|
|
||||||||


*
Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853; and
Departamento de Patologia Animal (Microbiologia e Immunologia), Facultad de Veterinaria, Universidad de Murcia, Murcia, Spain
| Abstract |
|---|
|
|
|---|
levels in infected, gene-deleted mice
were reduced 6075% relative to infected normal animals, and spleen
cell TNF-
was likewise reduced by
50%. These results highlight
an important role for CXCR2 in neutrophil migration, which may be
important for early control of infection and induction of immunity
during Toxoplasma infection. | Introduction |
|---|
|
|
|---|
Recently, mice with a targeted deletion of CXCR2, also known as murine IL-8R homolog (IL-8RL), were constructed (7). The animals display defective neutrophil migration in response to thioglycolate, although the killing function of intracellular and extracellular bacteria remains intact. In a model of urinary tract infection, transepithelial polymorphonuclear leukocyte (PMN) migration is defective, resulting in bacteremia and systemic disease (8, 9, 10). The murine IL-8R homolog has also been implicated in increased susceptibility during infections with pathogens such as Candida albicans and Legionella pneumophila (11, 12), but its role during protozoan infection has hitherto remained unexplored.
In our laboratory, we use the intracellular protozoan Toxoplasma gondii as a model to study initiation of immunity and early host resistance during microbial infection. Toxoplasmosis is a widespread parasitic infection among human and animal populations worldwide. In situations of immunodeficiency and during congenital infection, Toxoplasma emerges as a major opportunistic pathogen that can be lethal if not appropriately treated (13, 14). T. gondii is well known as a potent type 1 cytokine inducer, and while these cytokines are required to survive infection, their overproduction can lead to pathology and death (15, 16, 17, 18, 19, 20, 21, 22, 23).
We and others recently reported a requirement for neutrophils in early
resistance to T. gondii (24, 25, 26, 27). Although
these cells display microbicidal activity through phagocytosis and
release of superoxides and peroxides, it is also clear that PMN can
serve as a source of several proinflammatory cytokines during
infection. For the case of Toxoplasma, PMN release IL-12 and
TNF-
, as well as chemokines such as MIP-1
and MIP-1
, in
response to parasite stimulation (25, 28, 29). In an in
vitro model of infection, tachyzoites induced recruitment of large
neutrophil numbers into the peritoneal cavity within 4 h of
injection (30). The PMN were found to be the major source
of IL-12 in this model system, and Ab-mediated neutrophil depletion
resulted in early death of the animals, associated with defective type
1 cytokine responses (24). These results, and similar
findings by others (31, 32, 33, 34, 35, 36), led us to hypothesize that
PMN, by virtue of their ability to rapidly migrate to a site of
infection and release proinflammatory cytokines, may be important
immunoregulatory cells during the immune response to
Toxoplasma.
In the present report, we examined the ability of
CXCR2-/- mice to respond to T.
gondii infection. Our results reveal a profound defect in the
ability of neutrophils to migrate into the peritoneal cavity following
tachyzoite inoculation. Production of proinflammatory cytokines, in
particular TNF-
and IFN-
, was lower in CXCR2-deficient mice. The
gene-deleted mice harbored more parasites in the peritoneal cavity
during early infection and greater brain cyst numbers during chronic
infection. Mast cell-deficient
(KitW/KitW-v)
mice also displayed a defective ability to recruit PMN during early
infection, suggesting that these cells serve as a major chemokine
source involved in neutrophil recruitment. Our results suggest that
CXCR2 is required for early neutrophil recruitment, and that this
chemokine receptor and its ligands play an important protective role in
resistance to Toxoplasma.
| Materials and Methods |
|---|
|
|
|---|
Female BALB/c and 129/J mice (68 wk of age) were obtained from The Jackson Laboratory (Bar Harbor, ME). Heterozygous CXCR2 knockout (KO) mice (C.129S2(B6)-Cmkartm1/Mwm) were purchased from The Jackson Laboratory and bred at the College of Veterinary Medicine animal facility (Cornell University, Ithaca, NY). The KO animals were originally engineered by homologous recombination of a defective CXCR2 gene into 129 embryonic stem cells, followed by transplantation into C57BL/6 blastocysts. Resulting chimeric animals were backcrossed onto a BALB/c background for 10 generations (7). After genotyping for the CXCR2 gene, a colony of homozygous KO mice was established and used in the studies described. Female KO animals were age-matched to wild-type (WT) controls. Mast cell-deficient KitW/KitW-v and congenic normal WBB6F1+/+ littermates were obtained from The Jackson Laboratory. The mice were housed under specific pathogen-free conditions in the College of Veterinary Medicine animal facility, which is accredited by the American Association for Accreditation of Laboratory Care.
Mouse genotyping
To isolate DNA, tail snips were digested in lysis buffer (80 µl of 10% sodium dodecyl sulfate, 400 µl of 1 M Tris (pH 7.4), 400 µl of 1 M NaCl, 80 µl of 500 mM EDTA, 4 mg of proteinase K in 3040 ml of H2O per tail snip). Following an 18-h incubation at 56°C, 800 µl of H2O was added and digest-centrifuged, and resulting supernatant was added to premixed phenol/CHCl3/isoamylalcohol (25:24:1; Sigma-Aldrich, St. Louis, MO). After vortexing and centrifugation, the aqueous phase was collected and re-extracted with CHCl3. DNA precipitation was achieved by addition of 50 µl of 3 M sodium acetate and 1 ml of 100% ethanol followed by incubation at -70°C overnight. After centrifugation (10 min at 4°C), pellets were washed in 70% ethanol and resuspended in Tris-EDTA buffer, pH 8. DNA was quantitated on a UV spectrophotometer (Bio-Rad, Hercules, CA).
PCR amplification was accomplished as described elsewhere
(25) using primers specific for the CXCR2 gene and the
neomycin cassette, which replaces the single exon encoding the
IL-8Rh in KO mice (7). Primer sequences used were
GGTCGTACTGCGTATCCTGCCTCA (CXCR2, forward), TAGCCATGATCTTGAGAAGTCCAT
(CXCR2, reverse), CTTGGGTGGAGAGGCTATTC (neomycin, forward), and
AGGTGAGATGACAGGAGATC (neomycin, reverse). The amplification cycle
consisted of 2 min at 94°C followed by 30 cycles at 94°C for
30 s, 57°C for 30 s, and 72°C for 5 min. Chain elongation
at 72°C was continued for 5 min after the last cycle. Amplification
of CXCR2 and neomycin gene fragments results in 350- and 280-bp
products, respectively. An ethidium bromide gel showing PCR
amplification products from a representative typing experiment is shown
in Fig. 1
.
|
Parasites, Ag, and infection
Tachyzoites of the virulent RH strain were maintained in vitro by infection of human foreskin fibroblasts and biweekly passage in complete medium consisting of DMEM (Life Technologies, Gaithersburg, MD) supplemented with 1% FBS (HyClone Laboratories, Logan, UT), penicillin (100 U/ml), and streptomycin (100 µg/ml) (both from Life Technologies). Tachyzoites from freshly lysed fibroblast cultures were washed once with endotoxin-free PBS (Sigma-Aldrich) and resuspended in endotoxin-free PBS for i.p. injection. ME49 bradyzoite cysts were maintained in Swiss-Webster mice and infections were conducted as described previously (25). Soluble tachyzoite lysate Ag (STAg) was prepared by sonication of RH strain tachyzoites in the presence of protease inhibitors as described elsewhere (25). The STAg solution was stored at -70°C until use.
PECs
Peritoneal exudate cells (PEC; 2 x 105 per sample) collected by peritoneal lavage with 10 ml of PBS were cytospun (700 rpm for 5 min) onto glass microscope slides (VWR Scientific, Rochester, NY) using cytofunnels (Thermo Shandon, Pittsburgh, PA). To determine the composition of PEC and the number of parasites, differential counts were performed on Diff-Quick-stained (American Scientific Products, McGraw Park, IL) cytocentrifuge slides. A minimum of 300 cells were counted per slide.
Spleen cell culture
Spleens were collected from mice 7 days after i.p. infection with 100 ME49 cysts. After gentle mashing, cells were suspended in complete DMEM consisting of 10% FCS, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 10 mM HEPES buffer, 100 U/ml penicillin, 0.1 mg/ml streptomycin (all from Life Technologies), and 50 mM 2-ME (Sigma-Aldrich). The resulting single cell suspension was centrifuged for 7 min at 1,000 x g, supernatant was decanted, and erythrocytes were lysed using erythrocyte lysis buffer (Sigma-Aldrich). Cells were cultured (37°C; 5% CO2) in duplicate wells of 96-well plates (Costar, Cambridge, MA) at a concentration of 5 x 106 cells/ml with medium or STAg (2 µg/ml). After 24 or 48 h, supernatants were collected and stored at -20°C until assayed.
Cytokine measurement
To measure IFN-
, the ELISA was performed. Ninety-six-well
plates (Costar) were coated overnight at 4°C with mAb HB170 in ELISA
coating buffer (0.1 M
Na2CO3, 0.1 M
NaHCO3, 1 mM NaN3, pH 9.6).
After removing supernatant, plates were blocked for 1 h at 37°C
with 3% nonfat dry milk in PBS. After five washes with PBS containing
0.05% Tween (PBST), samples and rIFN-
standard (R&D Systems,
Minneapolis, MN) were added in 3% nonfat dry milk, and the plates were
incubated for 1 h at 37°C. Plates were washed five times in
PBST, biotinylated anti-IFN-
mAb XMG1.2 (BD PharMingen, San
Diego, CA) was added, and the plates were incubated at 37°C for
1 h. After washing five times, HRP-labeled streptavidin
(Kirkegaard & Perry Laboratories, Gaithersburg, MD) was added and
plates were incubated for 30 min at 37°C. Finally, plates were washed
10 times and 100 µl of ABTS substrate (Kirkegaard & Perry
Laboratories) was added to each well. Sample absorbances were measured
at 405 nm on a Microplate BioKinetics reader (Bio-Tek Instruments,
Winoosky, VT).
IL-12(p40) was measured in a similar manner, using plate-bound anti-IL-12 mAb C15.6 and biotinylated anti-IL-12 mAb C17.8 (kindly provided by G. Trinchieri, Wistar Institute, Philadelphia, PA). Plates were coated with C15.6 diluted in PBS, then blocked with 1% BSA (Sigma-Aldrich) in PBS. After washing, HRP-labeled streptavidin addition (Kirkegaard & Perry Laboratories), washing, and ABTS addition (Kirkegaard & Perry Laboratories), sample absorbances were measured at 405 nm.
TNF-
levels were measured by a mouse-specific TNF-
ELISA kit
according to the manufacturers instructions (R&D Systems).
Flow cytometric analysis
PEC and RBC-lysed splenocytes were washed with FACS buffer (1% FCS, 0.01% NaN3 in PBS) and blocked with anti-mouse CD16/CD32 (BD PharMingen) in PBS with 5% normal mouse serum for 30 min on ice. After the cells were washed with FACS buffer, FITC-conjugated anti-B220 (Caltag Laboratories, Burlingame, CA), anti-CD4, anti-Gr-1 (both from BD PharMingen), and PE-conjugated anti-F4.80 (Caltag Laboratories), anti-CD8 (BD PharMingen), and anti-CD11b (clone M1/70; BD PharMingen) were added, and the cells were incubated on ice for 30 min. The cells were analyzed on a FACSCalibur flow cytometer, and CellQuest software (BD Immunocytometry Systems, San Jose, CA) was used to analyze the data.
Statistical analysis
Significant differences were determined using Students t test. Values of p < 0.05 were considered significant. All experiments were performed on at least two independent occasions, and responses of individual animals were analyzed throughout.
| Results |
|---|
|
|
|---|
We initially confirmed the genotype of the
F1 generation resulting from a cross between
heterozygous CXCR2 WT and KO mice on a BALB/c genetic background (Fig. 1
). The homozygous KO animals were selected to establish a colony of
CXCR2-/- animals. Resulting homozygous KO and
WT control mice were infected by i.p. injection of 100 ME49 cysts, and
30 days later brains were removed for cyst enumeration. As shown in
Fig. 2
, brains from CXCR2 KO animals
harbored approximately five-fold greater cyst numbers than WT
mice.
|
Because IL-8 is a major neutrophil chemotactic cytokine, we
assessed the ability of PMN to migrate into the peritoneal cavity
following parasite inoculation. WT and KO animals were i.p. injected
with 2 x 106 RH strain tachyzoites. We
previously showed that the latter results in a rapid PMN influx,
detectable in C57BL/6 mice within 4 h of infection
(30). A similar result was found in BALB/c animals, with
an increase in neutrophils from 11% in noninfected mice to 45% in
animals infected 4 h previously (Fig. 3
). In a situation of CXCR2 deficiency,
the percentage of PMN was lower in noninfected animals (4%), and there
was a complete failure to recruit these cells following infection
(Fig. 3
).
|
Chemokines in general are regarded as highly redundant mediators;
therefore, it was of interest that recruitment of neutrophils in
CXCR2-/- mice was totally defective during
early infection. Nevertheless, it was possible that PMN could be
recruited by CXCR2-independent cytokines later in infection.
Accordingly, we examined peritoneal cell populations 36 h after
tachyzoite infection. At this time point, large numbers of PMN were
present in cell populations from WT mice (Fig. 4
, A and C). In
contrast, few or no neutrophils were evident in populations from
CXCR2-/- animals (B and
D).
|
|
|
|
Mast cells are capable of serving as a source of MIP-2 and
TNF-
, mediators which have been implicated in PMN recruitment in
models of bacterial host defense and T cell-mediated delayed-type
hypersensitivity (40, 41). The MIP-2 chemokine binds with
high affinity to CXCR2 (6). Therefore, to determine
whether mast cells were involved in the PMN influx during
Toxoplasma infection, we examined the response of mast
cell-deficient
KitW/KitW-v
mice. As shown in Fig. 5
B, the influx of
Gr-1+ cells was reduced approximately three-fold
in mast cell-deficient mice relative to control littermates.
Nevertheless, this decreased PMN influx was not as drastic as that seen
in CXCR2 KO mice, in which there was an
90% reduction in neutrophil
numbers (Fig. 5
B). We conclude that mast cells are an
important chemokine source driving PMN recruitment during T.
gondii infection, but that other cells are also likely to play a
role in providing these mediators in this infection model.
Parasite-induced type 1 cytokine responses are defective in CXCR2-/- animals
We next evaluated spleen cell responses in animals undergoing
acute Toxoplasma infection. The spleen cell phenotype was
evaluated by flow cytometry (Table I
).
Noninfected KO mice displayed increased levels of
Gr-1+ cells in the spleen, as previously
described (7), and this was also the case for 7-day
infected animals. The remaining populations of T lymphocytes, B
lymphocytes, macrophages, and NK cells appeared similar for both mouse
strains, with increases in all populations following infection,
although there was a small but statistically significant increase in
F4/80+ cells in CXCR2 KO animals.
|
and TNF-
responses were lower
using cells from 7-day infected KO mice relative to WT controls (Fig. 8
than WT controls, although there was not a significant
difference in TNF-
or IL-12 serum levels (Fig. 7
|
Genetic studies have mapped the Nramp1 gene to within 50 kb of the
murine IL-8Rh gene (43, 44). The Nramp1 gene is capable of
influencing resistance to intracellular bacteria (44).
Because the 129 mouse strain carries a WT Nramp1 allele and
the BALB/c strain carries a mutant Nramp1 allele, it was
possible that CXCR2 KO animals carried a 129-derived Nramp1
gene. We used primers specific for Nramp 783, the single nucleotide
position differing between the two parental mouse strains
(44), to amplify an Nramp1 amplicon in an allele-specific
manner. As shown in Fig. 9
A,
the KO strain retains a 129-derived Nramp1 gene, despite 10
generations of backcrossing to the BALB/c strain. To confirm that
presence of this allele was not affecting our results, we evaluated the
neutrophil influx in parental 129 and BALB/c mice. As shown in Fig. 9
B, a strong PMN
response was associated with both strains, despite carrying different
Nramp1 alleles. In addition, the percentage of infected
cells in the peritoneal cavity did not differ between the strains (Fig. 9
B). These results strongly argue that the disrupted
CXCR2 gene itself, rather than the 129-derived Nramp1
allele, accounts for the impaired neutrophil response in the KO
mice.
|
| Discussion |
|---|
|
|
|---|
Although mice do not express an IL-8 homolog, several CXC chemokines
bind to the IL-8Rh, including MIP-2 and KC (6, 46). Of
these, KC is
10-fold less potent than MIP-2, arguing that the latter
may be more important as a CXCR2 ligand. Nevertheless, in pulmonary
infections with Legionella pneumophila and Pseudomonas
aeruginosa, neutralization of either MIP-2 or KC resulted in only
partial blockade of the PMN influx, whereas Ab blocking of CXCR2
completely inhibited neutrophil recruitment (12, 47).
Thus, both MIP-2 and KC chemokines, by binding to CXCR2 on neutrophils,
may be involved in neutrophil trafficking during T. gondii
infection.
Previous studies on IL-12-/- and
IFN-
-/- mice have shown that T.
gondii infection induces abnormally high levels of PMN recruitment
into the peritoneal cavity (18, 27). Given our results, it
would be of interest to determine whether these cytokines play a
down-regulatory role in expression of either CXCR2 or ligands of this
chemokine receptor. We are currently examining MIP-2 and KC production,
as well as neutrophil CXCR2 expression in IL-12 and IFN-
KO mice to
determine levels of these mediators in the presence and absence of
IL-12 and IFN-
.
Our results showing that
KitW/KitW-v
mice display a defective neutrophil influx during T. gondii
infection implicate mast cells as an important chemokine source driving
CXCR2-dependent PMN migration into the peritoneal cavity. Because the
KitW/KitW-v
mice and their WT counterparts are on a different genetic background
than that of CXCR2 KO animals and the
KitW/KitW-v
mice also display other mast cell-independent abnormalities, this
result must be interpreted with some caution. Nevertheless, our
findings are in accord with those of others suggesting that mast
cells drive neutrophil recruitment through release of TNF-
and MIP-2
in models of bacterial clearance and T cell-mediated delayed-type
hypersensitivity (40, 41). In our experiments, the
defective neutrophil migration in mast cell-deficient mice was less
profound than that occurring in CXCR2 KO animals. The latter finding
may indicate that mast cells are not the sole source of CXCR2-binding
chemokines in the peritoneal cavity during infection. In this regard,
macrophages are capable of producing both MIP-2 and KC, and human
neutrophils themselves are a potent IL-8 source (48, 49, 50).
Although mice do not express IL-8, it is nevertheless possible that
murine PMN produce CXCR2-binding chemokines in response to T.
gondii, as has been shown for the CC chemokines MIP-1
and
MIP-1
(29).
In a related study to that reported in this work, it was shown that
CCR1 KO mice display increased susceptibility to T. gondii
(51). Unlike CXCR2, the ligands for CCR1 are CC chemokines
such as MIP-1
, MIP-1
, and RANTES (52). Indeed, the
phenotype for T. gondii-infected CCR1 and CXCR2 KO mice
appears distinct. Thus, CCR1-/- animals display
PMN trafficking to sites of infection but an impaired ability to
mobilize neutrophils and their precursors from the bone marrow
(51, 53). In contrast, our studies and those of others
(8, 10) show a defective ability of
CXCR2-/- neutrophils to migrate to sites of
infection. In addition, while we and others (12) found
evidence for defective proinflammatory cytokine responses in the
absence of a functional CXCR2, this was not the case in
CCR1-/- mice. Differences in the chemotactic
effects of CCR1 and CXCR2 ligands on PMN may underlie these disparate
effects.
In our experiments, we found a dramatic infection-induced loss of F4/80 strongly positive cells in the peritoneal cavity of both WT and KO animals. This was accompanied by an increase in cells expressing intermediate amounts of F4/80 and Gr-1. Fluorescence microscopy suggested that the latter population was composed mainly of macrophages/monocytes (data not shown), and, indeed, macrophages/monocytes have been previously found to express low levels of Gr-1 during models of inflammation (54). The apparent loss of F4/80 bright-staining cells may reflect infection-induced maturation of monocytes, as down-regulation of this Ag is associated with the latter process (39).
The results of our study show that defective neutrophil recruitment is
associated with increased host susceptibility and is detectable within
36 h of infection as increased tachyzoite numbers in the
peritoneal cavity, and at 30 days postinfection as increased numbers of
cysts establishing within the brain. The reason for this increased
susceptibility is not known; however, we and others have presented
evidence for an immunoregulatory role of PMN in initiating type 1
cytokine responses (12, 24, 31, 33, 55). The present data
are consistent with this concept. Thus, CXCR2 KO mice displayed
dysregulated IFN-
and TNF-
responses in the spleen, and serum
IFN-
levels were dramatically lower in the IL-8Rh KO mice. The fact
that IFN-
responses were not totally absent likely accounts for the
ability of CXCR2 KO mice to survive infection, albeit with higher cyst
numbers. Nevertheless, while these data are consistent with a role for
PMN in triggering type 1 cytokine responses, we cannot exclude the
possibility that susceptibility of the CXCR2-/-
mouse strain reflects decreased microbicidal activity at the site of
infection.
The results of this study indicate that, in addition to an inactive CXCR2 gene, the KO animals differ from BALB/c WT mice by retaining an Nramp1 allele associated with resistance to Mycobacterium bovis. It is also of note that the Nramp1 gene may influence susceptibility to T. gondii (56). However, we think it unlikely that differences in the Nramp1 allele account for the defective PMN responses between WT and KO strains for the following reasons. First, our results show that the parental strains, which differ in Nramp1 alleles, display an identical neutrophil influx during infection and an equivalent parasite level in the peritoneal cavity. Second, while the Nramp1 gene may influence macrophage production of the CXCR2 ligand KC, the particular allele carried by the KO strain is associated with increased, rather than decreased, KC gene expression (57). Therefore, our data suggest that absence of CXCR2 itself, rather than an allele-specific Nramp1 influence, accounts for the effects reported in this work.
In sum, our results point to an important function for CXCR2 in trafficking PMN to the site of protozoan infection. In this study, such newly recruited cytokine-secreting neutrophils may play a role in macrophage and dendritic cell activation, as well as displaying direct microbicidal activity. In this manner, PMN recruitment is likely to be an essential early step in controlling microbial infection and may underlie induction of acquired immunity to Toxoplasma and many other infections.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Eric Y. Denkers, Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853-6401. E-mail address: eyd1{at}cornell.edu ![]()
3 Abbreviations used in this paper: MIP, macrophage inflammatory protein; PMN, polymorphonuclear leukocyte; KO, knockout; STAg, soluble tachyzoite lysate Ag; WT, wild type; PEC, peritoneal exudate cell; IL-8Rh, IL-8R homolog. ![]()
Received for publication June 8, 2001. Accepted for publication October 1, 2001.
| References |
|---|
|
|
|---|
production in T cells mediating chronic resistance to the intracellular pathogen, Toxoplasma gondii. J. Immunol. 165:628.
mice develop unimpaired IL-12 responses to Toxoplasma gondii while failing to control acute infection. J. Immunol. 157:4045.[Abstract]
: the major mediator of resistance against Toxoplasma gondii. Science 240:516.
synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533.[Abstract]
, and TNF-
. J. Immunol. 157:798.[Abstract]
-independent IL-12. J. Immunol. 163:2081.
, and the chemokines macrophage-inflammatory protein-1
and -1
in response to Toxoplasma gondii antigens. J. Immunol. 162:7369.
. Nature 381:77.[Medline]
This article has been cited by other articles:
![]() |
C.-H. Ju, A. Chockalingam, and C. A. Leifer Early Response of Mucosal Epithelial Cells during Toxoplasma gondii Infection J. Immunol., December 1, 2009; 183(11): 7420 - 7427. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Chuang, S. Altuwaijri, G. Li, J.-J. Lai, C.-Y. Chu, K.-P. Lai, H.-Y. Lin, J.-W. Hsu, P. Keng, M.-C. Wu, et al. Neutropenia with impaired host defense against microbial infection in mice lacking androgen receptor J. Exp. Med., May 11, 2009; 206(5): 1181 - 1199. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Gigley, B. A. Fox, and D. J. Bzik Cell-Mediated Immunity to Toxoplasma gondii Develops Primarily by Local Th1 Host Immune Responses in the Absence of Parasite Replication J. Immunol., January 15, 2009; 182(2): 1069 - 1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Cardona, M. Li, L. Liu, C. Savarin, and R. M. Ransohoff Chemokines in and out of the central nervous system: much more than chemotaxis and inflammation J. Leukoc. Biol., September 1, 2008; 84(3): 587 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Benevides, C. M. Milanezi, L. M. Yamauchi, C. F. Benjamim, J. S. Silva, and N. M. Silva CCR2 Receptor Is Essential to Activate Microbicidal Mechanisms to Control Toxoplasma gondii Infection in the Central Nervous System Am. J. Pathol., September 1, 2008; 173(3): 741 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Carlson, M. Kroenke, P. Rao, T. E. Lane, and B. Segal The Th17-ELR+ CXC chemokine pathway is essential for the development of central nervous system autoimmune disease J. Exp. Med., April 14, 2008; 205(4): 811 - 823. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kesteman, G. Vansanten, B. Pajak, S. M. Goyert, and M. Moser Injection of lipopolysaccharide induces the migration of splenic neutrophils to the T cell area of the white pulp: role of CD14 and CXC chemokines J. Leukoc. Biol., March 1, 2008; 83(3): 640 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Pesce, Z. Liu, H. Hamed, F. Alem, J. Whitmire, H. Lin, Q. Liu, J. F. Urban Jr., and W. C. Gause Neutrophils Clear Bacteria Associated with Parasitic Nematodes Augmenting the Development of an Effective Th2-Type Response J. Immunol., January 1, 2008; 180(1): 464 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Lee, W. Sukhumavasi, and E. Y. Denkers Phosphoinositide-3-Kinase-Dependent, MyD88-Independent Induction of CC-Type Chemokines Characterizes the Macrophage Response to Toxoplasma gondii Strains with High Virulence Infect. Immun., December 1, 2007; 75(12): 5788 - 5797. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Buanne, E. Di Carlo, L. Caputi, L. Brandolini, M. Mosca, F. Cattani, L. Pellegrini, L. Biordi, G. Coletti, C. Sorrentino, et al. Crucial pathophysiological role of CXCR2 in experimental ulcerative colitis in mice J. Leukoc. Biol., November 1, 2007; 82(5): 1239 - 1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Goldszmid, A. Bafica, D. Jankovic, C. G. Feng, P. Caspar, R. Winkler-Pickett, G. Trinchieri, and A. Sher TAP-1 indirectly regulates CD4+ T cell priming in Toxoplasma gondii infection by controlling NK cell IFN-{gamma} production J. Exp. Med., October 29, 2007; 204(11): 2591 - 2602. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Sukhumavasi, C. E. Egan, and E. Y. Denkers Mouse Neutrophils Require JNK2 MAPK for Toxoplasma gondii-Induced IL-12p40 and CCL2/MCP-1 Release J. Immunol., September 15, 2007; 179(6): 3570 - 3577. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Shaftel, T. J. Carlson, J. A. Olschowka, S. Kyrkanides, S. B. Matousek, and M. K. O'Banion Chronic Interleukin-1{beta} Expression in Mouse Brain Leads to Leukocyte Infiltration and Neutrophil-Independent Blood Brain Barrier Permeability without Overt Neurodegeneration J. Neurosci., August 29, 2007; 27(35): 9301 - 9309. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rydstrom and M. J. Wick Monocyte Recruitment, Activation, and Function in the Gut-Associated Lymphoid Tissue during Oral Salmonella Infection J. Immunol., May 1, 2007; 178(9): 5789 - 5801. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Bonnett, E. J. Cornish, A. G. Harmsen, and J. B. Burritt Early Neutrophil Recruitment and Aggregation in the Murine Lung Inhibit Germination of Aspergillus fumigatus Conidia Infect. Immun., December 1, 2006; 74(12): 6528 - 6539. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Galioto, J. A. Hess, T. J. Nolan, G. A. Schad, J. J. Lee, and D. Abraham Role of Eosinophils and Neutrophils in Innate and Adaptive Protective Immunity to Larval Strongyloides stercoralis in Mice. Infect. Immun., October 1, 2006; 74(10): 5730 - 5738. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Gombart, U. Krug, J. O'Kelly, E. An, V. Vegesna, and H. P. Koeffler Aberrant expression of neutrophil and macrophage-related genes in a murine model for human neutrophil-specific granule deficiency J. Leukoc. Biol., November 1, 2005; 78(5): 1153 - 1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Iyoda, K. Nagata, M. Akashi, and Y. Kobayashi Neutrophils Accelerate Macrophage-Mediated Digestion of Apoptotic Cells In Vivo as Well as In Vitro J. Immunol., September 15, 2005; 175(6): 3475 - 3483. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rambeaud and G. M. Pighetti Impaired Neutrophil Migration Associated with Specific Bovine CXCR2 Genotypes Infect. Immun., August 1, 2005; 73(8): 4955 - 4959. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Robben, M. LaRegina, W. A. Kuziel, and L. D. Sibley Recruitment of Gr-1+ monocytes is essential for control of acute toxoplasmosis J. Exp. Med., June 6, 2005; 201(11): 1761 - 1769. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bennouna and E. Y. Denkers Microbial Antigen Triggers Rapid Mobilization of TNF-{alpha} to the Surface of Mouse Neutrophils Transforming Them into Inducers of High-Level Dendritic Cell TNF-{alpha} Production J. Immunol., April 15, 2005; 174(8): 4845 - 4851. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Kelly, J. K. Kolls, K. Happel, J. D. Schwartzman, P. Schwarzenberger, C. Combe, M. Moretto, and I. A. Khan Interleukin-17/Interleukin-17 Receptor-Mediated Signaling Is Important for Generation of an Optimal Polymorphonuclear Response against Toxoplasma gondii Infection Infect. Immun., January 1, 2005; 73(1): 617 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Johnston, J. P. Mizgerd, and S. A. Shore CXCR2 is essential for maximal neutrophil recruitment and methacholine responsiveness after ozone exposure Am J Physiol Lung Cell Mol Physiol, January 1, 2005; 288(1): L61 - L67. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Gavrilescu, B. A. Butcher, L. Del Rio, G. A. Taylor, and E. Y. Denkers STAT1 Is Essential for Antimicrobial Effector Function but Dispensable for Gamma Interferon Production during Toxoplasma gondii Infection Infect. Immun., March 1, 2004; 72(3): 1257 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Banerjee, P. S. Biswas, B. Kim, S. Lee, and B. T. Rouse CXCR2-/- Mice Show Enhanced Susceptibility to Herpetic Stromal Keratitis: A Role for IL-6-Induced Neovascularization J. Immunol., January 15, 2004; 172(2): 1237 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Pelus, H. Bian, A. G. King, and S. Fukuda Neutrophil-derived MMP-9 mediates synergistic mobilization of hematopoietic stem and progenitor cells by the combination of G-CSF and the chemokines GRO{beta}/CXCL2 and GRO{beta}T /CXCL2{Delta}4 Blood, January 1, 2004; 103(1): 110 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Mordue and L. D. Sibley A novel population of Gr-1+-activated macrophages induced during acute toxoplasmosis J. Leukoc. Biol., December 1, 2003; 74(6): 1015 - 1025. [Abstract] [Full Text] |
||||
![]() |
S. Bennouna, S. K. Bliss, T. J. Curiel, and E. Y. Denkers Cross-Talk in the Innate Immune System: Neutrophils Instruct Recruitment and Activation of Dendritic Cells during Microbial Infection J. Immunol., December 1, 2003; 171(11): 6052 - 6058. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Miller, R. M. Strieter, A. D. Gruber, S. B. Ho, and N. W. Lukacs CXCR2 Regulates Respiratory Syncytial Virus-Induced Airway Hyperreactivity and Mucus Overproduction J. Immunol., March 15, 2003; 170(6): 3348 - 3356. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Morris, A. Coppin, S. Tomavo, and V. B. Carruthers Functional Analysis of Toxoplasma gondii Protease Inhibitor 1 J. Biol. Chem., November 15, 2002; 277(47): 45259 - 45266. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Mehrad, M. Wiekowski, B. E. Morrison, S.-C. Chen, E. C. Coronel, D. J. Manfra, and S. A. Lira Transient Lung-Specific Expression of the Chemokine KC Improves Outcome in Invasive Aspergillosis Am. J. Respir. Crit. Care Med., November 1, 2002; 166(9): 1263 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Barragan and L. D. Sibley Transepithelial Migration of Toxoplasma gondii Is Linked to Parasite Motility and Virulence J. Exp. Med., June 17, 2002; 195(12): 1625 - 1633. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |