)IL-13R2-Fc
effectively reduced the hepatic fibrosis associated with
schistosomiasis (39). We observed that the 200-ng IL-13-PE
therapy had a profound effect on all of the pathological events
associated with chronic airway responses to Aspergillus.
Also of major significance was the finding that the 200-ng IL-13-PE
therapy successfully reversed these features of allergic airway
disease. We have previously observed that airway hyperresponsiveness
and airway remodeling are well-established features at 2 wk after the
introduction of A. fumigatus conidia into A.
fumigatus-sensitized mice (7). Thus, the delayed
targeting of IL-13-responsive lung cells ameliorates all of the
features of established fungal asthma including airway
hyperresponsiveness and airway remodeling. In light of recent evidence
that lung fibroblasts can directly respond to IL-4 and IL-13
(37) and that IL-13-PE was administered when peribronchial
fibrosis was established in this fungal allergy model (7),
studies are underway to address the direct effect of IL-13-PE on lung
fibroblast proliferation and collagen synthesis.
The delayed 200-ng IL-13-PE therapy during chronic fungal-induced
allergic airway disease was also associated with a significant increase
in the pulmonary levels of IFN-, but not IL-4 or IL-12. The effect
of IL-13-PE on IFN- levels coincides with other successful forms of
immunotherapy in asthmatics that appear to reduce pulmonary symptoms
through promotion of Th1 responses (67, 68, 69) that appear to
be suppressed in the background during atopic asthma (70).
Investigators have recently proposed that the prevalence of asthma (a
Th2 disorder) is inversely proportional to the prevalence of
tuberculosis and enteric infection (Th1 disorders) (41).
Although the development of Th2 cells is impaired in IL-13-deficient
mice (71), IL-13, in contrast to IL-4, does not appear to
regulate Th cell differentiation (72). Consistent with
this observation, we have noted that the systemic immunoneutralization
of IL-4 but not IL-13 during chronic fungal-induced allergic airway
disease augments spleen levels of IFN- (16). Thus, the
IL-13-PE therapy used in the fungal-induced allergic airway disease
model promoted the release of IFN-, but the manner in which this
occurs is presently unknown.
In conclusion, IL-13 has been shown to be a central mediator in airway inflammation, hyperreactivity, increased number of goblet cells, and excess mucus, all pulmonary features that characterize asthma (5, 6, 36, 40). Given its distinct and dynamic role in the development and maintenance of so many features of asthma, it is clearly important to characterize strategies that safely and effectively target cells that respond to this cytokine. In the present study, we observed that the prolonged intranasal instillation of a chimeric protein that selectively targeted lung cells expressing IL-13R was well tolerated and effective in the treatment of asthmatic airway disease, thereby obviating the need for Ab or receptor antagonist therapies (73). These findings provide impetus to explore the efficacy of this treatment in clinical asthma and atopy.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Cory M. Hogaboam, Department of Pathology, University of Michigan Medical School, 1301 Catherine Road, Ann Arbor, MI 48109-0602. E-mail address: hogaboam{at}med.umich.edu
3 Abbreviations used in this paper: IL-13-PE, IL-13-PE38QQR; SPF, specific pathogen-free; BAL, bronchoalveolar lavage; s, soluble; PAS, periodic acid Schiff.
Received for publication July 10, 2001. Accepted for publication October 4, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chain. Blood 87:4286.1 chain and reconstitution with the IL4R of a functional IL-4/IL-13 receptor complex. FEBS Lett. 401:163.[Medline]
2: molecular cloning, characterization, and comparison with murine IL-13 receptor 1. J. Immunol. 161:2317.1 expression on B cells, T cells and monocytes and its regulation by IL-13 and IL-4. Eur. J. Immunol. 28:4286.[Medline]
chain. Hum. Gene Ther. 11:1829.[Medline]
regulate allergic airway inflammation and mucus production. J. Exp. Med. 190:1309. production in infants with bronchiolitis and asthma. Am. J. Respir. Crit. Care Med. 159:1417. but not chain: a functional component of interleukin-4 receptor. Blood 91:3884. chain shared by receptors for interleukins 2, 4, 7, 9, and 15. J. Biol. Chem. 270:8797.1 gene. Immunogenetics 51:974.[Medline]
2 chain: an essential component for binding and internalization but not for interleukin-13-induced signal transduction through the STAT6 pathway. Blood 97:2673.2. Lab. Invest. 78:591.[Medline]
, but not on eosinophils. J. Immunol. 162:6178. secretion in specific allergen-stimulated T cell cultures. J. Immunol. 154:4187.[Abstract]
. J. Allergy Clin. Immunol. 97:1356.[Medline]
-producing CD8+ T cells in asthma. Am. J. Respir. Crit. Care Med. 161:1790.This article has been cited by other articles:
|
|
 |
|
  H. Ramaprakash, T. Ito, T. J. Standiford, S. L. Kunkel, and C. M. Hogaboam Toll-Like Receptor 9 Modulates Immune Responses to Aspergillus fumigatus Conidia in Immunodeficient and Allergic Mice Infect. Immun., January 1, 2009; 77(1): 108 - 119. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Shimamura, T. Fujisawa, S. R. Husain, M. Kioi, A. Nakajima, and R. K. Puri Novel Role of IL-13 in Fibrosis Induced by Nonalcoholic Steatohepatitis and Its Amelioration by IL-13R-Directed Cytotoxin in a Rat Model J. Immunol., October 1, 2008; 181(7): 4656 - 4665. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Arora, R. A. McDonald, G. B. Toews, and G. B. Huffnagle Effect of a CD4-Depleting Antibody on the Development of Cryptococcus neoformans-Induced Allergic Bronchopulmonary Mycosis in Mice Infect. Immun., July 1, 2006; 74(7): 4339 - 4348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. W. Denning, B. R. O'Driscoll, C. M. Hogaboam, P. Bowyer, and R. M. Niven The link between fungi and severe asthma: a summary of the evidence. Eur. Respir. J., March 1, 2006; 27(3): 615 - 626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Rivera, H. L. Van Epps, T. M. Hohl, G. Rizzuto, and E. G. Pamer Distinct CD4+-T-Cell Responses to Live and Heat-Inactivated Aspergillus fumigatus Conidia Infect. Immun., November 1, 2005; 73(11): 7170 - 7179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Jenkins, A. Swiatoniowski, A. C. Issekutz, and T.-J. Lin Pseudomonas aeruginosa Exotoxin A Induces Human Mast Cell Apoptosis by a Caspase-8 and -3-dependent Mechanism J. Biol. Chem., August 27, 2004; 279(35): 37201 - 37207. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Jakubzick, E. S. Choi, K. J. Carpenter, S. L. Kunkel, H. Evanoff, F. J. Martinez, K. R. Flaherty, G. B. Toews, T. V. Colby, W. D. Travis, et al. Human Pulmonary Fibroblasts Exhibit Altered Interleukin-4 and Interleukin-13 Receptor Subunit Expression in Idiopathic Interstitial Pneumonia Am. J. Pathol., June 1, 2004; 164(6): 1989 - 2001. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C Jakubzick, E S Choi, S L Kunkel, H Evanoff, F J Martinez, R K Puri, K R Flaherty, G B Toews, T V Colby, E A Kazerooni, et al. Augmented pulmonary IL-4 and IL-13 receptor subunit expression in idiopathic interstitial pneumonia J. Clin. Pathol., May 1, 2004; 57(5): 477 - 486. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kaminski, J. A. Belperio, P. B. Bitterman, L. Chen, S. W. Chensue, A. M.K. Choi, S. Dacic, J. H. Dauber, R. M. du Bois, J. J. Enghild, et al. Idiopathic Pulmonary Fibrosis Am. J. Respir. Cell Mol. Biol., September 1, 2003; 29(3): S1 - 105. [Full Text] [PDF]
|
|
|
|
|
|
C. Jakubzick, E. S. Choi, B. H. Joshi, M. P. Keane, S. L. Kunkel, R. K. Puri, and C. M. Hogaboam Therapeutic Attenuation of Pulmonary Fibrosis Via Targeting of IL-4- and IL-13-Responsive Cells J. Immunol., September 1, 2003; 171(5): 2684 - 2693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Jakubzick, E. S. Choi, S. L. Kunkel, B. H. Joshi, R. K. Puri, and C. M. Hogaboam Impact of Interleukin-13 Responsiveness on the Synthetic and Proliferative Properties of Th1- and Th2-Type Pulmonary Granuloma Fibroblasts Am. J. Pathol., May 1, 2003; 162(5): 1475 - 1486. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Inman Do Complex Conditions Require Complex Treatment? Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 6 - 6. [Full Text] [PDF]
|
|
|
|
|
|
C. Jakubzick, S. L. Kunkel, B. H. Joshi, R. K. Puri, and C. M. Hogaboam Interleukin-13 Fusion Cytotoxin Arrests Schistosoma mansoni Egg-Induced Pulmonary Granuloma Formation in Mice Am. J. Pathol., October 1, 2002; 161(4): 1283 - 1297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Schuh, K. Blease, S. L. Kunkel, and C. M. Hogaboam Eotaxin/CCL11 is involved in acute, but not chronic, allergic airway responses to Aspergillus fumigatus Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L198 - L204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Schuh, K. Blease, and C. M. Hogaboam CXCR2 Is Necessary for the Development and Persistence of Chronic Fungal Asthma in Mice J. Immunol., February 1, 2002; 168(3): 1447 - 1456. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
