The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, G.
Right arrow Articles by Gurney, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, G.
Right arrow Articles by Gurney, A. L.
The Journal of Immunology, 2001, 167: 6559-6567.
Copyright © 2001 by The American Association of Immunologists

Forced Expression of Murine IL-17E Induces Growth Retardation, Jaundice, a Th2-Biased Response, and Multiorgan Inflammation in Mice

Guohua Pan1,2,*, Dorothy French2,{ddagger}, Weiguang Mao*, Miko Maruoka{dagger}, Philip Risser*, James Lee{dagger}, Jessica Foster{dagger}, Sudeepta Aggarwal{dagger}, Katrina Nicholes{ddagger}, Susan Guillet{ddagger}, Peter Schow§ and Austin L. Gurney1,{dagger},{ddagger}

Departments of * Molecular Oncology, {dagger} Molecular Biology, {ddagger} Pathology, and § Immunology, Genentech, Inc., South San Francisco, CA 94080


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-17 is a proinflammatory cytokine, and its in vivo expression induces neutrophilia in mice. IL-17E is a recently described member of an emerging family of IL-17-related cytokines. IL-17E has been shown to bind IL-17Rh1, a protein distantly related to the IL-17R, suggesting that IL-17E probably possesses unique biological functions. In this study, we have identified the murine ortholog of IL-17E and developed transgenic mice to characterize its actions in vivo. Biological consequences of overexpression of murine (m)IL-17E, both unique to IL-17E and similar to IL-17, were revealed. Exposure to mIL-17E resulted in a Th2-biased response, characterized by eosinophilia, increased serum IgE and IgG1, and a Th2 cytokine profile including elevated serum levels of IL-13 and IL-5 and elevated gene expression of IL-4, IL-5, IL-10, and IL-13 was observed in many tissues. Increased gene expression of IFN-{gamma} in several tissues and elevated serum TNF-{alpha} were also noted. In addition, IL-17E induces G-CSF production in vitro and mIL-17E-transgenic mice had increased serum G-CSF and exhibit neutrophilia, a property shared by IL-17. Moreover, exposure to mIL-17E elicited pathological changes in multiple tissues, particularly liver, heart, and lungs, characterized by mixed inflammatory cell infiltration, epithelial hyperplasia, and hypertrophy. Taken together, these findings suggest that IL-17E is a unique pleiotropic cytokine and may be an important mediator of inflammatory and immune responses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-17 is a potent proinflammatory cytokine produced by activated T cells (1, 2). Although initially identified on the basis of homology with a protein encoded by HSV saimiri, it is now recognized as the prototype member of an expanding family comprised of at least six members (Refs. 3, 4, 5 and our unpublished observations). Subsequent characterization in vitro and in vivo has shown IL-17 to promote inflammatory responses in many peripheral tissues and to have substantial effects on hemopoiesis mediated by the induction of other cytokines, chemokines, and hemopoietic factors (6, 7, 8, 9, 10, 11). In addition, IL-17 has been implicated in a number of human disease conditions, including rheumatoid arthritis, and organ transplantation (12, 13, 14, 15). Recent members of the IL-17 family, including IL-17B, -C, and -E have also been identified on the basis of sequence homology between the family members. The biological functions of these new members remain to be characterized. However, initial characterizations suggest that each is capable of promoting the induction of other cytokines in cell culture systems (3, 5). Intraperitoneal administration of IL-17B was reported to induce neutrophil migration in mice (4).

The identification of IL-17Rh1 (also called IL-17ER, Evi27 or IL-17BR) as a receptor for IL-17E (5) and the observation that other IL-17R-like molecules are encoded in the human genome (our unpublished observations) suggest that members of the IL-17 family have a unique cognate receptor(s) and may therefore possess distinct biological functions. Interestingly, the murine ortholog of IL-17Rh1 was identified at Evi27, a common site of retroviral integration in BXH2 murine leukemias. The proviral integrations result in increased expression of the receptor, and its role in myeloid leukemia and growth and/or differentiation of hemopoietic cells has also been suggested (16). IL-17B has also been identified as a putative ligand for IL-17Rh1, although the apparent weaker binding suggests that it may use another, as yet unidentified, receptor (4). IL-17Rh1 transcripts are expressed in several adult tissues. In humans, abundant levels of IL-17Rh1 mRNA were detected in kidneys and liver, with lower abundance in testes, brain, small intestine, and other tissues. Similar expression patterns were observed in the mouse (5). Similar to IL-17, IL-17E was found capable of activation of NF-{kappa}B and stimulation of production of the proinflammatory chemokine IL-8 in cell cultures (5).

Here, we have developed a transgenic mouse model overexpressing murine (m)3 IL-17E (mIL-17E) under the control of the muscle myosin L chain 2 gene promoter. We found that systemic overexpression of mIL-17E up-regulates gene expression of Th2 cytokines, including IL-4, IL-10, and IL-13 in many tissues. Serum levels of IL-13 and IL-5 as well as circulating IgE and IgG1 are increased in transgenic mice. Furthermore, these profound immunological changes in mIL-17E-transgenic (TG) mice are associated with pathological changes in multiple tissues, characterized by a mixed immune infiltration and epithelial cell hyperplasia.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of mIL-17E-TG mice

All animal protocols were approved by an institutional use and care committee. The cDNA encoding for the mature mIL-17E protein with the putative signal sequence from human IL-17E was cloned into a plasmid containing rat myosin L chain promoter sequence (17, 18), followed by a sequence derived from the human growth hormone gene including the fourth and fifth exons and 3' untranslated region plus poly(A) to improve the expression of the transgene. The expression cassette fragment was excised, purified, and injected into one-cell mouse eggs prepared from FVB x FVB matings. Genotyping was performed by PCR analysis of the DNA from tail biopsies using primers against specific sequences in the expression cassette. Expression levels of mIL-17E were determined by Taqman RT-PCR (PerkinElmer, Norwalk, CT) on total RNA samples derived from muscle biopsy.

Determination of gene expression

Total RNA samples from various mouse tissues were prepared using TRIzol reagent according to the manufacturer’s instruction (Life Technologies, Grand Island, NY). The mRNA expression levels for various murine cytokines, chemokines, adhesion molecules, and IL-17Rh1 (IL-17E receptor) were determined by Taqman RT-PCR (PerkinElmer) using gene-specific primers and probes as follows. For mIL-6: primers, 5'-AAG GAG TGG CTA AGG ACC AA-3' and 5'-GTT TGC CGA GTA GAT CTC AAA G-3'; and probe, FAM ACC ATC CAA TTC ATC TTG AAA TCA CTT GAA G TAMARA. For mIL-10: primers, 5'-GAC TGG CAT GAG GAT CAG CA and 5'-CCG CAG CTC TAG GAG CAT GT; and probe, FAM CAC TTC CCA GTC GGC CAG AGC C TAMARA. For mIL-13: 5'-AGC CTG TGG CCT GGT CC and 5'-TCA AGA AGA AAT GTG CTC AAG CTG; and probe, FAM CAC AGG GCA ACT GAG GCA GGC A TAMARA. For mG-CSF: primers, 5'-CCT GCA GGC TCT ATC GGG TA and 5'-GCA ACA TCC AGC TGA AGC AA; and probe, FAM CCT GCC CTG GCC CCC ACC T TAMARA. For mIL-4: 5'-GAG CTG CAG AGA CTC TTT CG and 5'-ACT CAT TCA TGG TGC AGC TTA; and probe, FAM GCT TTT CGA TGC CTG GAT TCA TCG TAMARA. For mIL-9: 5'-AAA GGA TAG TTG AAG TCC TAA AGA ACA and 5'-TCT GGT TGC ATG GCT TTT C; and probe, FAM CAC GTG TCC GTC CTT TTC CTG C TAMARA. For mTNF-{alpha}: 5'-TGG GAC AGT GAC CTG GAC TGT and 5'-GGC TCC AGT GAA TTC GGA AAG; and probe, FAM CAC CAC CAT CAA GGA CTC AAA TGG GC TAMARA. For mIFN-{gamma}: primers, 5'-AGC TCA TCC GAG TGG TCC AC and 5'-AAA ATT CAA ATA GTG CTG GCA GAA; and probe, FAM AGC TGT TGC CGG AAT CCA GCC TC TAMARA. For mIL-5: primers, 5'-GTG CCT GGA GCA GCT GGA T and 5'-GTG GCT GGC TCT CAT TCA CA; and probe, FAM TTG GAA AAG AAA AGG GAC ATC TCC TTG CA TAMARA. For mGRO{alpha}: primers, 5'-TGCACCCAAACCGAAGTCA and 5'-AGCTTCAGGGTCAAGGCAAG; and probe, FAM AGCCACACTCAAGAATGGTCGCGAG TAMARA. For mICAM-1: primers, 5'-CCTAAGATGACCTGCAGACGG and 5'-TTTGACAGACTTCACCACCCC; and probe, FAM CAGATGGTGCCCTGCTGCCCA TAMARA. For mVCAM-1: primers, 5'-CCCTGAATACAAAACGATCGC and 5'-CAGCCCGTAGTGCTGCAAG; and probe, FAM CAAATCGGTGACTCCATGGCCCTC TAMARA. For mouse monocyte chemoattractant protein-1: primers, 5'- GATCGCCAAGGAGCTCAACT and 5'-TGGCGTCGATTACAGAACCA; and probe, FAM CGACCGGGAGGTGGTGAGGGT TAMARA. For mIL-17ER: primers, 5'-GCT GGA TAC TCC GGG GGC CA and 5'- TGC CACTCA CGC AGA TCT TG; and probe: FAM CAG CAT CCG CTT GTT GAA GGC CA TAMARA. Expression levels of 18S rRNA were used as normalization control.

Histological analysis

Routine necropsy was performed. Tissues for light microscopy were collected and fixed overnight in 10% neutral buffered Formalin, embedded in paraffin, sectioned at 5 µm, and stained with H&E.

FACS analysis

Blood samples were collected and processed, and FACS analyses were performed on EPICS XL-MCL (Coulter, Miami, FL) using various Abs (BD PharMingen, San Diego, CA) according to the manufacturers’ instructions.

Measurement of serum proteins

Serum IgG1 and IgG2a levels were assessed using a sandwich ELISA. Anti-mouse IgG1- and IgG2a-coating Abs (BD PharMingen) were diluted to 1.0 and 2.5 µg/ml in PBS (pH 7.2), respectively, and added to separate 96-well plates (Nunc Immuno Plate Maxisorp; Nunc, Naperville, IL), then incubated overnight at 4°C. Plates were washed three times (0.05% Tween 20), blocked (0.5% BSA in PBS), and incubated for 2 h at room temperature with gentle agitation, then washed three times. Mouse IgG1 standard (10 µg/ml standard stock, lot 31357-30A) was diluted to 25 ng/ml in assay buffer (0.5% BSA and 0.05% Tween 20 in PBS), and 2-fold serial dilutions were performed to create a seven-point standard curve ranging from 25 to 0.39 ng/ml. Mouse IgG2a standard (Southern Biotechnology Associates, Birmingham, AL) was diluted to 400 ng/ml in assay buffer, and 2-fold serial dilutions were performed to create a seven-point standard curve ranging from 400 to 6.25 ng/ml. Serum samples were serially diluted 2-fold in assay buffer to fall within the respective standard curve ranges. Standard or sample was added to each plate and incubated for 2 h at room temperature with gentle agitation, then washed six times. Biotinylated anti-mouse IgG1 and IgG2a detection Abs (BD PharMingen) were diluted 1/2000 in assay buffer and added to each plate at 100 µl/well, then incubated at room temperature for 1 h with gentle agitation and then washed six times. Strepavidin-HRP (Amersham Pharmacia Biotech, Piscataway, NJ) diluted 1/20,000 in assay buffer was added and incubated for 30 min at room temperature with gentle agitation, then washed six times. Tetramethylbenzidine substrate solution (Kirkegaard & Perry, Gaithersburg, MD) was added to each well, and color was allowed to develop for 4–6 min. The reaction was stopped with 1 M phosphoric acid, and absorbance was read at 450 nm. Serum IgE levels were assessed by sandwich ELISA using a mouse IgE OptEIA kit (BD PharMingen). Serum IL-5, IL-13, G-CSF, IFN-{gamma}, and TNF-{alpha} were measured using ELISA kits (R&D Systems, Minneapolis, MN) according to the manufacturer’s instructions.

Recombinant proteins and cell cultures

NIH-3T3 and ST2 cells were grown in high glucose DMEM with 10% heat-inactivated FBS, 2 mM L-glutamine, 1x penicillin, and streptomycin. The cultures were initiated at 500,000 per 60-mm culture disk. All cultures were grown in triplicate. At 24 h, factors were added to the cultures; 4 and 24 h later, conditioned media were removed and frozen for ELISA, and cells were lysed for RNA extraction in the dish using an RNeasy kit according to the manufacturer’s instructions (Qiagen, Valencia, CA). The rIL-17 was purchased from R&D Systems. IL-17E was prepared as previously described (5).

Statistical analysis

For body weights, hematological analysis, and FACS of PBMC, statistical significance was determined by Student’s t test. Gene expression data were statistically analyzed by ANOVA using StatView software (Calabasas, CA). A value of p < 0.05 was taken as significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of mIL-17E

The murine ortholog of IL-17E was identified through sequence comparison with expressed sequence tag information (accession no. AI430337) present in GenBank. Several cDNA clones were subsequently isolated, and the longest cDNA clone encoded a partial signal sequence and the predicted mature protein of murine IL-17E, which was 85% identical to human IL-17E and 17–22% identical to other members of the IL-17 family (Fig. 1GoA). Attempts including 5' racing, failed to identify cDNA that contained an initiation codon. Analysis of mRNA expression in several mouse tissues indicated that mIL-17E is expressed in brain, heart, and testes. Little expression was detected in liver, lung, or spleen (Fig. 1GoB).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 1. A, Predicted protein sequence of mIL-17E. The partial signal sequence and mature protein sequence of mIL-17E are aligned with those of its human ortholog. The putative signal sequence is underlined. The GenBank accession number for mIL-17E is AY034088. B, Tissue distribution of mIL-17E. The mRNA expression of mIL-17E was examined by a real-time RT-PCR assay using mIL-17E-specific primers and probe. Relative expression is shown. C, Growth retardation in TG mice. Growth curves are only shown for male mice. n = 5. D, Gross appearance of a mIL-17E-TG mouse compared with a non-TG littermate. The TG mouse is smaller than the non-TG mouse. Note the jaundiced skin (yellow-tinged) in the mIL-17E TG mouse.

 
mIL-17E-TG mice have elevated liver enzymes and are jaundiced and growth retarded

TG mice have not been previously reported for any member of the IL-17 family. Attempts to generate transgenic mice that ubiquitously overexpress mIL-17 were unsuccessful (9). The reason for this failure remains unknown, but it is probable that overexpression of potent proinflammatory cytokine, such as IL-17 during early development may be lethal. Thus, rat skeletal myosin L chain 2 promoter was chosen to overexpress mIL-17E in TG mice (17, 18), as this promoter is known to direct a high level gene expression starting 6–9 days after birth, presumably giving rise to circulating mIL-17E. The mice were housed in a specific pathogen-free environment, and multiple founders were analyzed. All TG pups were significantly smaller than their non-TG littermates by 1 wk of age. This difference in body weights was retained at 3, 4, 6, 12, and 13 wk of age (Fig. 1GoC and data not shown), suggesting that the TG mice were growth retarded. At 6 wk of age, most of the TG founder mice were jaundiced (Fig. 1GoD), indicating bilirubin deposition in the tissues. Consistent with this, serum levels of bilirubin were significantly elevated in the mIL-17E-TG mice (1.78 mg/dl (TG) vs 0.05 mg/dl (non-TG); p = 0.008). In addition, serum levels of liver enzymes were markedly elevated, including alkaline phosphatase (886.7 U/L (TG) vs 223 U/L (non-TG); p = 0.018), alanine aminotransferase (252 U/L (TG) vs 45 U/L (non-TG), p = 0.008), and amylase (21414 U/L (TG) vs 3606 U/L (non-TG); p = 0.015), suggestive of liver damage in the mIL-17E-TG mice.

Overexpression of mIL-17E in TG mice induces gene expression of cytokines in multiple tissues

To understand the in vivo consequences of the overexpressed mIL-17E, we first examined the gene profiles of both Th1 and Th2 cytokines. mIL-17E receptor, mIL-17ER, is expressed in multiple tissues, especially abundant in liver and kidneys (4, 5). Thus, we measured expression of inflammatory cytokines in these tissues using quantitative RT-PCR assays. The transcripts for Th2 cytokines IL-4 and IL-10 were significantly induced in liver, and IL-4, IL-10, and IL-13 in kidneys from TG mice (Fig. 2Go, A and B). Interestingly, we found that some of these cytokines were also dramatically induced in lungs (IL-4 and IL-10; Fig. 2GoC), heart (IL-10 and IL-13; data not shown), spleen (IL-4, IL-6, and IL-13; data not shown), and intestines (IL-4, IL-5, IL-9, and IL-10; data not shown) where normally a very low abundance of mIL-17ER was detected (4, 5), suggesting that these tissues were also responsive to IL-17E. We thus measured the mIL-17ER expression in these tissues in TG mice. Remarkably, mIL-17ER mRNA was substantially increased in multiple tissues, especially heart and lung (increased by 64- and 16-fold, respectively; Fig. 2GoD) and consistent with the idea that IL-17E may enhance its signaling in peripheral tissues by up-regulation of its own receptor. These cytokine profiles suggest that IL-17E may drive a Th2-like response. However, when the gene expression levels of Th1 cytokines were measured (e.g., IFN-{gamma} and TNF-{alpha}), we also observed elevated levels of these messages in several tissues (Fig. 2GoA and data not shown). Thus, the inflammatory response induced by mIL-17E may not be strictly Th2 in character.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 2. mRNA levels of various genes in TG vs non-TG mice. Gene expression in various tissues was examined by a real-time quantitative RT-PCR using gene-specific primers and probes as described in Materials and Methods. The mRNA levels of various genes were normalized over those of 18S. Relative mRNA expression values (TG vs non-TG) are shown as the fold increase. The data are from analysis of six TG and six non-TG mice and are presented as the range of increase. A, Gene expression profile in livers. B, Gene expression profile in kidneys. C, Gene expression profile in lungs. D, IL-17ER mRNA is up-regulated in TG mice. The fold increase is represented as the mean ± SD (n = 5).

 
mIL-17E-TG mice have increased serum IL-5 and IL-13 and circulating IgE and IgG1

To determine whether the elevated gene expression described above gave rise to circulating cytokines and further affected Ab generation, we measured serum levels of several cytokines and Abs using specific ELISAs. Both Th2 cytokines, IL-13 and IL-5, were increased in mIL-17E-TG mice (Fig. 3GoA). However, serum TNF-{alpha} was also induced in TG mice (Fig. 3GoA). Induction of serum IFN-{gamma} was not detected (data not shown) despite increased IFN-{gamma} mRNA in some tissues (Fig. 2Go). In addition, both serum IgE and IgG1 (characteristic of the Th2 response) were significantly elevated in the TG mice, but serum levels of IgG2a (Th1 in character) were not altered (Fig. 3GoB). Along with the increased circulating eosinophils (see below), these findings suggest that IL-17E induces a systemic Th2-biased response.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 3. Serum levels of cytokines and Ab isotypes in mIL-17E-TG mice. A, Increased serum IL-5, IL-13, and TNF-{alpha} in TG mice (n = 4). B, Increased circulating IgE and IgG1 in TG mice. The data from individual animals are shown. n.d., Nondetectable.

 
Overexpression of mIL-17E causes neutrophilia and eosinophilia in TG mice

In vivo expression of IL-17 via adenoviral-mediated delivery causes neutrophilia in mice (9), but no effect on eosinophils has been reported. To understand whether overexpression of mIL-17E had a similar effect, FACS analyses of PBMC were performed using specific cell surface markers. CD3+ T cells or CD19+ B cells were significantly reduced in TG mice compared with those of non-TG mice (Fig. 4GoA). However, there was no change in the CD4+:CD8+ ratio (data not shown). When PBMC were stained for GR-1+ neutrophils, we found that TG mice had significantly increased circulating neutrophils (Fig. 4GoB). Consistent with these findings, the absolute cell counts of neutrophils were increased by 8- to 10-fold in TG mice. Interestingly, the absolute counts of eosinophils were also dramatically increased (Fig. 4GoC), but the absolute number of lymphocytes was only slightly reduced (Fig. 4GoC). FACS analyses of cells isolated from spleen and lymph nodes also showed significantly increased neutrophils in the TG mice (data not shown). When lymphocytes from spleen and lymph nodes were examined, we found that CD3+ T cells were reduced by 20% (only significant in male TG mice; p = 0.009). In contrast, CD19+ B cells appeared to be increased in the TG mice, but this was not statistically significant (data not shown). Additional experiments are needed to examine the direct impact of IL-17E on the lymphocyte population. These findings suggest that IL-17E stimulates hemopoiesis and causes neutrophilia and eosinophilia in vivo. Although the underlying molecular mechanism remains to be further elucidated, these effects may be mediated in part by increased IL-5 and G-CSF (Figs. 2Go and 3Go and see below).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. FACS and hematology analyses of PBMC from TG mice. A, Reduced CD3+ T cell and CD19+ B cell populations in PBMC from TG mice. A representative example is shown. The percentage for each cell population is indicated. B, Increased GR-1+ neutrophil population in PBMC of TG mice. C, Changes in absolute cell counts of circulating neutrophils, eosinophils, and lymphocytes in TG mice. n = 5.

 
mIL-17E induces the expression of neutrophil-specific chemokine GRO{alpha} and adhesion molecules

Like IL-17, IL-17E stimulates IL-8 production in cell cultures (1, 5). To determine the effect of mIL-17E on the gene expression of other chemokines and adhesion molecules in vivo that might contribute to the immune infiltrate in tissues (see blow), we examined mRNA levels for GRO{alpha}, monocyte chemoattractant protein-1, ICAM-1, and VCAM-1 in multiple tissues from the TG mice. The GRO{alpha} mRNA was significantly induced in liver, kidneys, lungs, and heart, while ICAM-1 was increased in liver and VCAM-1 in kidneys (Fig. 2Go, A and B, and data not shown). These findings that mIL-17E may induce production of chemokines and adhesion molecules in epithelial cells, endothelial cells, and fibroblasts in various tissues, contributing to the recruitment of neutrophils, lymphocytes, and other infiltrating cells.

IL-17E stimulates G-CSF production

IL-17 stimulates the production of G-CSF, a potent inducer of granulopoiesis, in vivo and from stromal cells in vitro (7, 9, 19). To determine whether G-CSF was induced by IL-17E in vivo, its mRNA levels in TG tissues were measured. G-CSF mRNA levels were markedly increased in liver, kidneys, and spleen (Fig. 2Go, A and B, and data not shown). Consistent with this, serum G-CSF was also dramatically induced in TG mice (Fig. 5GoA). IL-17 directly stimulates G-CSF production from stromal cells, NIH-3T3, and ST2 (7). To determine whether IL-17E has a similar activity, NIH-3T3 and ST2 were treated with rIL-17E. Like IL-17, IL-17E stimulated G-CSF mRNA (Fig. 5Go, B and C). G-CSF protein production from NIH-3T3 cells was confirmed by ELISA (Fig. 5GoD). These findings suggest that IL-17E induces G-CSF production, and the increased G-CSF may contribute to the granulopoiesis seen in mIL-17E-TG mice.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. IL-17E induces G-CSF production. A, Increased serum G-CSF in mIL-17E-TG mice (n = 3). B and C, IL-17E stimulates G-CSF in NIH-3T3 and ST2 cells, respectively. mRNA expression of G-CSF was examined by a quantitative RT-PCR, and 18S rRNA levels were used as normalization controls. The data are presented as the fold increase (cells treated with IL-17 or IL-17E vs medium alone). The cells were treated as indicated. D, IL-17E induces the production of G-CSF protein. NIH-3T3 cells were treated with IL-17 (50 ng/ml) or IL-17E (50 ng/ml) for 24 h, and G-CSF levels in conditioned medium were measured by ELISA.

 
Overexpression of mIL-17E causes multiorgan inflammation

A comprehensive histological tissue survey showed that mIL-17E-TG mice had chronic inflammation in multiple tissues. Tissues consistently affected include liver, heart, lungs, lymph node, kidneys (renal pelvis and mild glomerular changes), spleen, and urinary bladder. Inflammation in these tissues was comprised of mixed infiltrates of neutrophils, eosinophils, lymphocytes, plasma cells, and macrophages. In the liver, all mIL-17E-TG mice evaluated had severe cholangiohepatitis with adenomatous hyperplasia of bile ducts, periportal fibrosis, and variable oval cell hyperplasia (Fig. 6Go, B vs A). Special stains, including Warthin Starry and periodic acid-Schiff, were negative for Helicobacter sp. and fungal elements, respectively (data not shown). In the lungs, mIL-17E-TG mice consistently develop diffuse interstitial and peribronchial inflammation, with more severe changes in the highest expressing founders (Fig. 6Go, C and D). In addition to the mixed inflammatory cell infiltrate described above, alveolar spaces were filled with numerous macrophages that were occasionally multinucleated and often distended with long, thin, cytoplasmic crystals, similar to those reported in the lungs of other mutant mouse models that have eosinophilic inflammation (20, 21). Consistent with these studies, crystals seen in the mIL-17E TGs were stained with eosin, but not periodic acid-Schiff or Congo Red. All IL-17E-TG mice examined had splenomegaly (data not shown). Splenic weights showed that, on the average, the mIL-17E-TG spleen weighed up to four times more than that of the non-TG littermates. Histologically, the splenomegaly was attributable to extensive extramedullary hemopoiesis (data not shown). Lymph nodes were also enlarged in the IL-17E TGs due to expansion of medullary and cortical sinuses by numerous plasma cells (data not shown). Thymic weights were slightly reduced (data not shown). These histological findings suggest that ubiquitous expression of mIL-17E causes profound pathological and immunological changes in multiple organs.



View larger version (167K):
[in this window]
[in a new window]
 
FIGURE 6. Comparison of histological changes in mIL-17E-TG mice (B and D) and non-TG littermates (A and C). A, Portal area of the liver from a wild-type littermate. B, Liver from a mIL-17E-TG mouse demonstrating severe periportal inflammation, fibrosis, and adenomatous hyperplasia of bile ducts. Note hypertrophied bile duct epithelial cells distended with eosinophilic homogeneous or crystalline material (arrow). C, Lung from a wild-type littermate with normal alveoli and bronchioles. D, Lung from a mIL-17E-TG mouse with diffuse inflammation within alveolar spaces, septa, and around airways. Note the hyperplastic bronchiole epithelium (arrow). H&E stain. Bar, 100 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-17E is a recently identified member of the IL-17 cytokine family. Although IL-17E appears to be a proinflammatory cytokine and induces IL-8 production in human cells, no in vivo biological activity has been described. To understand the in vivo action of this cytokine, we have generated and characterized TG mice that ubiquitously express the mIL-17E. The mIL-17E-TG mice exhibit growth retardation, jaundice, and striking multiorgan inflammation associated with mixed infiltrate.

The biological consequences of IL-17E exposure have both interesting similarities and clear distinctions to those reported for IL-17. Like IL-17, IL-17E impacts diverse tissues. This reflects in part the broad expression of its receptor (4, 5, 22). IL-17E promotes substantial neutrophilia, a response that may be due to the observed induction of G-CSF. IL-17 has also been shown to induce the production of G-CSF and promote neutrophilia (6, 7, 9, 19). Similarly, both IL-17 and IL-17E induce the local production of chemokines that target neutrophils such as GRO{alpha} and IL-8 (5, 8). Furthermore, both IL-17 and IL-17E are associated with increased expression of ICAM-1 and other inflammatory cytokines (1, 17). Although we could not exclude the possibility that some of the actions elicited by IL-17E might be mediated by IL-17, serum IL-17 was not elevated in IL-17E-TG mice (data not shown). Additional experiments using Abs against IL-17 or cells or mice deficient in IL-17/IL-17R are required to address these issues. In contrast, IL-17E overexpression resulted in the promotion of a systemic Th2-biased immune response. This response has not been noted with chronic IL-17 exposure (9). It should be mentioned that IL-17 can be produced by both Th1 and Th2 subsets, and it has not been strongly associated with either the Th1 or Th2 response (23, 24). The Th2 feature of this response in the TG mice was characterized by cytokine profile, the presence of increased serum IgE and IgG1, and an increase in eosinophil number. It was noted that in vivo expression of IL-17 increased the peripheral white blood cell count and 2-fold increases in lymphocytes (6, 9). In contrast, mIL-17E-TG mice appeared to be slightly lymphopenic. Further studies are required to understand the effect of IL-17E on lymphopoiesis and subtypes of lymphocytes. These comparisons should be viewed with caution, since the phenotype of IL-17-TG mice has not been reported.

Long-term exposure to IL-17E causes multiorgan inflammation. The inflammatory infiltrate in IL-17E-TG mice is comprised of eosinophils; however, mixed cellular infiltrates, including neutrophils and lymphocytes, are frequently present and may result from secondary necrosis or induction of proinflammatory chemokines. Epithelial hyperplasia was observed in multiple tissues. Interestingly, the IL-17Rh1 message is elevated in multiple tissues in the TG mice, suggesting that the spectrum of tissues upon which IL-17E can act is influenced by the regulation of receptor expression. In a survey of human cell lines by PCR for expression of IL-17Rh1 mRNA, message was detectable in nearly all cell lines examined and was detectable in cells of various hemopoietic lineages (our unpublished observations). In this context, the complete mechanisms by which IL-17E promotes the development of inflammation and a Th2-immune profile are as yet unclear, but may reflect, at least partially, direct actions on cells of the immune system.

Microbial lipopeptides have recently been identified as the first demonstrated pathological inducers of IL-17 production (23). Lipopeptides are known to signal through the Toll-related receptor 2 (25, 26). This suggests that normal IL-17 function may relate the defense against pathogens. Consistent with this, IL-17R has recently been shown to be required for host defense against bacterial pneumonia (27). The immunological or pathological source of IL-17E remains to be identified, but IL-17E mRNA is expressed at very low levels in peripheral tissues (5). It is likely that there exist stimuli, as yet unidentified, that induce elevated expression of IL-17E. The phenotype of the IL-17E-TG mice also resembles an immune response to pathogens, with an inflammation marked by the presence of neutrophils, eosinophils, and macrophage, cells that are important mediators of innate host defense. It is conceivable that certain pathogens or their byproducts may be inducers of IL-17E production. In addition, the Th2 response can be considered a means of promoting humoral defense, a key component in the immune strategy against extracellular pathogens. In addition, histological changes in the lungs of TG mice suggest that IL-17E might contribute to the pathogenesis of allergy/asthma. It may be that both IL-17 and IL-17E and perhaps other members of the IL-17 family play roles in the generation and regulation of interactions between the adaptive and innate immune responses. The mIL-17E-TG mice developed diffuse interstitial and peribronchial inflammation with alveolar space filled with macrophages. It will be important to examine whether IL-17E contributes to the pathogenesis of allergy/asthma in human.

Although overexpression of IL-17E appears to drive a Th2-biased response, increased expression of several Th1 cytokines (IFN-{gamma} mRNA and serum TNF-{alpha}) was also seen in the TG mice. This might have been from secondary tissue necrosis and contributed to the tissue-specific variation in immunological response and pathological changes. Systemic chronic exposure to IL-17E elicits inflammation in multiple organs; however, it is conceivable that local expression of IL-17E in tissues caused by certain disease conditions may induce a more localized, tissue-specific immunological response and pathological changes. Future efforts that aim at the identification of such disease conditions may provide therapeutic opportunities.


    Acknowledgments
 
We thank Sherman Fong, Iqbal Grewal, Tim Stewart, and Paul Godowski for helpful discussions, and Peter Ng and Mark Vasser for technical assistance.


    Footnotes
 
1 Address correspondence and reprint requests to Drs. Guohua Pan and Austin Gurney, Genentech, Inc., M/S-37, 1 DNA Way, South San Francisco, CA 94080. E-mail addresses: jgpan@gene.com and nico{at}gene.com Back

2 G.P. and D.F. share co-first authorship. Back

3 Abbreviations used in this paper: m, murine; TG, transgenic. Back

Received for publication July 25, 2001. Accepted for publication September 25, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fossiez, F., J. Banchereau, R. Murray, C. Van Kooten, P. Garrone, S. Lebeque. 1998. Interleukin-17. Int. Rev. Immunol. 16:541.[Medline]
  2. Yao, Z., S. L. Painter, W. C. Fanslow, D. Ulrich, B. M. Macduff, M. K. Spriggs, R. J. Armitage. 1995. Human IL-17: a novel cytokine derived from T cells. J. Immunol. 155:5483.[Abstract]
  3. Li, H., J. Chen, A. Huang, J. Stinson, S. Heldens, J. Foster, P. Dowd, A. L. Gurney, W. I. Wood. 2000. Cloning and characterization of IL-17B and IL-17C, two new members of the IL-17 cytokine family. Proc. Natl. Acad. Sci. USA 97:773.[Abstract/Free Full Text]
  4. Shi, Y., S. Ulrich, J. Zhang, K. Connolly, K. J. Grzegorzewski, M. C. Barber, W. Wang, K. Wathen, V. Hodge, C. L. Fisher, et al 2000. A novel cytokine receptor-ligand pair: identification, molecular characterization, and in vivo immunoregulatory activity. J. Biol. Chem. 275:19167.[Abstract/Free Full Text]
  5. Lee, J., W. H. Ho, M. Maruoka, R. T. Corpuz, D. T. Baldwin, J. S. Foster, A. D. Goddard, D. G. Yansura, R. L. Vandlen, W. I. Wood, et al 2001. IL-17E, a novel proinflammatory ligand for the IL-17 receptor homolog IL-17Rh1. J. Biol. Chem. 276:1660.[Abstract/Free Full Text]
  6. Schwarzenberger, P., W. Huang, P. Ye, P. Oliver, M. Manuel, Z. Zhang, G. Bagby, S. Nelson, J. K. Kolls. 2000. Requirement of endogenous stem cell factor and granulocyte-colony-stimulating factor for IL-17-mediatd granulopoiesis. J. Immunol. 164:4783.[Abstract/Free Full Text]
  7. Fossiez, F., O. Djossou, P. Chomarat, L. Flores-Romo, S. Ait-Yahia, C. Maat, J. J. Pin, P. Garrone, E. Garcia, S. Saeland, et al 1996. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J. Exp. Med. 183:2596.
  8. Witowski, J., K. Pawlaczyk, A. Breborowicz, A. Scheuren, M. Kuzlan-Pawlaczyk, J. Wisniewska, A. Polubinska, H. Friess, G. M. Gahl, U. Frei, et al 2000. IL-17 stimulates intraperitoneal neutrophil infiltration through the release of GRO {alpha} chemokine from mesothelial cells. J. Immunol. 165:5814.[Abstract/Free Full Text]
  9. Schwarzenberger, P., V. L. Russa, A. Miller, P. Ye, W. Huang, A. Zieske, S. Nelson, G. J. Bagby, D. Stoltz, R. L. Mynatt, et al 1998. IL-17 stimulates granulopoiesis in mice: use of an alternate, novel gene therapy-derived method for in vivo evaluation of cytokines. J. Immunol. 161:6383.[Abstract/Free Full Text]
  10. Laan, M., Z. H. Cui, H. Hoshino, J. Lötvall, M. Sjöstrand, D. C. Gruenert, B. E. Skoogh, A. Lindén. 1999. Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J. Immunol. 162:2347.[Abstract/Free Full Text]
  11. Linden, A., H. Hoshino, M. Laan. 2000. Airway neutrophils and interleukin-17. Eur. Respir. J. 15:973.[Abstract]
  12. Kotake, S., N. Udagawa, N. Takahashi, K. Matsuzaki, K. Itoh, S. Ishiyama, S. Saito, K. Inoue, N. Kamatani, M. T. Gillespie, et al 1999. IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J. Clin. Invest. 103:1345.[Medline]
  13. Kooten, C. V., J. G. Boonstra, M. E. Paape, F. Fossiez, J. Banchereau, S. Lebeque, J. A. Bruijn, J. W. De Fijter, L. A. Van Es, M. R. Daha. 1998. Interleukin-17 activates human renal epithelial cells in vitro and is expressed during renal allograft rejection. J. Am. Soc. Nephrol. 9:1526.[Abstract]
  14. Antonysamy, M. A., W. C. Fanslow, F. Fu, W. Li, S. Qian, A. B. Troutt, A. W. Thomson. 1999. Evidence for a role of IL-17 in alloimmunity: a novel IL-17 antagonist promotes heart graft survival. Transplant. Proc. 31:93.[Medline]
  15. Lubberts, E., L. A. B. Joosten, M. Chabaud, L. V. D. Bersselaar, B. Oppers, C. J. J. Coenen-de Roo, C. D. Richards, P. Miossec, W. B. Van den Berg. 2000. IL-4 gene therapy for collagen arthritis suppressed synovial IL-17 and osteoprotegerin ligand and prevents bone erosion. J. Clin. Invest. 105:1697.[Medline]
  16. Tian, E., J. R. Sawyer, D. A. Largaespada, N. A. Jenkins, N. G. Gopeland, Jr J. D. Shaughnessy. 2000. Evi27 encodes a novel membrane protein with homology to the IL-17 receptor. Oncogene 19:2098.[Medline]
  17. Faerman, A., M. Shani. 1993. The expression of the regulatory myosin light chain 2 gene during mouse embryogenesis. Development 118:919.[Abstract]
  18. Shani, M., I. Dekel, O. Yoffe. 1998. Expression of the rat myosin light-chain 2 gene in transgenic mice: stage specificity, developmental regulation, and interrelation with the endogenous gene. Mol. Cell. Biol. 8:1006.
  19. Metcalf, D.. 1991. Control of granulocytes and macrophages: molecular, cellular, and clinical aspects. Science 254:529.[Abstract/Free Full Text]
  20. Zhu, Z., R. Homer, Z. Wang, Q. Chen, G. P. Geba, J. Wang, Y. Zhang, J. A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J. Clin. Invest. 103:779.[Medline]
  21. Gao, L., R. S. Johnson, J. C. L. Schuh. 2000. Biochemical characterization of endogenously formed eosinophilic crystals in the lung of mice. J. Biol. Chem. 275:8023.
  22. Yao, Z., W. C. Fanslow, M. F. Seldens, A. M. Rousseau, S. L. Painter, M. R. Comeau, J. I. Cohen, M. K. Spriggs. 1995. Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity 3:811.[Medline]
  23. Infante-Duarte, C., H. F. Horton, M. C. Byrne, T. Kamradt. 2000. Microbial lipopeptides induce the production of IL-17 in Th cells. J. Immunol. 165:6107.[Abstract/Free Full Text]
  24. Albanesi, C., C. Scarponi, A. Cavani, M. Federici, F. Nasorri, G. Girolomoni. 2000. Interleukin-17 is produced by both Th1 and Th2 lymphocytes, and modulates interferon-{gamma}- and interleukin-4-induced activation of human keratinocytes. J. Invest. Dermatol. 115:81.[Medline]
  25. Brightbill, H. D., D. H. Librat, S. R. Krutzik, R. B. Yang, J. T. Belisle, J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al 1999. Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science 285:732.[Abstract/Free Full Text]
  26. Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Sugget, B. Devaux, J. D. Radolf, G. R. Klimpel, P. J. Godowski, A. Zychlinski. 1999. Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor-2. Science 285:736.[Abstract/Free Full Text]
  27. Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, et al 2001. Requirement of interleukin-17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J. Exp. Med. 194:519.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Sonobe, H. Takeuchi, K. Kataoka, H. Li, S. Jin, M. Mimuro, Y. Hashizume, Y. Sano, T. Kanda, T. Mizuno, et al.
Interleukin-25 Expressed by Brain Capillary Endothelial Cells Maintains Blood-Brain Barrier Function in a Protein Kinase C{epsilon}-dependent Manner
J. Biol. Chem., November 13, 2009; 284(46): 31834 - 31842.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Stock, V. Lombardi, V. Kohlrautz, and O. Akbari
Induction of Airway Hyperreactivity by IL-25 Is Dependent on a Subset of Invariant NKT Cells Expressing IL-17RB
J. Immunol., April 15, 2009; 182(8): 5116 - 5122.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Claudio, S. U. Sonder, S. Saret, G. Carvalho, T. R. Ramalingam, T. A. Wynn, A. Chariot, A. Garcia-Perganeda, A. Leonardi, A. Paun, et al.
The Adaptor Protein CIKS/Act1 Is Essential for IL-25-Mediated Allergic Airway Inflammation
J. Immunol., February 1, 2009; 182(3): 1617 - 1630.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Terashima, H. Watarai, S. Inoue, E. Sekine, R. Nakagawa, K. Hase, C. Iwamura, H. Nakajima, T. Nakayama, and M. Taniguchi
A novel subset of mouse NKT cells bearing the IL-17 receptor B responds to IL-25 and contributes to airway hyperreactivity
J. Exp. Med., November 24, 2008; 205(12): 2727 - 2733.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. A. Rickel, L. A. Siegel, B.-R. P. Yoon, J. B. Rottman, D. G. Kugler, D. A. Swart, P. M. Anders, J. E. Tocker, M. R. Comeau, and A. L. Budelsky
Identification of Functional Roles for Both IL-17RB and IL-17RA in Mediating IL-25-Induced Activities
J. Immunol., September 15, 2008; 181(6): 4299 - 4310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Kim, K. S. Lee, S. J. Park, K. H. Min, K. Y. Lee, Y. H. Choe, Y. R. Lee, J. S. Kim, S. J. Hong, and Y. C. Lee
PTEN Down-Regulates IL-17 Expression in a Murine Model of Toluene Diisocyanate-Induced Airway Disease
J. Immunol., November 15, 2007; 179(10): 6820 - 6829.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y.-H. Wang, P. Angkasekwinai, N. Lu, K. S. Voo, K. Arima, S. Hanabuchi, A. Hippe, C. J. Corrigan, C. Dong, B. Homey, et al.
IL-25 augments type 2 immune responses by enhancing the expansion and functions of TSLP-DC activated Th2 memory cells
J. Exp. Med., August 6, 2007; 204(8): 1837 - 1847.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. Angkasekwinai, H. Park, Y.-H. Wang, Y.-H. Wang, S. H. Chang, D. B. Corry, Y.-J. Liu, Z. Zhu, and C. Dong
Interleukin 25 promotes the initiation of proallergic type 2 responses
J. Exp. Med., July 9, 2007; 204(7): 1509 - 1517.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. A. Kleinschek, A. M. Owyang, B. Joyce-Shaikh, C. L. Langrish, Y. Chen, D. M. Gorman, W. M. Blumenschein, T. McClanahan, F. Brombacher, S. D. Hurst, et al.
IL-25 regulates Th17 function in autoimmune inflammation
J. Exp. Med., January 22, 2007; 204(1): 161 - 170.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Lajoie-Kadoch, P. Joubert, S. Letuve, A. J. Halayko, J. G. Martin, A. Soussi-Gounni, and Q. Hamid
TNF-{alpha} and IFN-{gamma} inversely modulate expression of the IL-17E receptor in airway smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1238 - L1246.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. G. Fallon, S. J. Ballantyne, N. E. Mangan, J. L. Barlow, A. Dasvarma, D. R. Hewett, A. McIlgorm, H. E. Jolin, and A. N.J. McKenzie
Identification of an interleukin (IL)-25-dependent cell population that provides IL-4, IL-5, and IL-13 at the onset of helminth expulsion
J. Exp. Med., April 17, 2006; 203(4): 1105 - 1116.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Maezawa, H. Nakajima, K. Suzuki, T. Tamachi, K. Ikeda, J.-i. Inoue, Y. Saito, and I. Iwamoto
Involvement of TNF Receptor-Associated Factor 6 in IL-25 Receptor Signaling
J. Immunol., January 15, 2006; 176(2): 1013 - 1018.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Ikeda, H. Nakajima, K. Suzuki, S.-i. Kagami, K. Hirose, A. Suto, Y. Saito, and I. Iwamoto
Mast cells produce interleukin-25 upon Fcepsilon RI-mediated activation
Blood, May 1, 2003; 101(9): 3594 - 3596.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. R. Kim, R. Manoukian, R. Yeh, S. M. Silbiger, D. M. Danilenko, S. Scully, J. Sun, M. L. DeRose, M. Stolina, D. Chang, et al.
Transgenic overexpression of human IL-17E results in eosinophilia, B-lymphocyte hyperplasia, and altered antibody production
Blood, September 18, 2002; 100(7): 2330 - 2340.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Aggarwal and A. L. Gurney
IL-17: prototype member of an emerging cytokine family
J. Leukoc. Biol., January 1, 2002; 71(1): 1 - 8.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, G.
Right arrow Articles by Gurney, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, G.
Right arrow Articles by Gurney, A. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS