| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RI Stimulates the Production of IL-16 in Langerhans Cell-Like Dendritic Cells1 ,2
Departments of
*
Dermatology,
Pathology, and
Rheumatology/Nephrology, Georg- August-University, Göttingen, Germany; and
Division of Gastroenterology and Hepatology, Department of Medicine, University Hospital Innsbruck, Innsbruck, Austria
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RI, is regarded as an important mechanism in the induction of
cutaneous inflammation in atopic dermatitis. Here, we show that
activation of monocyte-derived LC-like dendritic cells (LLDC) through
engagement of FcRI induces the expression of IL-16, a
chemoattractant factor for dendritic cells, CD4+ T cells,
and eosinophils. We found that ligation of FcRI on LLDC derived from
atopic dermatitis patients that express high levels of FcRI
increases IL-16 mRNA expression and storage of intracellular IL-16
protein and enhances the secretion of mature IL-16 in a biphasic
manner. An early release of IL-16 (peak at 4 h) is independent of
protein synthesis, while a more delayed release (peak at 12 h)
requires protein synthesis and occurs subsequent to the induction of
IL-16 mRNA and intracellular accumulation of pro-IL-16. There was
evidence that LLDC use caspase-1 to process IL-16, as inhibition of
caspase-1, but not of caspase-3, partially prevented the release of
IL-16 in response to ligation of FcRI. In an in vivo model of
IgE-dependent LC activation, the atopy patch test, positive skin
reactions were also associated with the induction of IL-16 in epidermal
dendritic cells. These data indicate that IL-16 released from LC after
allergen-mediated activation through FcRI may link IgE-driven and
cellular inflammatory responses in diseases such as atopic
dermatitis. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- and 
-chains and acts synergistically with IL-2 in
expanding activated CD4+ cells
(7). IL-16 is synthesized by CD4+ and CD8+ T cells and is released in response to Ag, mitogen, histamine, and serotonin (1). Production of IL-16 has also been demonstrated in eosinophils, mast cells, respiratory tract epithelial cells, fibroblasts, and, more recently, B cells and dendritic cells (8, 9). IL-16 is synthesized as a nonbioactive precursor protein (pro-IL-16) encoded from a 2.6-kb transcript (10). From recent studies in T cells and fibroblasts there is evidence that the conversion of pro-IL-16 to bioactive IL-16 is mediated by caspase-3. This cleavage is likely to represent a critical step in the post-transcriptional regulation of IL-16 production (11, 12).
Knowledge about a functional role of IL-16 in inflammatory processes is only beginning to emerge. The results of some early reports indicate that IL-16 could be involved in autoimmune disorders, such as multiple sclerosis (13), rheumatoid arthritis (14), and inflammatory bowel disease (15). There is also evidence that IL-16 mediates important pathogenic aspects of allergic asthma, including production of allergen-specific IgE, recruitment of inflammatory cells to the bronchial mucosa, and development of airway hyper-responsiveness (16, 17, 18).
Atopic dermatitis
(AD)4 is a common
chronic inflammatory skin disease characterized by the presence of
increased numbers of Langerhans cells (LC), CD4+
T cells, macrophages, and eosinophils in cutaneous lesions. The
histologic picture is partly reminiscent of cutaneous delayed-type
hypersensitivity (DTH) responses. Because AD frequently coexists with
allergic rhinitis and asthma, and affected patients share some typical
immunologic findings, such as the presence of IgE Abs to a limited set
of Ags, a systemic link between respiratory allergy and AD has been
suggested. A current concept is that epidermal LC in AD overexpress
FcRI and use this structure for the selective and highly efficient
uptake of IgE-bound Ags. Preferential presentation of these Ags
subsequently leads to the induction of allergen-specific T cell
responses that are capable of promoting IgE production and DTH
responses (19). This understanding is supported by the
clinical observation that DTH-like skin lesions can be provoked in a
subset of AD patients by epicutaneous application of allergen (atopy
patch test), with positive patch test reactions depending on the
presence of IgE-bearing LC in the epidermis (20). However,
the frequency of allergen-specific T cells in the atopy patch test
model of acute AD is low (21), and the exact mechanisms
regulating the influx of T cell into AD lesions remain to be
defined.
Here we show that cross-linking of IgE bound to FcRI on LC-like DC
(LLDC) derived from AD patients increases IL-16 mRNA expression and
intracellular protein storage and enhances the release of mature IL-16.
IL-16 was also induced in epidermal dendritic cells in vivo during
positive atopy patch test reactions. Therefore, IL-16 production in
epidermal LC may link IgE-dependent LC activation and
CD4+ cell infiltration in atopic dermatitis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A culture medium consisting of RPMI 1640 supplemented with 10%
FCS, 12 mM HEPES, 2 mM L-glutamine, 100 U/ml penicillin G,
and 100 µg/ml streptomycin (all purchased from Biochrom, Berlin,
Germany) was used. All experiments shown in this report were performed
with FCS lot 371S. Recombinant human (rh) GM-CSF was provided by the
Schering Plough Research Institute (Kenilworth, NJ), rhIL-4 and natural
human (platelet-derived) TGF-1 were purchased from Strathmann
Biotech (Hannover, Germany), and rhIL-16 was obtained from PeproTech
(London, U.K.). Human AB serum, saponin, and actinomycin D were
obtained from Sigma (Deisenhofen, Germany). Human myeloma IgE,
cycloheximide, and specific inhibitors of caspase-1 (Ac-YVAD-CHO) and
caspase-3 (Ac-DEVD-CHO) were purchased from Calbiochem (Schwalbach,
Germany). Normal rabbit serum and normal goat serum were obtained from
DAKO (Hamburg, Germany), and lactose was purchased from Merck
(Darmstadt, Germany).
mAbs directed against CD1a (FITC, clone HI149), CD40 (FITC, 5C3), CD86
(PE, IT2.2), and IL-16 (PE, 14.1) were purchased from PharMingen (San
Diego, CA). mAb 14.1 has been shown to detect pro-IL-16 and mature
IL-16 (22). Abs against CD1a (PE, VIT6B), CD3 (PE, S4.1),
CD4 (FITC, S3.5), CD20 (FITC, HI47), CD56 (PE, NKI-nbl-1) and
HLA-DR (FITC, TÜ36) were obtained from Caltag (Burlingame, CA);
anti-CD14 (FITC, UCHM1) was purchased from Ancell (Bayport, MN);
anti-CD83 (PE, HB15A), anti-HLA-DR (PE, B8.12.2), anti-CD23
(FITC, 9P.25), and anti-E-cadherin (67A4) were obtained from
Coulter (Marseilles, France). The anti-Lag Ab (23) was
provided by S. Imamura (Kyoto University, Kyoto, Japan). Anti-IL-16 mAb
LCF-1 has been described previously (13) and was provided
by H. J. Schluesener (Eberhard Karls University, Tubingen,
Germany). Anti-FcRI -chain mAb 3G6 was purchased from Upstate
Biotechnology (Lake Placid, NY). mAbs 9P.25 (24) and 3G6
(25) inhibit IgE binding to CD23 and FcRI,
respectively. Anti-FcRI -chain 29C6, which does not interfere
with the IgE binding site (26), was provided by B. Henz
(Humboldt University, Berlin, Germany). Rabbit polyclonal
anti-IL-16 Ab (H-110) was obtained from Santa Cruz Biotechnology
(Heidelberg, Germany). Rabbit anti-human IgE pAb was purchased from
DAKO. FITC-conjugated or biotinylated rabbit anti-mouse and goat
anti-rabbit Ig F(ab')2 were obtained from
DAKO and BioSource (Solingen, Germany), respectively. FITC- or
PE-conjugated and unconjugated isotype control mouse Igs were obtained
from Caltag, and rabbit IgG was purchased from Sigma.
Individuals and skin biopsy specimens
Peripheral blood (100 ml) for purification of monocytes was obtained from five healthy volunteers and five patients with confirmed AD. All patients with AD had high serum IgE levels (>500 kU/L) and specific IgE Abs to typical allergens.
From out-clinic AD patients, five patients with positive and five
patients with negative patch test responses to the major allergen (der
p1) of the house dust mite Dermatophagoides pteronyssinus
(after 48 h) were identified. All these patients were clinically
in remission and sensitized to der p1 as determined by measuring serum
levels of specific IgE (RAST class 
3 as determined by the CAP method;
Pharmacia, Freiburg, Germany). Patients were again patch-tested with
der p1 on nonlesional skin of the back according to a standard protocol
(21). Test sites were evaluated by two independent
investigators after 24, 48, and 72 h and were recorded as 1+
(erythema with slight induration), 2+ (erythema and papules), or 3+
(erythema, papules, and vesicles). Reactions were scored as negative
when repeated testing (twice) gave a negative result at all time
points. Biopsies were obtained from negative and positive test sites
after 48 h. In patients with positive patch test reactions,
biopsies after 48 h were also collected from nonlesional skin
patch tested with vehicle alone.
Patients were included if they had not received any systemic therapy, including UV therapy, within at least 4 wk before study entry. In patients patch-tested with der p1, topical treatment other than emollients was also discontinued at least 2 wk before skin sampling. Informed consent was obtained in all cases. The study was approved by the institutional review board of the Medical Faculty of the University of Göttingen.
Generation of LLDC
CD14+ monocytes were negatively isolated
from PBMC by high gradient magnetic sorting using the monocyte
isolation kit in combination with the VarioMACS technique according to
the manufacturer’s instructions (Miltenyi Biotec, Bergisch Gladbach,
Germany). To evaluate the efficiency of the cell separation, aliquots
of the negatively enriched cells were stained with directly conjugated
CD14-, CD3-, CD19-, CD56-, and HLA-DR-specific mAbs and analyzed by
flow cytometry. Routinely, between 10 and 15 x
106 CD14+ cells were
recovered from 100 ml venous blood with a purity 95%.
LLDC were generated from peripheral blood monocytes as previously
described (27). Briefly, purified
CD14+ cells were cultured for 6 days at a cell
density of 2.5 x 105 cells/ml in 24-well
flat-bottom culture plates (Greiner, Solingen, Germany) in culture
medium containing rhIL-4, rhGM-CSF (both at 1 x
103 U/ml), and natural human TGF-1 (25 U/ml)
in a 37°C humidified 5% CO2 atmosphere. On day
3 one-third of the supernatant was removed, and fresh medium (half the
culture volume) supplemented with full doses of cytokines was added.
Cell mortality and apoptosis were detected cytofluorometrically based
on the incorporation of propidium iodide and YO-PRO-1 dye using the
Vybrant Apoptosis Assay kit according to the manufacturer’s
instructions (Molecular Probes, Eugene, OR), and was <10% throughout
the culture.
IgE-dependent activation of LLDC
Day 6 LLDC were washed and incubated at 2.5 x
105 cells/ml in 24-well flat-bottom culture
plates in medium containing human myeloma IgE (10 µg/ml) for 1 h
at 37°C. Excessive IgE was removed, and surface-bound IgE was
cross-linked by addition of medium containing 50 µg/ml rabbit
anti-human IgE pAb. Alternatively, cells were activated by direct
ligation of FcRI using mAb 29C6 and rabbit anti-mouse Ig
F(ab')2 as previously described
(28). In blocking experiments cells were preincubated with
anti-CD23 (9P.25; 5 µg/ml), anti-FcRI (3G6; 10 µg/ml;
both for 30 min), or lactose (0.2 M, 15 min) before loading with IgE.
To study the effects of de novo protein synthesis and caspases on the
IgE-dependent release of IL-16, LLDC were incubated with either
cycloheximide (20 µg/ml for 2 h) or cell-permeable inhibitors to
caspase-1 and caspase-3 (both at 100 µM for 1 h) before addition
of rabbit anti-IgE pAb. In the experiments using actinomycin D,
this was added at 10 µg/ml together with the anti-IgE Abs. LLDC
were cultured in a 37°C humidified 5% CO2
atmosphere, and cells and cell-free supernatants were harvested after
2, 4, 6, 12, 24, and 48 h.
Flow cytometry
For one- and two-color flow cytometries, a total of 1 x
106 cells were washed in PBS, resuspended in
PBS/20% human AB serum, and incubated for 30 min at 4°C. After
pelleting, cells were labeled with fluorochrome-conjugated mAbs to
CD14, CD1a, CD83, CD86, CD40, HLA-DR, CD23, or the respective
isotype-matched control Igs for 30 min at 4°C (all Abs at 5–10
µg/ml). Cells were washed twice with PBS and immediately analyzed on
a PAS III flow cytometer (Partec, Munster, Germany) equipped with a
488-nm argon laser. At least 2 x 104
cells/single or dual staining were analyzed using the Winlist software
(version 3.0, Varity Software House, Topsham, ME). For the detection of
surface FcRI -chain and E-cadherin expression, cells were
incubated with PBS/20% human AB serum/20% rabbit serum, followed by
anti-FcRI or anti-E-cadherin mAbs (both at 10 µg/ml)
and FITC-conjugated rabbit anti-mouse Ig
F(ab')2 (1/20). Surface-bound IgE was detected on
cells preincubated with PBS/20% human AB serum/20% goat serum using
rabbit anti-human IgE (1/40) and FITC-conjugated goat
anti-rabbit Ig F(ab')2 (1/100). All
incubations were performed for 30 min at 4°C.
For analysis of intracellular IL-16, 1 x 105 DC were washed twice in ice-cold PBS/20% human AB serum, fixed for 15 min with 4% paraformaldehyde at 4°C, and permeabilized by incubation with PBS/20% human AB serum/0.1% saponin for 1 h at 4°C. After pelleting, cells were incubated with 10 µg/ml PE-conjugated anti-IL-16 (mAb 14.1) or the respective isotype-matched control Ig diluted in PBS/0.1% saponin for 30 min at 4°C, washed, and analyzed. As indicated, the IL-16 mAb was preincubated with 10 µg/ml rhIL-16 to confirm specificity.
Immunohistochemical procedures
Four-millimeter punch biopsies were fixed in neutral buffered formalin. For indirect immunoperoxidase staining of IL-16, 4-µm paraffin-embedded sections were dewaxed in xylol (Merck, Darmstadt, Germany) and rehydrated in serial dilutions of ethanol. For Ag retrieval, slides were placed in 10 mM citrate buffer (pH 6.0) and subjected to repeated heating in a microwave oven (five times, 5 min each time, 600 W). Sections were left to cool for 30 min, washed with 50 mM TBS (pH 7.6), and incubated with 0.3% H2O2 in methanol for 30 min for quenching of endogenous peroxidase activity, followed by a blocking step with TBS/20% normal rabbit serum for 30 min at room temperature. After blotting of excessive liquid, sections were incubated at 4°C overnight with anti-IL-16 mAb LCF-1 (undiluted hybridoma supernatant) in a humidified chamber. Sections were washed with TBS and incubated for 30 min with biotinylated rabbit anti-mouse IgG F(ab')2 diluted 1/300 in TBS/0.1% BSA. Sections were washed again and incubated with streptavidin-biotin-HRP complexes (DAKO), prepared according to the manufacturer’s instructions, for 30 min at room temperature. HRP activity was visualized using 3,3'-diaminobenzidine tetrahydrochloride (Sigma) as the chromogen. Control reactions included substitution of the primary Ab by mouse IgG1 and blocking of LCF-1 with rhIL-16 (10 µg/ml).
For immunocytochemical detection of Lag, 1 x 105 day 6 LLDC were centrifuged onto slides coated with 3-aminopropyl-triethoxysilane and fixed in ice-cold acetone for 30 s. After quenching of endogenous peroxidase, cytospins were blocked with 10% rabbit serum/10% human AB serum in TBS and incubated with Lag-Ab (1:200) overnight. Primary Abs were detected as described above with 3-amino-9-ethylcarbazole as the chromogen (DAKO). No counterstaining was used in these staining procedures.
RNA extraction and cDNA synthesis
RNA was extracted from approximately 5 x 105 cells according to the manufacturer’s instructions (RNeasy, Qiagen, Hilden, Germany) and was eluted in 30 µl RNase-free water (0.1% diethylpyrocarbonate; Sigma). RNA content was determined spectrophotometrically. Subsequent to a DNase digestion step (FCLP-pure DNase I; Pharmacia, Freiburg, Germany),1 µg RNA was reverse transcribed in a total volume of 50 µl RNase-free water including 1.5 µM p(dT)12–18 (Pharmacia), 0.4 mM of each dNTP (MBI Fermentas, St. Leon Rot, Germany), and 200 U reverse transcriptase (Superscript II, Life Technologies, Eggenstein, Germany).
RT-PCR for FcRI chains
After cDNA synthesis, cDNA was immediately controlled by PCR for
-actin (GenBank accession no. X00351; actin forward 5'
3',
CCCAGCCATGTACGTTGCTA; actin reverse 5'3',
GGGTGGCTTTTAGGATGGCAA; product size, 1047 bp; PCR conditions: 2 min
at 95°C, followed by 35 cycles of 45 s at 95°C, 45 s at
60°C, and 90 s at 72°C, followed by a final elongation step of
10 min at 72°C). Each PCR reaction was conducted in a total volume of
50 µl containing 20 mM Tris-HCl, 50 mM KCl, 1 µl cDNA, 1.5 mM
MgCl2, 0.2 mM dNTPs (MBI Fermentas), 18.75 pmol
of each primer (all primers from MWG Biotech, Ebersberg, Germany), and
1 U Taq DNA polymerase (Life Technologies). Primer sequences, cycle
numbers, and annealing temperatures were (PCR conditions otherwise as
for -actin): FcRI forward (Z29585),
TACAGTAATGTTGAGGGGCTCAG; FcRI reverse,
CTGTTCTTCGCTCCAGATGGCGT (536 bp, 30 cycles, 60°C); FcRI forward
(M89796), GGACACAGAAAGTAATAGGAGAG; FcRI reverse,
GATCAGGATGGTAATTCCCGTT (446 bp, 35 cycles, 56°C); FcRI
forward
(M33195), CCAGCAGTGGTCTTGCTCTTAC; and FcRI reverse,
GCATGCAGGCATATGTGATGCC (338 bp, 32 cycles, 69°C). PCR products were
visualized on 1 or 2% agarose gels by staining with ethidium bromide.
A PCR reaction was considered positive when the band was detected by
the gel analysis software Easy Win 32 (Herolab, Wiesloch, Germany).
Negative control PCR without template DNA was performed in all
experiments. PCR product identity was confirmed by cycle sequencing.
The expression of FcRI chain mRNA was also investigated in freshly
isolated LC and keratinocytes, prepared as described previously
(29).
Quantitative real-time RT-PCR for IL-16
Real-time RT-PCR for IL-16 was performed on the Light Cycler
(Roche Diagnostics, Mannheim, Germany) in a total volume of 20 µl in
the presence of 2 µl 10x reaction buffer (containing SYBR Green;
Roche Diagnostics), 2.4 ml MgCl2 (25 mM), 2 µl
cDNA, and 11.25 pmol of each oligonucleotide primer (actin-light cycles
forward, CCCAAGGCCAACCGCGAGAAGAT; actin-light cycles reverse,
GTCCCGGCCAGCCAGGTCCAG (219 bp); IL-16-light cycles forward
(M90391), AAGGGGCATCTCCAACATCATCAT; IL-16-light cycles reverse,
CTCCTGCCAAGCTGAACCCAAGAC (332 bp)) as previously described
(30). Briefly, PCR products (initial denaturation of
30 s at 95°C, followed by 40 cycles of 0 s at 95°C,
5 s at annealing temperature (-actin, 66°C; IL-16, 62°C)
and product length in base pairs/25 s at 72°C) were subjected to
melting curve analysis, and external standards, ranging from 10 to
0.0001 amol/µl (representing 6 x 106 to
60 copies/µl), were prepared for -actin and IL-16. Quantitation
was performed at a temperature (as obtained from the melting curve
analysis) above the melting point of primer-dimers and below the
melting point of the specific PCR product (-actin, 87°C; IL-16,
83°C). From the external standards, a calibration curve was
automatically generated, and samples were quantified accordingly using
Light Cycler analysis software (version 3.39). Values (attomoles per
microliter) obtained for IL-16 were standardized for -actin
values. Quantitation was performed in duplicate (variation typically
<10%), and negative control reactions without template were always
included.
Immunoblotting for IL-16
Cell extracts of 2 x 106 LLDC were prepared by lysis in RIPA buffer (150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris-HCl (pH 8.0), 0.2 mM PMSF, 1 µg/ml pepstatin, and 0.5 µg/ml leupeptin) for 30 min at 4°C and subsequent centrifugation for 5 min at 16,000 x g. Protein content was estimated in cell lysates and corresponding cell-free supernatants by a commercial Bradford assay (Bio-Rad, Munich, Germany) with BSA standards, and 50 µg/lane were boiled in SDS sample buffer and subjected to electrophoresis through a 12% SDS-polyacrylamide gel. Proteins were electrophoretically transferred to a polyvinylidene difluoride membrane (0.45 µm; Immobilon-P, Millipore, Eschborn, Germany) and probed with rabbit anti-IL-16 pAb (1/200), followed by biotinylated goat anti-rabbit (1/2000; DAKO), and streptavidin-HRP (DAKO). Visualization of bound Abs was performed using the Blotting Amplification System according to the manufacturer’s instructions (NEN Life Science, Boston, MA).
ELISA for IL-16
Cell-free supernatants were collected at different time points during culture of day 6 LLDC, and levels of IL-16 protein were determined by ELISA according to the manufacturer’s instructions (BioSource, Solingen, Germany; sensitivity, 5 pg/ml).
Statistical analysis
Data are given as the mean and SEM unless indicated otherwise. Levels of IL-16 mRNA and secreted IL-16 protein obtained after stimulation of LLDC derived from healthy controls and AD patients were first evaluated by ANOVA as indicated. Simple main effects within the groups and between groups were then compared using the paired or unpaired t test, respectively. Values of p < 0.05 were considered to indicate significance. Calculation was performed using PRISM 2.01 software (GraphPad, San Diego, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RI is the main IgE-binding structure on monocyte-derived LLDC
LLDC were generated from purified monocytes by 6-day culture in
GM-CSF, IL-4, and TGF-1 as previously described (27).
In contrast to DC generated in the presence of IL-4 and GM-CSF alone,
these cells have been shown to more closely resemble LC in that they
express the epithelial antigen E-cadherin and the skin-homing antigen
CLA (cutaneous lymphocyte-associated antigen), both relevant to the
unique localization of LC within epithelial cells, and exhibit Birbeck
granules and their associated Lag antigen (27). In
accordance with the published data, the resulting DC were
CD1a+, but CD83- (Fig. 1
, a and b), and a
substantial fraction (40–70%) expressed E-cadherin and CLA (Fig. 1, d and e), and contained the Lag antigen
(Fig. 2). The purity of day 6 LLDC, as
assessed by the expression of these markers as well as of CD40 (Fig. 1c) and the absence of CD3, CD20, CD14, and CD56 (not
shown), was >95%.
|
|
- and -chains, but not the -chain of FcRI (Fig. 3). Although the phenotype of day 6 LLDC
derived from patients with AD and healthy controls was otherwise
identical, the percentage of day 6 LLDC showing surface expression of
the FcRI -chain was significantly higher among cells derived from
patients with AD (mean ± SD, 56.3 ± 11.3%) than on those
derived from healthy donors (22.3 ± 10.8%; p <
0.01; for examples, see Fig. 1
, g and h).
In contrast, the low affinity receptor for IgE (CD23) was expressed on
<10% of LLDC in either group (Fig. 1f).
|
i). However,
LLDC could be efficiently loaded with IgE by incubation for 1 h
with human myeloma IgE (10 mg/ml; Fig. 1j). Blocking studies
were performed by preincubation of LLDC with lectin, mAb 3G6, and mAb
9P.25, preventing the binding of IgE to -binding proteins, FcRI,
and CD23, respectively. These experiments identified FcRI as the
main IgE-binding structure on LLDC, since only pretreatment of LLDC
with Abs to FcRI significantly reduced IgE binding (by 
90%; Fig. 1k), whereas pretreatment with mAbs to CD23 or with lectin
had no effect (Fig. 1, l and m). This result was
supported by the finding that the IgE binding capacity of LLDC derived
from patients with AD (mean ± SD of positive cells after
incubation with IgE, 62.0 ± 18.5%) was significantly greater
than that of LLDC derived from healthy donors (24.4 ±
10.5%; p < 0.01).
Activation of LLDC from patients with AD via FcRI induces IL-16
mRNA expression, and storage and release of IL-16 protein
Day 6 LLDC constitutively contained IL-16 mRNA and intracellular
protein (as determined by intracellular cytokine staining with 14.1 mAb
and flow cytometry; see Fig. 1n) and spontaneously released
IL-16 into the supernatant. Fig. 4A shows the constitutive
IL-16 mRNA expression, determined by quantitative real-time PCR, and
IL-16 secretion, determined per 24 h by ELISA, in LLDC compared
with those in purified monocytes and activated T cells. Immunoblotting
of day 6 LLDC cell extracts separated by SDS-PAGE revealed one
prominent band around 80 kDa and several smaller molecular mass species
between 40 and 60 kDa (Fig. 4B); the pattern resembled
pro-IL-16 and partially processed pro-IL-16 as detectable in activated
T cells (10, 22). In line with previous findings
(8), no band was observed around 20 kDa, indicating that
mature IL-16 is not constitutively stored in DC. However, a band around
20 kDa resembling mature IL-16 (10, 22) was found in the
supernatant of day-6 LLDC (Fig. 4B), suggesting that LLDC
release mature IL-16. In this set of experiments no significant
differences were noted between day 6 LLDC from AD patients and those
from healthy donors.
|
. Ligation
of surface-bound IgE on LLDC derived from AD patients resulted in a
biphasic release of IL-16, with the first peak detectable at 4 h,
and the second peak detectable at 12 h after activation (Fig. 5A). Stimulation of IL-16 secretion was accompanied by the
induction of IL-16 mRNA expression starting at 6 h and lasting
until 24 h after activation. In contrast, in LLDC cultures derived
from healthy subjects there was only a small increase in the amount of
IL-16 protein released at 6 h (compared with unstimulated
cultures) and no significant induction of IL-16 mRNA expression (Fig. 5A). Levels of IL-16 protein secreted by LLDC from AD
patients in response to cross-linking of IgE at 4 and 12 h were
significantly greater than the corresponding protein levels in cultures
from healthy individuals, and mRNA levels were also significantly
greater at 6, 12, and 24 h (Fig. 5A; n
= 5 experiments in each group). Cell extracts were prepared from LLDC
of AD patients at different time points of the culture and investigated
by immunoblots (Fig. 5B). In contrast to unstimulated day 6
LLDC, a weak band of about 20 kDa was detectable 4 h after
IgE-dependent activation, suggesting that cross-linking of IgE resulted
in the storage of mature IL-16. Following the induction of IL-16 mRNA,
LLDC at 12 h after cross-linking of IgE also contained increasing
amounts of 80 kDa pro-IL-16. These findings were supported by
intracellular cytokine staining for IL-16 using 14.1 mAb that
recognizes pro- and mature IL-16 (22). The mean
fluorescence intensity, as an estimate of the amount of intracellular
protein, and the percentage of positively stained cells were clearly
increased in LLDC harvested 12 h after IgE-dependent activation
compared with those in unstimulated day 6 LLDC (for example compare
Fig. 1, n and o).
|
RI, we tested this more directly by activating LLDC derived from
AD patients via ligation of FcRI using 29C6 mAb as described
previously (28) (n = 3). The induction of
IL-16 mRNA expression and protein release following direct ligation of
the receptor was similar to that obtained after cross-linking of
surface-bound IgE (not shown). IL-16 is induced in epidermal dendritic cells in positive atopy patch test reactions
Given the observation that cross-linking of IgE stimulated IL-16 production in LLDC from atopic donors in vitro, we were interested to determine whether IgE-dependent activation would also induce IL-16 production in epidermal LC in vivo. To address this question, we investigated the expression of IL-16 in positive and negative skin reactions of clinically nonactive AD patients patch-tested with the house dust mite Ag der p1, because this type of contact hypersensitivity is considered to involve IgE-dependent activation of epidermal LC (20). All patients were sensitized to der p1, as indicated by the presence of specific IgE Abs and previous skin testing.
In biopsies obtained from positive skin reactions 48 h after
application of the allergen, numerous epidermal dendritic cells in
addition to some epidermis-infiltrating mononuclear cells, but not
keratinocytes, were found to contain IL-16 (Fig. 6c). The perivascular
mononuclear infiltrate also stained strongly positive for IL-16. In
some patients net-like clusters of IL-16 containing DC were present
above the papillae (inset in Fig. 6c), the area of potential
LC-T cell interactions. In contrast, no IL-16+
epidermal cells were found in skin samples obtained from negative test
reactions (Fig. 6d) or biopsies obtained from sites patch
tested with vehicle alone (not shown). Also, in these cases there was
no significant perivascular infiltrate containing IL-16, and the
expression of IL-16 was similar to that observed in normal skin (Fig. 6b).
|
Since the early release of IL-16 occurred before the induction of
IL-16 mRNA, we speculated that it was independent of de novo protein
synthesis. To test this hypothesis, experiments were performed in which
LLDC from AD patients were treated with actinomycin D or cycloheximide
before cross-linking of IgE. The results are summarized in Fig. 7A. The early release of IL-16
(at 4 h) in response to IgE-dependent activation of LLDC was not
affected by either treatment; however, the second peak at 12 h was
significantly reduced by both agents. Cycloheximide tended to be more
effective in reducing the release of IL-16 after 12 h, suggesting
that some IL-16 mRNA was still present in actinomycin D-treated
cultures during the first hours after stimulation. Real-time RT-PCR, in
fact, demonstrated low amounts of IL-16 mRNA at 2 and 4 h, whereas
IL-16 mRNA became undetectable thereafter (not shown).
|
B), although the same procedure has been shown to inhibit
the release of IL-16 from resting CD8+ and
activated CD4+ T cells (11, 31). In
contrast, when cells were preincubated with Ac-YVAD-CHO, a specific
inhibitor of caspase-1 (32, 33), the amounts of IL-16
protein released from activated LLDC at 4 and 12 h were
significantly decreased (Fig. 7B). Pretreatment with the
caspase-1 inhibitor, but not the caspase-3 inhibitor, also prevented
the appearance of the 20-kDa band detectable in IL-16 immunoblots of
LLDC lysates after ligation of IgE (Fig. 7C). Inhibition of
neither caspase affected the induction of IL-16 mRNA or the appearance
of the 80-kDa band (not shown). Importantly, the release of IL-16 in
response to IgE cross-linking was not associated with apoptosis
(determined by flow cytometric analysis of propidium iodide and
YO-PRO-1 dye incorporation; see Materials and Methods), as
the rate of apoptotic cells during the 48-h stimulation period was
similar in control cultures (medium alone), cultures activated via IgE
cross-linking, and activated LLDC treated with caspase inhibitors
(10%; not shown). In concert, these findings suggest that the
release of IL-16 from LLDC in response to ligation of FcRI-bound IgE
requires processing of the IL-16 precursor by caspase-1. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RI, and can use this structure for
capture of Ags, we attempted to elucidate whether activation of LC
cells through engagement of the high affinity IgE receptor would
influence the production of IL-16, a cytokine unique in its ability to
induce chemotactic responses in CD4+ cells.
Monocyte-derived LLDC generated by 6-day culture in the presence of
IL-4, GM-CSF, and TGF-1, served as a model for epidermal LC. In
contrast to peripheral blood dendritic cells, LLDC closely resembled
epidermal LC with regard to the expression of typical adhesion
molecules (E-cadherin and CLA) and the Birbeck granules-associated Lag
Ag. More importantly, we show that LLDC derived from monocytes of AD
patients carry high levels of FcRI and low levels of CD23 (the low
affinity IgE receptor), similar to LC isolated from AD lesions, while
LLDC derived from monocytes of healthy subjects expressed only low
levels of FcRI, similar to LC isolated from normal skin
(28). There was also evidence that LLDC express only the
- and -chains, not the -chain, of FcRI, a characteristic of
LC (19).
Activation of LLDC derived from AD patients by cross-linking of IgE
bound to FcRI was found to induce IL-16 mRNA expression and enhance
the storage and release of IL-16 protein. From the results of Western
analysis, the secreted cytokine is likely to represent mature IL-16
(10, 22). This is also supported by the earlier
demonstration that IL-16 released from DC is bioactive and capable of
inducing chemotactic responses in DC themselves and in T cells
(8). The release of IL-16 from LLDC in response to
ligation of FcRI occurred in a biphasic manner. There was an early
release (after 4 h) that was independent of protein synthesis and
a more delayed release of IL-16 (peak after 12 h) that followed
the induction of IL-16 mRNA and the accumulation of intracellular
pro-IL-16 and was at least partially dependent on de novo protein
synthesis.
Rapid release of IL-16 has been observed in the human mast cell line
HMC-1 (34). These cells secrete bioactive IL-16 by 2
h after stimulation with PMA and 4 h after stimulation with C5a,
while mRNA is not induced before 4 h by these stimuli. The
mechanisms involved in the early release of preformed IL-16 by HMC-1
cells have not yet been analyzed. Pro-IL-16 is present preformed in
CD4+ and CD8+ T cells, and
CD8+, but not CD4+, T cells
constitutively store and secrete bioactive IL-16 (1).
CD8+ T cells rapidly release bioactive IL-16 in
response to histamine (2–4 h) and serotonin (1–2 h) independent of
protein synthesis (35, 36). More recently,
CD8+ T cells, but not CD4+
T cells, have been shown to constitutively contain active caspase-3,
and cleavage of pro-IL-16 by caspase-3 is now regarded as an essential
step in the constitutive release of bioactive IL-16 from
CD8+ T cells (11, 31). Similar to
CD8+ T cells, day 6 LLDC contained IL-16
precursor fragments, consistent with a spontaneous (partial) cleavage
of pro-IL-16, and constitutively released mature IL-16. The early
appearance of mature intracellular IL-16 and the rapid release of IL-16
in response to cross-linking of IgE also suggested that enzymatic
cleavage could be involved. Unexpectedly, inhibition of caspase-1, but
not of caspase-3, prevented the appearance of intracellular mature
IL-16 after cross-linking of IgE and significantly decreased the
release of IL-16 from activated LLDC, indicating that LLDC, compared
with T cells, use an alternative pathway to process IL-16 that involves
caspase-1 and is activated through engagement of FcRI. Therefore, at
least in LLDC, IL-16 may share the requirement of caspase-1 activation
with IL-1 and IL-18, two other cytokines that affect LC migration
and are also processed by caspase-1 (32, 33).
There was a considerable constitutive release of IL-16 from LLDC on day
6 and during further incubation of day 6 LLDC in culture medium alone,
as could be expected from previous findings (8). In
contrast, we found that epidermal LC in normal skin (Fig. 6b) and LC freshly isolated from the foreskin of (nonatopic)
individuals undergoing circumcision do not constitutively contain
IL-16, although synthesis, storage, and secretion of IL-16 can be
induced in the latter by incubation with PMA and ionomycin, confirming
the principle ability of epidermal LC to produce
IL-16.5 A possible
explanation is that DC obtained from peripheral monocytes by 6-day
culture in the presence of cytokines are in a different state of
activation compared with resting (immature) DC within normal epidermis.
This is supported by the observation that DC generated from peripheral
blood cells constitutively synthesize a variety of cytokines that are
not detectable in normal epidermis (37). Accordingly, the
cytokines added to induce differentiation of monocytes into LLDC or the
factors produced by differentiating LLDC themselves may account for the
baseline production of IL-16 observed in these cells. It is noteworthy
that inhibition of caspase-1 clearly (although not completely)
decreased the spontaneous release of IL-16 from day 6 LLDC incubated in
culture medium alone (not shown), suggesting that cleavage of pro-IL-16
by caspase-1 is a principle requirement for the release of IL-16 from
LLDC and is not exclusively induced by activation via ligation of
surface-bound IgE.
The differential response of LLDC derived from atopic patients and
healthy donors to IgE-dependent activation is remarkable and possibly
best explained by the observed difference in the expression of FcRI
on these cells. In line with this view, calcium mobilization upon
ligation of FcRI is only detected in epidermal LC isolated from AD
patients who express high levels of FcRI, but not in those from
normal skin of healthy individuals expressing low levels of FcRI
(28). Our finding that monocyte-derived LLDC from AD
patients carry the same phenotypic abnormality as observed in freshly
isolated LC is in agreement with earlier results (38) and
supports the concept of an intrinsic defect in the regulation of IgE
receptor expression in these patients (39, 40).
The atopy patch test, i.e., the epicutaneous application of relevant
allergens to nonlesional skin of AD patients, is a well-established
model of an allergen-induced DTH-like skin immune response
(20). In the case of a positive patch test, as observed in
a subset of AD patients, CD4+ lymphocytes
infiltrate the skin, and an eczematous lesion develops within 48 h
at the site of allergen challenge. Importantly, the development of a
positive test reaction has been shown to strictly depend on the
presence og IgE-bearing epidermal LC, circulating specific IgE Abs, and
allergen-reactive T cells (20). The current explanation is
that LC capture allergen via specific IgE molecules bound to the high
affinity IgE receptor and subsequently induce an allergen-specific
cutaneous T cell response (19). Because allergen-dependant
LC activation and CD4+ T cell infiltration are
key elements of the atopy patch test reaction, we used this model to
investigate whether FcRI-dependant induction of IL-16 would also
occur in LC in vivo. When the house dust mite allergen der p1 was
applied to nonlesional skin of AD patients sensitized to der p1, IL-16
became detectable in epidermal dendritic cells in positive, but not in
negative, patch test reactions, suggesting that allergen-mediated
cross-linking of surface-bound IgE may activate epidermal LC to express
IL-16 in this model. In concert with the earlier findings that IL-16 is
a major chemotactic signal from DC toward CD4+ T
cells (8) and a critical mediator of T cell infiltration
during murine DTH responses (41), these data point to an
important role of IL-16 in the LC-dependant control of
CD4+ cell infiltration into the skin. Clearly,
there are other cutaneous sources of IL-16, and the perivascular
mononuclear infiltrate emerging in the dermis during positive atopy
patch test reactions also stained positively for IL-16. If an
IgE-dependant pathway of LC activation similar to that observed in LLDC
and in the positive atopy patch test reaction is also functional in
active AD, one should expect constitutive expression of IL-16 in
epidermal LC in this condition. In fact, we found that approximately
40% of epidermal CD1a+ LC in active AD express
IL-16 protein and that this expression is completely down-regulated by
topical treatment with FK506, which is known to suppress LC
activation.5
Taken together, we present evidence that the secretion of IL-16 from allergen-activated epidermal LC may contribute to the recruitment and activation of DC, T cells, and eosinophils in AD, providing a possible link between IgE-mediated and cellular inflammatory responses. It will be interesting to see how our data on the caspase-1-dependent release of IL-16 from LLDC relate to the recent observation that LC migration and contact sensitization are impaired in caspase-1-deficient mice (42).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Preliminary results were presented at the meeting of the European Academy of Allergy and Clinical Immunology, Davos, Switzerland, February 1–4, 2001.
3 Address correspondence and reprint requests to Dr. Kristian Reich, Department of Dermatology, Georg-August-University, Von Siebold Strasse 3, 37075 Göttingen, Germany. E-mail address: kreich{at}gwdg.de
4 Abbreviations used in this paper: AD, atopic dermatitis; DC, dendritic cell; DTH, delayed-type hypersensitivity; LC, Langerhans cells; LLDC, Langerhans cell-like dendritic cells; pAb, polyclonal Ab; rh, recombinant human.
5 K. Reich, S. Hugo, P. Middel, V. Blaschke, A. Heine, C. Gutgesell, R. Williams, and C. Neumann. Evidence for a role of Langerhans cell-derived IL-16 in atopic dermatitis. Submitted for publication.
Received for publication July 9, 2001. Accepted for publication October 2, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(MIP1) in bronchoalveolar lavage fluid of antigen-challenged asthmatics. Am. J. Respir. Cell. Mol. Biol. 13:738.[Abstract]
RI on antigen-presenting cells. Int. Arch. Allergy Immunol. 113:24.[Medline]
RI chain is necessary for efficient folding in the endoplasmic reticulum. J. Biol. Chem. 270:8249.RI): analysis of functional domains of the alpha-subunit with monoclonal antibodies. J. Biol. Chem. 266:11245.1, in the presence of granulocyte/macrophage colony-stimulating factor and interleukin 4, induces differentiation of human peripheral blood monocytes into dendritic Langerhans cells. J. Exp. Med. 187:961.RI. J. Immunol. 155:5184.[Abstract]
and interleukin-10 promoter regions and polymorphic xenobiotic metabolizing enzymes in psoriasis. J. Invest. Dermatol. 113:214.[Medline]
(IL-1) processing in murine macrophages requires a structurally conserved homologue of human IL-1 converting enzyme. Proc. Natl. Acad. Sci. USA 90:1809.-inducing factor and regulates LPS-induced IFN- production. Nature 386:619.[Medline]
subunit of the high-affinity immunoglobulin E receptor. Nat. Genet. 7:125.[Medline]
subunit of the interleukin-4 receptor. N. Engl. J. Med. 337:1720.This article has been cited by other articles:
|
|
 |
|
  T. Bieber Atopic Dermatitis N. Engl. J. Med., April 3, 2008; 358(14): 1483 - 1494. [Full Text] [PDF]
|
|
|
|
 |
|
 J. Bayry, S. Lacroix-Desmazes, M. D. Kazatchkine, O. Hermine, D. F. Tough, and S. V. Kaveri Modulation of Dendritic Cell Maturation and Function by B Lymphocytes J. Immunol., July 1, 2005; 175(1): 15 - 20. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Pasquier, Y. Lepelletier, C. Baude, O. Hermine, and R. C. Monteiro Differential expression and function of IgA receptors (CD89 and CD71) during maturation of dendritic cells J. Leukoc. Biol., December 1, 2004; 76(6): 1134 - 1141. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, left y-axis) were determined by quantitative
real-time RT-PCR. Monocytes and day 6 LLDC were cultured in medium
alone, PBMCs were incubated in medium containing PMA (10 ng/ml) and
ionomycin (1 µmol). Levels of secreted IL-16 protein were determined
by ELISA per 5 x 105 cells/24 h (
,
right y-axis). Bars represent the
mean ± SEM of five experiments in each group. B,
Immunoblot of cell lysate and supernatant of day 6 LLDC. A total of 50
µg cellular extracts (lane 1), supernatants
(lane 2), and 200 ng rhIL-16 (lane 3),
respectively, were separated by SDS-PAGE, blotted, and probed with
rabbit IgG pAb. Molecular mass standards are indicated by arrows. This
figure is representative of four independent experiments.
