The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Del Rio, L.
Right arrow Articles by Denkers, E. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Del Rio, L.
Right arrow Articles by Denkers, E. Y.
The Journal of Immunology, 2001, 167: 6503-6509.
Copyright © 2001 by The American Association of Immunologists

CXCR2 Deficiency Confers Impaired Neutrophil Recruitment and Increased Susceptibility During Toxoplasma gondii Infection1

Laura Del Rio{dagger}, Soumaya Bennouna*, Jesus Salinas{dagger} and Eric Y. Denkers*,2

* Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853; and {dagger} Departamento de Patologia Animal (Microbiologia e Immunologia), Facultad de Veterinaria, Universidad de Murcia, Murcia, Spain


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neutrophil migration to the site of infection is a critical early step in host immunity to microbial pathogens, in which chemokines and their receptors play an important role. In this work, mice deficient in expression of the chemokine receptor CXCR2 were infected with Toxoplasma gondii and the outcome was monitored. Gene-deleted animals displayed completely defective neutrophil recruitment, which was apparent at 4 h and sustained for at least 36 h. KitW/KitW-v animals also displayed defective polymorphonuclear leukocyte migration, suggesting mast cells as one source of chemokines driving the response. Tachyzoite infection and replication were accelerated in CXCR2-/- animals, resulting in establishment of higher cyst numbers in the brain relative to wild-type controls. Furthermore, serum and spleen cell IFN-{gamma} levels in infected, gene-deleted mice were reduced 60–75% relative to infected normal animals, and spleen cell TNF-{alpha} was likewise reduced by ~50%. These results highlight an important role for CXCR2 in neutrophil migration, which may be important for early control of infection and induction of immunity during Toxoplasma infection.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CXC chemokine IL-8 is an important chemoattractant and activator of neutrophils (1, 2, 3). In humans, there are two high-affinity receptors for IL-8, designated CXCR1 and CXCR2 (4, 5). Although mice do not possess a homologous IL-8 gene, they express a CXCR with similarity to human CXCR2 which is expressed predominantly on neutrophils. The murine receptor binds several IL-8-like CXC chemokines, most notably macrophage inflammatory protein (MIP)3-2 and KC (6).

Recently, mice with a targeted deletion of CXCR2, also known as murine IL-8R homolog (IL-8RL), were constructed (7). The animals display defective neutrophil migration in response to thioglycolate, although the killing function of intracellular and extracellular bacteria remains intact. In a model of urinary tract infection, transepithelial polymorphonuclear leukocyte (PMN) migration is defective, resulting in bacteremia and systemic disease (8, 9, 10). The murine IL-8R homolog has also been implicated in increased susceptibility during infections with pathogens such as Candida albicans and Legionella pneumophila (11, 12), but its role during protozoan infection has hitherto remained unexplored.

In our laboratory, we use the intracellular protozoan Toxoplasma gondii as a model to study initiation of immunity and early host resistance during microbial infection. Toxoplasmosis is a widespread parasitic infection among human and animal populations worldwide. In situations of immunodeficiency and during congenital infection, Toxoplasma emerges as a major opportunistic pathogen that can be lethal if not appropriately treated (13, 14). T. gondii is well known as a potent type 1 cytokine inducer, and while these cytokines are required to survive infection, their overproduction can lead to pathology and death (15, 16, 17, 18, 19, 20, 21, 22, 23).

We and others recently reported a requirement for neutrophils in early resistance to T. gondii (24, 25, 26, 27). Although these cells display microbicidal activity through phagocytosis and release of superoxides and peroxides, it is also clear that PMN can serve as a source of several proinflammatory cytokines during infection. For the case of Toxoplasma, PMN release IL-12 and TNF-{alpha}, as well as chemokines such as MIP-1{alpha} and MIP-1{beta}, in response to parasite stimulation (25, 28, 29). In an in vitro model of infection, tachyzoites induced recruitment of large neutrophil numbers into the peritoneal cavity within 4 h of injection (30). The PMN were found to be the major source of IL-12 in this model system, and Ab-mediated neutrophil depletion resulted in early death of the animals, associated with defective type 1 cytokine responses (24). These results, and similar findings by others (31, 32, 33, 34, 35, 36), led us to hypothesize that PMN, by virtue of their ability to rapidly migrate to a site of infection and release proinflammatory cytokines, may be important immunoregulatory cells during the immune response to Toxoplasma.

In the present report, we examined the ability of CXCR2-/- mice to respond to T. gondii infection. Our results reveal a profound defect in the ability of neutrophils to migrate into the peritoneal cavity following tachyzoite inoculation. Production of proinflammatory cytokines, in particular TNF-{alpha} and IFN-{gamma}, was lower in CXCR2-deficient mice. The gene-deleted mice harbored more parasites in the peritoneal cavity during early infection and greater brain cyst numbers during chronic infection. Mast cell-deficient (KitW/KitW-v) mice also displayed a defective ability to recruit PMN during early infection, suggesting that these cells serve as a major chemokine source involved in neutrophil recruitment. Our results suggest that CXCR2 is required for early neutrophil recruitment, and that this chemokine receptor and its ligands play an important protective role in resistance to Toxoplasma.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

Female BALB/c and 129/J mice (6–8 wk of age) were obtained from The Jackson Laboratory (Bar Harbor, ME). Heterozygous CXCR2 knockout (KO) mice (C.129S2(B6)-Cmkartm1/Mwm) were purchased from The Jackson Laboratory and bred at the College of Veterinary Medicine animal facility (Cornell University, Ithaca, NY). The KO animals were originally engineered by homologous recombination of a defective CXCR2 gene into 129 embryonic stem cells, followed by transplantation into C57BL/6 blastocysts. Resulting chimeric animals were backcrossed onto a BALB/c background for 10 generations (7). After genotyping for the CXCR2 gene, a colony of homozygous KO mice was established and used in the studies described. Female KO animals were age-matched to wild-type (WT) controls. Mast cell-deficient KitW/KitW-v and congenic normal WBB6F1+/+ littermates were obtained from The Jackson Laboratory. The mice were housed under specific pathogen-free conditions in the College of Veterinary Medicine animal facility, which is accredited by the American Association for Accreditation of Laboratory Care.

Mouse genotyping

To isolate DNA, tail snips were digested in lysis buffer (80 µl of 10% sodium dodecyl sulfate, 400 µl of 1 M Tris (pH 7.4), 400 µl of 1 M NaCl, 80 µl of 500 mM EDTA, 4 mg of proteinase K in 3040 ml of H2O per tail snip). Following an 18-h incubation at 56°C, 800 µl of H2O was added and digest-centrifuged, and resulting supernatant was added to premixed phenol/CHCl3/isoamylalcohol (25:24:1; Sigma-Aldrich, St. Louis, MO). After vortexing and centrifugation, the aqueous phase was collected and re-extracted with CHCl3. DNA precipitation was achieved by addition of 50 µl of 3 M sodium acetate and 1 ml of 100% ethanol followed by incubation at -70°C overnight. After centrifugation (10 min at 4°C), pellets were washed in 70% ethanol and resuspended in Tris-EDTA buffer, pH 8. DNA was quantitated on a UV spectrophotometer (Bio-Rad, Hercules, CA).

PCR amplification was accomplished as described elsewhere (25) using primers specific for the CXCR2 gene and the neomycin cassette, which replaces the single exon encoding the IL-8Rh in KO mice (7). Primer sequences used were GGTCGTACTGCGTATCCTGCCTCA (CXCR2, forward), TAGCCATGATCTTGAGAAGTCCAT (CXCR2, reverse), CTTGGGTGGAGAGGCTATTC (neomycin, forward), and AGGTGAGATGACAGGAGATC (neomycin, reverse). The amplification cycle consisted of 2 min at 94°C followed by 30 cycles at 94°C for 30 s, 57°C for 30 s, and 72°C for 5 min. Chain elongation at 72°C was continued for 5 min after the last cycle. Amplification of CXCR2 and neomycin gene fragments results in 350- and 280-bp products, respectively. An ethidium bromide gel showing PCR amplification products from a representative typing experiment is shown in Fig. 1Go.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. Genotypic analysis of mice from a heterozygous cross between WT and CXCR2 KO mice. DNA was isolated from tail snips of F1 progeny from +/- x +/- crosses and subjected to RT-PCR-mediated amplification of the endogenous CXCR2 gene and neomycin (Neo), which replaces CXCR2 in the KO chromosome. Amplified DNA was subjected to agarose gel electrophoresis and products were visualized by viewing ethidium bromide-stained gels under UV illumination.

 
Genotyping of Nramp1 was performed essentially as described above. The primers used were TGGACGCATCCCGCTGTGGGG (forward primer specific for 129-derived Nramp1), TGGACGCATCCCGCTGTGGGA (forward primer specific for BALB/c-derived Nramp1), and GCATGATGATGGCACCGACGAT (common reverse primer). The amplification cycle consisted of 2 min at 94°C followed by 26 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 5 min. Chain elongation at 72°C was continued for 5 min after the last cycle. RT-PCR amplification of this portion of the Nramp1 gene results in a 790-bp amplicon, as predicted from sequence data (37) and as confirmed by agarose gel electrophoresis.

Parasites, Ag, and infection

Tachyzoites of the virulent RH strain were maintained in vitro by infection of human foreskin fibroblasts and biweekly passage in complete medium consisting of DMEM (Life Technologies, Gaithersburg, MD) supplemented with 1% FBS (HyClone Laboratories, Logan, UT), penicillin (100 U/ml), and streptomycin (100 µg/ml) (both from Life Technologies). Tachyzoites from freshly lysed fibroblast cultures were washed once with endotoxin-free PBS (Sigma-Aldrich) and resuspended in endotoxin-free PBS for i.p. injection. ME49 bradyzoite cysts were maintained in Swiss-Webster mice and infections were conducted as described previously (25). Soluble tachyzoite lysate Ag (STAg) was prepared by sonication of RH strain tachyzoites in the presence of protease inhibitors as described elsewhere (25). The STAg solution was stored at -70°C until use.

PECs

Peritoneal exudate cells (PEC; 2 x 105 per sample) collected by peritoneal lavage with 10 ml of PBS were cytospun (700 rpm for 5 min) onto glass microscope slides (VWR Scientific, Rochester, NY) using cytofunnels (Thermo Shandon, Pittsburgh, PA). To determine the composition of PEC and the number of parasites, differential counts were performed on Diff-Quick-stained (American Scientific Products, McGraw Park, IL) cytocentrifuge slides. A minimum of 300 cells were counted per slide.

Spleen cell culture

Spleens were collected from mice 7 days after i.p. infection with 100 ME49 cysts. After gentle mashing, cells were suspended in complete DMEM consisting of 10% FCS, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 10 mM HEPES buffer, 100 U/ml penicillin, 0.1 mg/ml streptomycin (all from Life Technologies), and 50 mM 2-ME (Sigma-Aldrich). The resulting single cell suspension was centrifuged for 7 min at 1,000 x g, supernatant was decanted, and erythrocytes were lysed using erythrocyte lysis buffer (Sigma-Aldrich). Cells were cultured (37°C; 5% CO2) in duplicate wells of 96-well plates (Costar, Cambridge, MA) at a concentration of 5 x 106 cells/ml with medium or STAg (2 µg/ml). After 24 or 48 h, supernatants were collected and stored at -20°C until assayed.

Cytokine measurement

To measure IFN-{gamma}, the ELISA was performed. Ninety-six-well plates (Costar) were coated overnight at 4°C with mAb HB170 in ELISA coating buffer (0.1 M Na2CO3, 0.1 M NaHCO3, 1 mM NaN3, pH 9.6). After removing supernatant, plates were blocked for 1 h at 37°C with 3% nonfat dry milk in PBS. After five washes with PBS containing 0.05% Tween (PBST), samples and rIFN-{gamma} standard (R&D Systems, Minneapolis, MN) were added in 3% nonfat dry milk, and the plates were incubated for 1 h at 37°C. Plates were washed five times in PBST, biotinylated anti-IFN-{gamma} mAb XMG1.2 (BD PharMingen, San Diego, CA) was added, and the plates were incubated at 37°C for 1 h. After washing five times, HRP-labeled streptavidin (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was added and plates were incubated for 30 min at 37°C. Finally, plates were washed 10 times and 100 µl of ABTS substrate (Kirkegaard & Perry Laboratories) was added to each well. Sample absorbances were measured at 405 nm on a Microplate BioKinetics reader (Bio-Tek Instruments, Winoosky, VT).

IL-12(p40) was measured in a similar manner, using plate-bound anti-IL-12 mAb C15.6 and biotinylated anti-IL-12 mAb C17.8 (kindly provided by G. Trinchieri, Wistar Institute, Philadelphia, PA). Plates were coated with C15.6 diluted in PBS, then blocked with 1% BSA (Sigma-Aldrich) in PBS. After washing, HRP-labeled streptavidin addition (Kirkegaard & Perry Laboratories), washing, and ABTS addition (Kirkegaard & Perry Laboratories), sample absorbances were measured at 405 nm.

TNF-{alpha} levels were measured by a mouse-specific TNF-{alpha} ELISA kit according to the manufacturer’s instructions (R&D Systems).

Flow cytometric analysis

PEC and RBC-lysed splenocytes were washed with FACS buffer (1% FCS, 0.01% NaN3 in PBS) and blocked with anti-mouse CD16/CD32 (BD PharMingen) in PBS with 5% normal mouse serum for 30 min on ice. After the cells were washed with FACS buffer, FITC-conjugated anti-B220 (Caltag Laboratories, Burlingame, CA), anti-CD4, anti-Gr-1 (both from BD PharMingen), and PE-conjugated anti-F4.80 (Caltag Laboratories), anti-CD8 (BD PharMingen), and anti-CD11b (clone M1/70; BD PharMingen) were added, and the cells were incubated on ice for 30 min. The cells were analyzed on a FACSCalibur flow cytometer, and CellQuest software (BD Immunocytometry Systems, San Jose, CA) was used to analyze the data.

Statistical analysis

Significant differences were determined using Student’s t test. Values of p < 0.05 were considered significant. All experiments were performed on at least two independent occasions, and responses of individual animals were analyzed throughout.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CXCR2-/- mice display increased susceptibility to infection

We initially confirmed the genotype of the F1 generation resulting from a cross between heterozygous CXCR2 WT and KO mice on a BALB/c genetic background (Fig. 1Go). The homozygous KO animals were selected to establish a colony of CXCR2-/- animals. Resulting homozygous KO and WT control mice were infected by i.p. injection of 100 ME49 cysts, and 30 days later brains were removed for cyst enumeration. As shown in Fig. 2Go, brains from CXCR2 KO animals harbored approximately five-fold greater cyst numbers than WT mice.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. Cyst numbers are elevated in brains of CXCR2 KO relative to WT mice. Animals were infected by i.p. inoculation of 100 ME49 cysts. After 30 days, brains were removed and homogenized, and cyst numbers enumerated. Each circle represents an individual mouse. This experiment was repeated three times with equivalent results.

 
Neutrophils fail to migrate into the peritoneal cavity during early infection in CXCR2 KO mice

Because IL-8 is a major neutrophil chemotactic cytokine, we assessed the ability of PMN to migrate into the peritoneal cavity following parasite inoculation. WT and KO animals were i.p. injected with 2 x 106 RH strain tachyzoites. We previously showed that the latter results in a rapid PMN influx, detectable in C57BL/6 mice within 4 h of infection (30). A similar result was found in BALB/c animals, with an increase in neutrophils from 11% in noninfected mice to 45% in animals infected 4 h previously (Fig. 3Go). In a situation of CXCR2 deficiency, the percentage of PMN was lower in noninfected animals (4%), and there was a complete failure to recruit these cells following infection (Fig. 3Go).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. Defective PMN influx in CXCR2 KO mice early after T. gondii infection. Animals were infected by i.p. injection of 2 x 106 RH strain tachyzoites. After 4 h, PECs were harvested, centrifuged onto glass microscope slides, and stained with Diff-Quik. Percentages of eosinophils (EO), neutrophils (NEU), lymphocytes (LY), monocytes (MO), and mast cells (MC) were determined by differential counting. The results are expressed as mean ± SD of individual mice. Results are representative of two different experiments.

 
Parasite numbers are increased and PMN influx remains defective 36 h postinfection

Chemokines in general are regarded as highly redundant mediators; therefore, it was of interest that recruitment of neutrophils in CXCR2-/- mice was totally defective during early infection. Nevertheless, it was possible that PMN could be recruited by CXCR2-independent cytokines later in infection. Accordingly, we examined peritoneal cell populations 36 h after tachyzoite infection. At this time point, large numbers of PMN were present in cell populations from WT mice (Fig. 4Go, A and C). In contrast, few or no neutrophils were evident in populations from CXCR2-/- animals (B and D).



View larger version (99K):
[in this window]
[in a new window]
 
FIGURE 4. Defective PMN response at 36 h is associated with high tachyzoite numbers in CXCR2 KO mice. Tachyzoites (RH strain, 2 x 106) were i.p. inoculated into WT and KO animals, then 36 h later PECs were collected, centrifuged onto glass slides, and stained with Diff-Quik. A and C, Cells from WT animals, showing large PMN numbers. B and D, Cells from KO mice, demonstrating near complete absence of neutrophils but large tachyzoite numbers. Original magnification of A and B was x40; C and D, x100. The arrows in D point to individual tachyzoites. This experiment was repeated three times with equivalent results.

 
In Fig. 5Go, cells from the peritoneal cavity were isolated and stained with the granulocyte-associated marker Gr-1 (Ly6G) (38) and the macrophage marker F4/80 (39) 36 h after PBS injection or RH infection. In WT mice, five distinct populations could be distinguished: Gr-1lowF4/80low, Gr-1lowF4/80high, Gr-1intF4/80int, Gr-1highF4/80low, and Gr-1highF4/80int (Fig. 5GoA). In response to parasite infection, there was a large increase in GR-1highF4/80low and Gr-1highF4/80int populations in cells from WT animals. High-level Gr-1 expression is known to be granulocyte restricted, and fluorescence microscopy confirmed that the GR-1highF4/80low and Gr-1highF4/80int populations were composed of neutrophils (data not shown). In CXCR2-/- mice, there was an almost complete absence of Gr-1high cells, consistent with a failure in neutrophil recruitment during infection (Fig. 5Go, A and B). Interestingly, tachyzoite infection resulted in a complete loss of Gr-1lowF4/80high cells, with a concomitant increase in Gr-1intF4/80int cells from WT and KO populations (Fig. 5GoA). The latter displayed a macrophage morphology, as determined by fluorescence microscopy (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 5. Flow cytometric analysis of peritoneal cells from WT and mutant mice. A, Cells were collected 36 h after i.p. inoculation of 2 x 106 RH strain tachyzoites or an equivalent volume of PBS, then stained with mAb to Gr-1 (Ly6G) and F4/80. Percentages lying in each circled population are indicated. Each fluorescence plot shows the results from an individual mouse (n = five per group). B, CXCR2 KO (KO), BALB/c controls (BA), KitW/KitW-v (W/W-v), and WBB6F1+/+ controls (+/+) were infected as in A, then the number of Gr-1+ cells at 36 h postinfection was quantitated by flow cytometry. These experiments were repeated twice with identical results.

 
We also performed double staining for F4/80 and CD11b in populations derived from infected and PBS-injected WT mice. As shown in Fig. 6Go, the F4/80high population present in PBS-injected animals also expressed high levels of CD11b. Likewise, after RH infection, the F4/80int cells coexpressed intermediate levels of CD11b. The F4/80lowCD11bint population appearing after infection most likely represents PMN, as these cells also expressed high levels of Gr-1 (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 6. Expression of F4/80 and CD11b on peritoneal cells from infected animals. Peritoneal cells were collected 36 h after i.p. injection of PBS or 2 x 106 RH strain tachyzoites. Cells were analyzed as described in Fig. 5Go, using Abs to F4/80 and CD11b (clone M1/70). Percentages lying in each circled population are indicated. This experiment is representative of two performed.

 
Increased tachyzoite numbers appeared to be present in preparations from the KO mice (Fig. 4Go). We confirmed that this was the case by enumerating parasite numbers and percentage of infected cells, as shown in Fig. 7Go. Thus, in terms of intracellular and extracellular parasite numbers, as well as percentage of infected cells, there was a dramatic increase in parasite levels in CXCR2-/- mice. These data confirm that the defect in neutrophil infiltration is sustained for at least 36 h, and that the absence of CXCR2 increases susceptibility to infection.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 7. Quantitation of tachyzoites and infection in peritoneal cavities of WT and CXCR2 KO mice. Peritoneal cells and extracellular tachyzoites were obtained by lavage 36 h after infection with 2 x 106 RH tachyzoites. Parasite and cell counts were determined by microscopic examination of Diff-Quik-stained cells. A, Extracellular tachyzoites were counted in four fields (17,000 µm2 per field). B, The number of intracellular tachyzoites per infected cell was determined in four fields. C, The percentage of infected cells was estimated by counting four fields from each sample. In these experiments, 91% of infected cells are monocytes (two to eight tachyzoites per cell). Approximately 5% of the remaining infected cells are PMN with one to two intracellular tachyzoites. The data show mean ± SD from individual mice (n = 5 per group) and are representative of two experiments. *, p < 0.05.

 
CXCR2-dependent neutrophil influx is defective in mast cell-deficient KitW/KitW-v mice

Mast cells are capable of serving as a source of MIP-2 and TNF-{alpha}, mediators which have been implicated in PMN recruitment in models of bacterial host defense and T cell-mediated delayed-type hypersensitivity (40, 41). The MIP-2 chemokine binds with high affinity to CXCR2 (6). Therefore, to determine whether mast cells were involved in the PMN influx during Toxoplasma infection, we examined the response of mast cell-deficient KitW/KitW-v mice. As shown in Fig. 5GoB, the influx of Gr-1+ cells was reduced approximately three-fold in mast cell-deficient mice relative to control littermates. Nevertheless, this decreased PMN influx was not as drastic as that seen in CXCR2 KO mice, in which there was an ~90% reduction in neutrophil numbers (Fig. 5GoB). We conclude that mast cells are an important chemokine source driving PMN recruitment during T. gondii infection, but that other cells are also likely to play a role in providing these mediators in this infection model.

Parasite-induced type 1 cytokine responses are defective in CXCR2-/- animals

We next evaluated spleen cell responses in animals undergoing acute Toxoplasma infection. The spleen cell phenotype was evaluated by flow cytometry (Table IGo). Noninfected KO mice displayed increased levels of Gr-1+ cells in the spleen, as previously described (7), and this was also the case for 7-day infected animals. The remaining populations of T lymphocytes, B lymphocytes, macrophages, and NK cells appeared similar for both mouse strains, with increases in all populations following infection, although there was a small but statistically significant increase in F4/80+ cells in CXCR2 KO animals.


View this table:
[in this window]
[in a new window]
 
Table I. Phenotypic composition of splenocytes from T. gondii-infected and non-infected WT and CXCR2 KO mice1

 
Because we and others have found that PMN can serve as an IL-12 source that may play a role in type 1 cytokine response induction (24, 30, 34), we examined spleen cell cytokine release after in vitro stimulation with STAg. Both IFN-{gamma} and TNF-{alpha} responses were lower using cells from 7-day infected KO mice relative to WT controls (Fig. 8Go). Nevertheless, IL-12 levels produced by spleen cells from KO and WT animals were not significantly different. This is likely to be the result of the presence of splenic PMN and dendritic cells, which produce IL-12 in response to STAg (25, 42). When we examined serum cytokine levels we found that CXCR2-/- mice displayed five-fold less serum IFN-{gamma} than WT controls, although there was not a significant difference in TNF-{alpha} or IL-12 serum levels (Fig. 7Go). Similar results were found in mice undergoing infection with RH strain parasites.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 8. Cytokine production by infected WT and KO animals. WT and CXCR2 KO mice were infected (100 ME49 cysts), then 7 days later spleens were isolated and serum was collected. Spleen cells were stimulated with STAg (2 µg/ml), supernatants were harvested 48 h later, and cytokines were quantitated by ELISA. The data are expressed as means ± SD of individual mice (n = 5 per strain). *, Significant differences between WT and KO (p < 0.05). The results are representative of three individual experiments.

 
Nramp1 genotype of CXCR2-/- animals

Genetic studies have mapped the Nramp1 gene to within 50 kb of the murine IL-8Rh gene (43, 44). The Nramp1 gene is capable of influencing resistance to intracellular bacteria (44). Because the 129 mouse strain carries a WT Nramp1 allele and the BALB/c strain carries a mutant Nramp1 allele, it was possible that CXCR2 KO animals carried a 129-derived Nramp1 gene. We used primers specific for Nramp 783, the single nucleotide position differing between the two parental mouse strains (44), to amplify an Nramp1 amplicon in an allele-specific manner. As shown in Fig. 9GoA, the KO strain retains a 129-derived Nramp1 gene, despite 10 generations of backcrossing to the BALB/c strain. To confirm that presence of this allele was not affecting our results, we evaluated the neutrophil influx in parental 129 and BALB/c mice. As shown in Fig. 9GoB, a strong PMN response was associated with both strains, despite carrying different Nramp1 alleles. In addition, the percentage of infected cells in the peritoneal cavity did not differ between the strains (Fig. 9GoB). These results strongly argue that the disrupted CXCR2 gene itself, rather than the 129-derived Nramp1 allele, accounts for the impaired neutrophil response in the KO mice.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 9. Nramp1 genotype of KO mice. A, An Nramp1 gene fragment was subjected to RT-PCR-assisted amplification using a primer specific for BALB/c-derived (A primer) and 129-derived (G primer) Nramp1. B, Mice were infected with 2 x 106 RH strain tachyzoites, then 36 h later peritoneal cells were harvested, centrifuged onto glass slides, and stained with Diff-Quik. The percentage of PMN and infected cells was calculated by counting 300 cells in randomly selected fields.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results of our study argue that mouse CXCR2 is essential for early neutrophil recruitment during T. gondii infection. Animals deficient in mast cells also displayed an impaired PMN influx, suggesting these cells as a source of mediators that bind to CXCR2. The defective neutrophil influx was associated with higher parasite numbers in the peritoneal cavity during early stages of infection, and this was reflected by increased cyst numbers later during chronic infection. Earlier studies suggested that tachyzoites release factors chemotactic for neutrophils (45). Our studies argue that host CXCR2 expression is necessary for PMN recruitment. While it is possible that the parasite releases CXCR2-binding ligands, we think it more likely that the chemotactic mediators are host derived. Indeed, in our laboratory we have been unable to detect tachyzoite-derived neutrophil chemotactic factors (S. K. Bliss and E. Y. Denkers, unpublished observations).

Although mice do not express an IL-8 homolog, several CXC chemokines bind to the IL-8Rh, including MIP-2 and KC (6, 46). Of these, KC is ~10-fold less potent than MIP-2, arguing that the latter may be more important as a CXCR2 ligand. Nevertheless, in pulmonary infections with Legionella pneumophila and Pseudomonas aeruginosa, neutralization of either MIP-2 or KC resulted in only partial blockade of the PMN influx, whereas Ab blocking of CXCR2 completely inhibited neutrophil recruitment (12, 47). Thus, both MIP-2 and KC chemokines, by binding to CXCR2 on neutrophils, may be involved in neutrophil trafficking during T. gondii infection.

Previous studies on IL-12-/- and IFN-{gamma}-/- mice have shown that T. gondii infection induces abnormally high levels of PMN recruitment into the peritoneal cavity (18, 27). Given our results, it would be of interest to determine whether these cytokines play a down-regulatory role in expression of either CXCR2 or ligands of this chemokine receptor. We are currently examining MIP-2 and KC production, as well as neutrophil CXCR2 expression in IL-12 and IFN-{gamma} KO mice to determine levels of these mediators in the presence and absence of IL-12 and IFN-{gamma}.

Our results showing that KitW/KitW-v mice display a defective neutrophil influx during T. gondii infection implicate mast cells as an important chemokine source driving CXCR2-dependent PMN migration into the peritoneal cavity. Because the KitW/KitW-v mice and their WT counterparts are on a different genetic background than that of CXCR2 KO animals and the KitW/KitW-v mice also display other mast cell-independent abnormalities, this result must be interpreted with some caution. Nevertheless, our findings are in accord with those of others suggesting that mast cells drive neutrophil recruitment through release of TNF-{alpha} and MIP-2 in models of bacterial clearance and T cell-mediated delayed-type hypersensitivity (40, 41). In our experiments, the defective neutrophil migration in mast cell-deficient mice was less profound than that occurring in CXCR2 KO animals. The latter finding may indicate that mast cells are not the sole source of CXCR2-binding chemokines in the peritoneal cavity during infection. In this regard, macrophages are capable of producing both MIP-2 and KC, and human neutrophils themselves are a potent IL-8 source (48, 49, 50). Although mice do not express IL-8, it is nevertheless possible that murine PMN produce CXCR2-binding chemokines in response to T. gondii, as has been shown for the CC chemokines MIP-1{alpha} and MIP-1{beta} (29).

In a related study to that reported in this work, it was shown that CCR1 KO mice display increased susceptibility to T. gondii (51). Unlike CXCR2, the ligands for CCR1 are CC chemokines such as MIP-1{alpha}, MIP-1{beta}, and RANTES (52). Indeed, the phenotype for T. gondii-infected CCR1 and CXCR2 KO mice appears distinct. Thus, CCR1-/- animals display PMN trafficking to sites of infection but an impaired ability to mobilize neutrophils and their precursors from the bone marrow (51, 53). In contrast, our studies and those of others (8, 10) show a defective ability of CXCR2-/- neutrophils to migrate to sites of infection. In addition, while we and others (12) found evidence for defective proinflammatory cytokine responses in the absence of a functional CXCR2, this was not the case in CCR1-/- mice. Differences in the chemotactic effects of CCR1 and CXCR2 ligands on PMN may underlie these disparate effects.

In our experiments, we found a dramatic infection-induced loss of F4/80 strongly positive cells in the peritoneal cavity of both WT and KO animals. This was accompanied by an increase in cells expressing intermediate amounts of F4/80 and Gr-1. Fluorescence microscopy suggested that the latter population was composed mainly of macrophages/monocytes (data not shown), and, indeed, macrophages/monocytes have been previously found to express low levels of Gr-1 during models of inflammation (54). The apparent loss of F4/80 bright-staining cells may reflect infection-induced maturation of monocytes, as down-regulation of this Ag is associated with the latter process (39).

The results of our study show that defective neutrophil recruitment is associated with increased host susceptibility and is detectable within 36 h of infection as increased tachyzoite numbers in the peritoneal cavity, and at 30 days postinfection as increased numbers of cysts establishing within the brain. The reason for this increased susceptibility is not known; however, we and others have presented evidence for an immunoregulatory role of PMN in initiating type 1 cytokine responses (12, 24, 31, 33, 55). The present data are consistent with this concept. Thus, CXCR2 KO mice displayed dysregulated IFN-{gamma} and TNF-{alpha} responses in the spleen, and serum IFN-{gamma} levels were dramatically lower in the IL-8Rh KO mice. The fact that IFN-{gamma} responses were not totally absent likely accounts for the ability of CXCR2 KO mice to survive infection, albeit with higher cyst numbers. Nevertheless, while these data are consistent with a role for PMN in triggering type 1 cytokine responses, we cannot exclude the possibility that susceptibility of the CXCR2-/- mouse strain reflects decreased microbicidal activity at the site of infection.

The results of this study indicate that, in addition to an inactive CXCR2 gene, the KO animals differ from BALB/c WT mice by retaining an Nramp1 allele associated with resistance to Mycobacterium bovis. It is also of note that the Nramp1 gene may influence susceptibility to T. gondii (56). However, we think it unlikely that differences in the Nramp1 allele account for the defective PMN responses between WT and KO strains for the following reasons. First, our results show that the parental strains, which differ in Nramp1 alleles, display an identical neutrophil influx during infection and an equivalent parasite level in the peritoneal cavity. Second, while the Nramp1 gene may influence macrophage production of the CXCR2 ligand KC, the particular allele carried by the KO strain is associated with increased, rather than decreased, KC gene expression (57). Therefore, our data suggest that absence of CXCR2 itself, rather than an allele-specific Nramp1 influence, accounts for the effects reported in this work.

In sum, our results point to an important function for CXCR2 in trafficking PMN to the site of protozoan infection. In this study, such newly recruited cytokine-secreting neutrophils may play a role in macrophage and dendritic cell activation, as well as displaying direct microbicidal activity. In this manner, PMN recruitment is likely to be an essential early step in controlling microbial infection and may underlie induction of acquired immunity to Toxoplasma and many other infections.


    Acknowledgments
 
We thank Dr. B. A. Butcher for critical review of the manuscript and J. Olaya for technical assistance.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant AI47888. L.D.R. was supported by Ministerio de Educación y Cultura of Spain. Back

2 Address correspondence and reprint requests to Dr. Eric Y. Denkers, Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853-6401. E-mail address: eyd1{at}cornell.edu Back

3 Abbreviations used in this paper: MIP, macrophage inflammatory protein; PMN, polymorphonuclear leukocyte; KO, knockout; STAg, soluble tachyzoite lysate Ag; WT, wild type; PEC, peritoneal exudate cell; IL-8Rh, IL-8R homolog. Back

Received for publication June 8, 2001. Accepted for publication October 1, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hechtman, D. H., M. I. Cybulsky, H. J. Fuchs, J. B. Baker, Jr M. A. Gimbrone. 1990. Intravascular IL-8: inhibitor of polymorphonuclear leukocyte accumulation at sites of acute inflammation. J. Immunol. 147:883.[Abstract]
  2. Colditz, I., R. Zwahlen, B. Dewald, M. Baggiolini. 1989. In vivo inflammatory activity of neutrophil-activating factor, a novel chemotactic peptide derived from human monocytes. Am. J. Pathol. 134:755.[Abstract]
  3. Leonard, E. J., A. Skeel, T. Yoshimura, N. Noer, S. Kutvirt, D. Van Epps. 1990. Leukocyte specificity and binding of human neutrophil attractant/activation protein-1. J. Immunol. 144:1333.
  4. Murphy, P., H. Tiffany. 1991. Cloning of complementary DNA encoding a functional human interleukin-8 receptor. Science 253:1280.[Abstract/Free Full Text]
  5. Holmes, W. E., J. Lee, W. J. Kuang, G. C. Rice, W. I. Wood. 1991. Structure and functional expression of a human interleukin-8 receptor. Science 253:1278.[Abstract/Free Full Text]
  6. Lee, J., G. Cacalano, T. Camerato, K. Toy, M. W. Moore, W. I. Wood. 1995. Chemokine binding and activities mediated by the mouse IL-8 receptor. J. Immunol. 155:2158.[Abstract]
  7. Cacalano, G., J. Lee, K. Kikly, A. M. Ryan, S. Pitts-Meek, B. Hultgren, W. I. Wood, M. W. Moore. 1994. Neutrophil and B cell expansion in mice that lack the murine IL-8 receptor homolog. Nature 265:682.
  8. Frendeus, B., G. Godaly, L. Hang, D. Karpman, A.-C. Lundstedt, C. Svanborg. 2000. Interleukin-8 receptor deficiency confers susceptibility to acute experimental pyelonephritis and may have a human counterpart. J. Exp. Med. 192:881.[Abstract/Free Full Text]
  9. Hang, L., B. Frendeus, G. Godaly, C. Svanborg. 2000. Interleukin-8 receptor knockout mice have subepithelial neutrophil entrapment and renal scarring following acute pyelonephritis. J. Infect. Dis. 182:1738.[Medline]
  10. Godaly, G., L. Hang, B. Frendeus, C. Svanborg. 2000. Transepithelial neutrophil migration is CXCR1 dependent in vitro and is defective in IL-8 receptor knockout mice. J. Immunol. 165:5287.[Abstract/Free Full Text]
  11. Balish, E., R. D. Wagner, A. Vazquez-Torres, J. Jones-Carson, C. Pierson, T. Warner. 1999. Mucosal and systemic candidiasis in IL-8Rh-/- BALB/c mice. J. Leukocyte Biol. 66:144.[Abstract]
  12. Tateda, K., T. A. Moore, M. W. Newstead, W. C. Tsai, X. Zeng, J. C. Deng, G. Chen, R. Reddy, K. Yamaguchi, T. J. Standiford. 2001. Chemokine-dependent neutrophil recruitment in a murine model of Legionella pneumonia: potential role of neutrophils as immunoregulatory cells. Infect. Immun. 69:2017.[Abstract/Free Full Text]
  13. Navia, B. A., C. K. Petito, J. W. M. Gold, E. S. Cho, B. D. Jordon, J. W. Price. 1986. Cerebral toxoplasmosis complicating the acquired immune deficiency syndrome: clinical and neuropathological findings in 27 patients. Ann. Neurol. 19:224.[Medline]
  14. Remington, J. S., G. Desmonts. 1990. Toxoplasmosis. J. S. Remington, and J. O. Klein, eds. Infectious Diseases of the Fetus and Newborn Infant 89. Saunders, Philadelphia.
  15. Denkers, E. Y., R. T. Gazzinelli. 1998. Regulation and function of T cell-mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. 11:569.[Abstract/Free Full Text]
  16. Alexander, J., C. A. Hunter. 1998. Immunoregulation during toxoplasmosis. Chem. Immunol. 70:81.[Medline]
  17. Yap, G., M. Pesin, A. Sher. 2000. IL-12 is required for the maintenance of IFN-{gamma} production in T cells mediating chronic resistance to the intracellular pathogen, Toxoplasma gondii. J. Immunol. 165:628.[Abstract/Free Full Text]
  18. Scharton-Kersten, T. M., T. A. Wynn, E. Y. Denkers, S. Bala, L. Showe, E. Grunvald, S. Hieny, R. T. Gazzinelli, A. Sher. 1996. In the absence of endogenous IFN-{gamma} mice develop unimpaired IL-12 responses to Toxoplasma gondii while failing to control acute infection. J. Immunol. 157:4045.[Abstract]
  19. Suzuki, Y., M. A. Orellana, R. D. Schreiber, J. S. Remington. 1988. Interferon-{gamma}: the major mediator of resistance against Toxoplasma gondii. Science 240:516.[Abstract/Free Full Text]
  20. Gazzinelli, R. T., M. Wysocka, S. Hayashi, E. Y. Denkers, S. Hieny, P. Caspar, G. Trinchieri, A. Sher. 1994. Parasite-induced IL-12 stimulates early IFN-{gamma} synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533.[Abstract]
  21. Gazzinelli, R. T., M. Wysocka, S. Hieny, T. Scharton-Kersten, A. Cheever, R. Kuhn, W. Muller, G. Trinchieri, A. Sher. 1996. In the absence of endogenous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal immune response dependent upon CD4+ T cells and accompanied by overproduction of IL-12, IFN-{gamma}, and TNF-{alpha}. J. Immunol. 157:798.[Abstract]
  22. Neyer, L. E., G. Grunig, M. Fort, J. S. Remington, D. Rennick, C. A. Hunter. 1997. Role of interleukin-10 in regulation of T-cell-dependent and T-cell-independent mechanisms of resistance to Toxoplasma gondii. Infect. Immun. 65:1675.[Abstract]
  23. Suzuki, Y., A. Sher, G. Yap, D. Park, L. Ellis Neyer, O. Liesenfeld, M. Fort, H. Kang, E. Gufwoli. 2000. IL-10 is required for prevention of necrosis in the small intestine and mortality in both genetically resistant BALB/c and susceptible C57BL/6 mice following peroral infection with Toxoplasma gondii. J. Immunol. 164:5375.[Abstract/Free Full Text]
  24. Bliss, S. K., L. C. Gavrilescu, A. Alcaraz, E. Y. Denkers. 2001. Neutrophil depletion during Toxoplasma gondii infection leads to impaired immunity and lethal systemic pathology. Infect. Immun. 69:4898.[Abstract/Free Full Text]
  25. Bliss, S. K., Y. Zhang, E. Y. Denkers. 1999. Murine neutrophil stimulation by Toxoplasma gondii antigen drives high level production of IFN-{gamma}-independent IL-12. J. Immunol. 163:2081.[Abstract/Free Full Text]
  26. Sayles, P. C., L. J. Johnson. 1997. Exacerbation of toxoplasmosis in neutrophil depleted mice. Nat. Immun. 15:249.
  27. Scharton-Kersten, T., G. Yap, J. Magram, A. Sher. 1997. Inducible nitric oxide is essential for host control of persistent but not acute infection with the intracellular pathogen Toxoplasma gondii. J. Exp. Med. 185:1.[Abstract/Free Full Text]
  28. Bacon, C. M., E. F. Petricoin, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, J. J. O’Shea. 1995. IL-12 induces tyrosine phosphorylation and activation of STAT 4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307.[Abstract/Free Full Text]
  29. Bliss, S. K., A. J. Marshall, Y. Zhang, E. Y. Denkers. 1999. Human polymorphonuclear leukocytes produce IL-12, TNF-{alpha}, and the chemokines macrophage-inflammatory protein-1{alpha} and -1{beta} in response to Toxoplasma gondii antigens. J. Immunol. 162:7369.[Abstract/Free Full Text]
  30. Bliss, S. K., B. A. Butcher, E. Y. Denkers. 2000. Rapid recruitment of neutrophils with prestored IL-12 during microbial infection. J. Immunol. 165:4515.[Abstract/Free Full Text]
  31. Tateda, K., T. A. Moore, J. C. Deng, M. W. Newstead, X. Zeng, A. Matsukawa, M. S. Swanson, K. Yamaguchi, T. J. Standiford. 2001. Early recruitment of neutrophils determines subsequent T1/T2 host responses in a murine model of Legionella pneumophila pneumonia. J. Immunol. 166:3355.[Abstract/Free Full Text]
  32. Chen, L., T. Watanabe, H. Watanabe, F. Sendo. 2001. Neutrophil depletion exacerbates experimental Chagas’ disease in BALB/c, but protects C57BL/6 mice through modulating the Th1/Th2 dichotomy in different directions. Eur. J. Immunol. 31:265.[Medline]
  33. Pedrosa, J., B. M. Saunders, R. Appelberg, I. M. Orme, M. T. Silva, A. M. Cooper. 2000. Neutrophils play a protective nonphagocytic role in systemic Mycobacterium tuberculosis infection of mice. Infect. Immun. 68:577.[Abstract/Free Full Text]
  34. Romani, L., A. Mencacci, E. Cenci, G. Del Sero, F. Bistoni, P. Puccetti. 1997. An immunoregulatory role for neutrophils in CD4+ T helper subset selection in mice with candidiasis. J. Immunol. 158:2356.[Abstract]
  35. Romani, L., A. Mencacci, E. Cenci, R. Spaccapelo, G. Del Sero, I. Nicoletti, G. Trinchieri, F. Bistoni, P. Puccetti. 1997. Neutrophil production of IL-12 and IL-10 in candidiasis and efficacy of IL-12 therapy in neutropenic mice. J. Immunol. 158:5349.[Abstract]
  36. Chen, L., Z. H. Zhang, F. Sendo. 2000. Neutrophils play a critical role in the pathogenesis of experimental cerebral malaria. Clin. Exp. Immunol. 120:125.[Medline]
  37. Govini, G., S. Vidal, M. Cellier, P. Lepage, D. Malo, P. Gros. 1995. Genomic structure, promoter sequence, and induction of expression of the mouse Nramp1 gene in macrophages. Genomics 27:9.[Medline]
  38. Fleming, T. J., M. L. Fleming, T. R. Malek. 1993. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow: RB6–8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J. Immunol. 151:2399.[Abstract]
  39. Plasman, N., B. Vray. 1993. Mouse peritoneal macrophages: characterization of functional subsets following Percoll density gradients. Res. Immunol. 144:151.[Medline]
  40. Biedermann, T., M. Kneilling, R. Mailhammer, K. Maier, C. A. Sander, G. Kollias, S. L. Kunkel, L. Hultner, M. Rocken. 2000. Mast cells control neutrophil recruitment during T cell-mediated delayed-type hypersensitivity reactions through tumor necrosis factor and macrophage inflammatory protein 2. J. Exp. Med. 192:1441.[Abstract/Free Full Text]
  41. Malaviya, R., T. Ikeda, E. Ross, S. N. Abraham. 1996. Mast cell modulation of neutrophil influx and bacterial clearance at sites of infection through TNF-{alpha}. Nature 381:77.[Medline]
  42. Reis e Sousa, C., S. Hieny, T. Scharton-Kersten, D. Jankovic, H. Charest, R. N. Germain, A. Sher. 1997. In vivo microbial stimulation induces rapid CD40L-independent production of IL-12 by dendritic cells and their redistribution to T cell areas. J. Exp. Med. 186:1819.[Abstract/Free Full Text]
  43. Cerretti, D. P., N. Nelson, C. J. Kozlosky, P. J. Morrissey, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, J. K. Dosik, B. A. Mock. 1993. The murine homologue of the human interleukin-8 receptor type B maps near the Ity-Lsh-Bcg disease resistance locus. Genomics 18:410.[Medline]
  44. Vidal, S. M., D. Malo, K. Vogan, E. Skamene, P. Gros. 1993. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 73:469.[Medline]
  45. Nakao, M., E. Konishi. 1991. Neutrophil chemotactic factors secreted from Toxoplasma gondii. Parasitology 103:29.
  46. Bozic, C. R., N. P. Gerard, C. von Uexkull-Gulenband, L. F. Kolakowski, M. J. Conklyn, R. Breslow, H. J. Showell, C. Gerard. 1994. The murine interleukin 8 type B receptor homologue and its ligands: expression and biological characterization. J. Biol. Chem. 269:29355.[Abstract/Free Full Text]
  47. Tsai, W. C., R. M. Strieter, B. Mehrad, M. W. Newstead, X. Zeng, T. J. Standiford. 2000. CXC chemokine receptor CXCR2 is essential for protective innate host response in murine Pseudomonas aeruginosa pneumonia. Infect. Immun. 68:4289.[Abstract/Free Full Text]
  48. Wolpe, S. D., B. Sherry, D. Juers, G. Davatelis, R. W. Yurt, A. Cerami. 1989. Identification and characterization of macrophage inflammatory protein 2. Proc. Natl. Acad. Sci. USA 86:612.[Abstract/Free Full Text]
  49. Adams, L. B., Jr J. B. Hibbs, R. R. Taintor, J. L. Krahenbuhl. 1990. Microbiostatic effect of murine-activated macrophages for Toxoplasma gondii: role for synthesis of inorganic nitrogen oxides from L-arginine. J. Immunol. 144:2725.[Abstract]
  50. Kuhns, D. B., H. A. Young, E. K. Gallin, J. A. Gallin. 1998. Ca2+-dependent production and release of IL-8 in human neutrophils. J. Immunol. 161:4332.[Abstract/Free Full Text]
  51. Khan, I. A., P. M. Murphy, L. Casciotti, J. D. Schwartzman, J. Collins, J.-L. Gao, G. R. Yeaman. 2001. Mice lacking the chemokine receptor CCR1 show increased susceptibility to Toxoplasma gondii infection. J. Immunol. 166:1930.[Abstract/Free Full Text]
  52. Rossi, D., A. Zlotnik. 2000. The biology of chemokines and their receptors. Annu. Rev. Immunol. 18:217.[Medline]
  53. Gao, J.-L., T. A. Wynn, Y. Chang, E. J. Lee, H. E. Broxmeyer, S. Cooper, H. L. Tiffany, H. Westphal, J. Kwong-Chung, P. M. Murphy. 1997. Impaired host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cytokine balance in mice lacking CC chemokine receptor 1. J. Exp. Med. 185:1959.[Abstract/Free Full Text]
  54. Lagasse, E., I. L. Weissman. 1996. Flow cytometric identification of murine neutrophils and monocytes. J. Immunol. Methods 197:139.[Medline]
  55. Romani, L., F. Bistoni, P. Puccetti. 1997. Initiation of T-helper cell immunity to Candida albicans by IL-12: the role of neutrophils. Chem. Immunol. 68:110.[Medline]
  56. Blackwell, J. M., C. W. Roberts, T. I. A. Roach, J. Alexander. 1994. Influence of macrophage resistance gene Lsh/Ity/Bcg (candidate Nramp) on Toxoplasma gondii infection in mice. Clin. Exp. Immunol. 97:107.[Medline]
  57. Roach, T. I., D. Chatterjee, J. M. Blackwell. 1994. Induction of early-response genes KC and JE by mycobacterial lipoarabinomannans: regulation of KC expression in murine macrophages by Lsh/Ity/Bcg (candidate Nramp). Infect. Immun. 62:1176.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JEMHome page
K.-H. Chuang, S. Altuwaijri, G. Li, J.-J. Lai, C.-Y. Chu, K.-P. Lai, H.-Y. Lin, J.-W. Hsu, P. Keng, M.-C. Wu, et al.
Neutropenia with impaired host defense against microbial infection in mice lacking androgen receptor
J. Exp. Med., May 11, 2009; 206(5): 1181 - 1199.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. P. Gigley, B. A. Fox, and D. J. Bzik
Cell-Mediated Immunity to Toxoplasma gondii Develops Primarily by Local Th1 Host Immune Responses in the Absence of Parasite Replication
J. Immunol., January 15, 2009; 182(2): 1069 - 1078.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. E. Cardona, M. Li, L. Liu, C. Savarin, and R. M. Ransohoff
Chemokines in and out of the central nervous system: much more than chemotaxis and inflammation
J. Leukoc. Biol., September 1, 2008; 84(3): 587 - 594.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
L. Benevides, C. M. Milanezi, L. M. Yamauchi, C. F. Benjamim, J. S. Silva, and N. M. Silva
CCR2 Receptor Is Essential to Activate Microbicidal Mechanisms to Control Toxoplasma gondii Infection in the Central Nervous System
Am. J. Pathol., September 1, 2008; 173(3): 741 - 751.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Carlson, M. Kroenke, P. Rao, T. E. Lane, and B. Segal
The Th17-ELR+ CXC chemokine pathway is essential for the development of central nervous system autoimmune disease
J. Exp. Med., April 14, 2008; 205(4): 811 - 823.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
N. Kesteman, G. Vansanten, B. Pajak, S. M. Goyert, and M. Moser
Injection of lipopolysaccharide induces the migration of splenic neutrophils to the T cell area of the white pulp: role of CD14 and CXC chemokines
J. Leukoc. Biol., March 1, 2008; 83(3): 640 - 647.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. T. Pesce, Z. Liu, H. Hamed, F. Alem, J. Whitmire, H. Lin, Q. Liu, J. F. Urban Jr., and W. C. Gause
Neutrophils Clear Bacteria Associated with Parasitic Nematodes Augmenting the Development of an Effective Th2-Type Response
J. Immunol., January 1, 2008; 180(1): 464 - 474.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. W. Lee, W. Sukhumavasi, and E. Y. Denkers
Phosphoinositide-3-Kinase-Dependent, MyD88-Independent Induction of CC-Type Chemokines Characterizes the Macrophage Response to Toxoplasma gondii Strains with High Virulence
Infect. Immun., December 1, 2007; 75(12): 5788 - 5797.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. Buanne, E. Di Carlo, L. Caputi, L. Brandolini, M. Mosca, F. Cattani, L. Pellegrini, L. Biordi, G. Coletti, C. Sorrentino, et al.
Crucial pathophysiological role of CXCR2 in experimental ulcerative colitis in mice
J. Leukoc. Biol., November 1, 2007; 82(5): 1239 - 1246.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. S. Goldszmid, A. Bafica, D. Jankovic, C. G. Feng, P. Caspar, R. Winkler-Pickett, G. Trinchieri, and A. Sher
TAP-1 indirectly regulates CD4+ T cell priming in Toxoplasma gondii infection by controlling NK cell IFN-{gamma} production
J. Exp. Med., October 29, 2007; 204(11): 2591 - 2602.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Sukhumavasi, C. E. Egan, and E. Y. Denkers
Mouse Neutrophils Require JNK2 MAPK for Toxoplasma gondii-Induced IL-12p40 and CCL2/MCP-1 Release
J. Immunol., September 15, 2007; 179(6): 3570 - 3577.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. S. Shaftel, T. J. Carlson, J. A. Olschowka, S. Kyrkanides, S. B. Matousek, and M. K. O'Banion
Chronic Interleukin-1{beta} Expression in Mouse Brain Leads to Leukocyte Infiltration and Neutrophil-Independent Blood Brain Barrier Permeability without Overt Neurodegeneration
J. Neurosci., August 29, 2007; 27(35): 9301 - 9309.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Rydstrom and M. J. Wick
Monocyte Recruitment, Activation, and Function in the Gut-Associated Lymphoid Tissue during Oral Salmonella Infection
J. Immunol., May 1, 2007; 178(9): 5789 - 5801.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. R. Bonnett, E. J. Cornish, A. G. Harmsen, and J. B. Burritt
Early Neutrophil Recruitment and Aggregation in the Murine Lung Inhibit Germination of Aspergillus fumigatus Conidia
Infect. Immun., December 1, 2006; 74(12): 6528 - 6539.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. M. Galioto, J. A. Hess, T. J. Nolan, G. A. Schad, J. J. Lee, and D. Abraham
Role of Eosinophils and Neutrophils in Innate and Adaptive Protective Immunity to Larval Strongyloides stercoralis in Mice.
Infect. Immun., October 1, 2006; 74(10): 5730 - 5738.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. F. Gombart, U. Krug, J. O'Kelly, E. An, V. Vegesna, and H. P. Koeffler
Aberrant expression of neutrophil and macrophage-related genes in a murine model for human neutrophil-specific granule deficiency
J. Leukoc. Biol., November 1, 2005; 78(5): 1153 - 1165.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Iyoda, K. Nagata, M. Akashi, and Y. Kobayashi
Neutrophils Accelerate Macrophage-Mediated Digestion of Apoptotic Cells In Vivo as Well as In Vitro
J. Immunol., September 15, 2005; 175(6): 3475 - 3483.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Rambeaud and G. M. Pighetti
Impaired Neutrophil Migration Associated with Specific Bovine CXCR2 Genotypes
Infect. Immun., August 1, 2005; 73(8): 4955 - 4959.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. M. Robben, M. LaRegina, W. A. Kuziel, and L. D. Sibley
Recruitment of Gr-1+ monocytes is essential for control of acute toxoplasmosis
J. Exp. Med., June 6, 2005; 201(11): 1761 - 1769.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Bennouna and E. Y. Denkers
Microbial Antigen Triggers Rapid Mobilization of TNF-{alpha} to the Surface of Mouse Neutrophils Transforming Them into Inducers of High-Level Dendritic Cell TNF-{alpha} Production
J. Immunol., April 15, 2005; 174(8): 4845 - 4851.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. N. Kelly, J. K. Kolls, K. Happel, J. D. Schwartzman, P. Schwarzenberger, C. Combe, M. Moretto, and I. A. Khan
Interleukin-17/Interleukin-17 Receptor-Mediated Signaling Is Important for Generation of an Optimal Polymorphonuclear Response against Toxoplasma gondii Infection
Infect. Immun., January 1, 2005; 73(1): 617 - 621.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. A. Johnston, J. P. Mizgerd, and S. A. Shore
CXCR2 is essential for maximal neutrophil recruitment and methacholine responsiveness after ozone exposure
Am J Physiol Lung Cell Mol Physiol, January 1, 2005; 288(1): L61 - L67.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L. C. Gavrilescu, B. A. Butcher, L. Del Rio, G. A. Taylor, and E. Y. Denkers
STAT1 Is Essential for Antimicrobial Effector Function but Dispensable for Gamma Interferon Production during Toxoplasma gondii Infection
Infect. Immun., March 1, 2004; 72(3): 1257 - 1264.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Banerjee, P. S. Biswas, B. Kim, S. Lee, and B. T. Rouse
CXCR2-/- Mice Show Enhanced Susceptibility to Herpetic Stromal Keratitis: A Role for IL-6-Induced Neovascularization
J. Immunol., January 15, 2004; 172(2): 1237 - 1245.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. M. Pelus, H. Bian, A. G. King, and S. Fukuda
Neutrophil-derived MMP-9 mediates synergistic mobilization of hematopoietic stem and progenitor cells by the combination of G-CSF and the chemokines GRO{beta}/CXCL2 and GRO{beta}T /CXCL2{Delta}4
Blood, January 1, 2004; 103(1): 110 - 119.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. G. Mordue and L. D. Sibley
A novel population of Gr-1+-activated macrophages induced during acute toxoplasmosis
J. Leukoc. Biol., December 1, 2003; 74(6): 1015 - 1025.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
S. Bennouna, S. K. Bliss, T. J. Curiel, and E. Y. Denkers
Cross-Talk in the Innate Immune System: Neutrophils Instruct Recruitment and Activation of Dendritic Cells during Microbial Infection
J. Immunol., December 1, 2003; 171(11): 6052 - 6058.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. L. Miller, R. M. Strieter, A. D. Gruber, S. B. Ho, and N. W. Lukacs
CXCR2 Regulates Respiratory Syncytial Virus-Induced Airway Hyperreactivity and Mucus Overproduction
J. Immunol., March 15, 2003; 170(6): 3348 - 3356.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. T. Morris, A. Coppin, S. Tomavo, and V. B. Carruthers
Functional Analysis of Toxoplasma gondii Protease Inhibitor 1
J. Biol. Chem., November 15, 2002; 277(47): 45259 - 45266.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. Mehrad, M. Wiekowski, B. E. Morrison, S.-C. Chen, E. C. Coronel, D. J. Manfra, and S. A. Lira
Transient Lung-Specific Expression of the Chemokine KC Improves Outcome in Invasive Aspergillosis
Am. J. Respir. Crit. Care Med., November 1, 2002; 166(9): 1263 - 1268.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Barragan and L. D. Sibley
Transepithelial Migration of Toxoplasma gondii Is Linked to Parasite Motility and Virulence
J. Exp. Med., June 17, 2002; 195(12): 1625 - 1633.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Del Rio, L.
Right arrow Articles by Denkers, E. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Del Rio, L.
Right arrow Articles by Denkers, E. Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS