| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Ludwig Institute for Cancer Research, University of Lausanne, Epalinges, Switzerland; and
Swiss Institute for Experimental Cancer Research, Epalinges, Switzerland
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Murine NK cells recognize classical MHC class I molecules via Ly49 family receptors. In general these receptors are specific for one and occasionally two class I isotypes, sometimes discriminating alleles thereof (1). The prototype receptor, Ly49A, inhibits NK cell function upon the interaction with the H-2Dd but not the Db class I molecule (2). The specificity of Ly49 receptors together with their combinatorial distribution allows NK cells to react to subtle changes in a cell’s MHC class I make-up, such as the absence of a single class I allele (3).
The MHC class I environment in which NK cells mature or exist is an
important determinant of their reactivity to target cells. The
requirements for NK cell adaptation to class I were addressed using two
experimental systems: MHC-deficient and MHC-different mouse models.
First, although NK cells arise in the absence of MHC class I molecules
in 
2-microglobulin
(2m)3-deficient
mice, they were found to be impaired in their ability to lyse various
target cells (4, 5, 6). In radiation bone marrow chimeras,
the absence of class I molecules from either the radioresistant cells
or some or all of the radiosensitive (hematopoietic) cells was
sufficient to render NK cells hyporesponsive (4, 5, 7). In
addition, MHC differences between mice were used to investigate NK cell
function and tolerance. NK cells that developed in
H-2b mice expressing an
H-2Dd transgene (Tg) acquired the ability to
reject bone marrow grafts from H-2b donors.
Nontransgenic (non-Tg) and Tg mice were self-tolerant, as the
respective syngeneic bone marrow grafts were not rejected
(8). Thus, NK cells can adapt to the presence of MHC class
I molecules. They acquire tolerance toward MHC-identical cells and
reactivity to cells that lack them.
Due to the generalized effect on NK cell function in the absence of MHC
class I, MHC-deficient mice were not suited to address the function of
NK cell subsets that are defined by the expression of specific
receptors for MHC class I. Indeed, the rejection of MHC-different but
not MHC-deficient bone marrow cells could be prevented by the enforced
expression of an appropriate inhibitory MHC receptor on all NK cells
(9, 10, 11). Further, it was shown that NK cell self-tolerance
was ensured via the inhibitory effect of MHC receptors
(12, 13, 14); e.g., the inhibitory Ly49A receptor prevented
H-2d NK cells from attacking syngeneic cells. In
contrast, self-tolerance of H-2b
Ly49A+ NK cells was independent of Ly49A function
(12, 13). Because Ly49A+ NK cells
from H-2b mice killed 2m-deficient target
cells it was concluded that self-tolerance was ensured by the
inhibition through H-2b-specific receptors
(13). In agreement with this thesis, in a panel of human
NK cell clones, each clone expressed at least one inhibitory receptor
specific for self-MHC (15). These results suggest that
autoaggressive clones are not present in the NK cell compartment.
However, they did not rule out the existence of additional tolerance
mechanisms. Autoaggressive NK cells may be refractory to cloning.
Consistent with this possibility, murine NK cell clones lacking known
self-MHC-specific inhibitory receptors were detected using a single
cell PCR assay (16). Evidence for the existence of
potentially autoaggressive NK cells was also obtained using a class I
MHC mosaic mouse, where H-2b cells coexisted with
H-2b cells expressing H-2Dd
(17). NK cells in these mice were unable to react to
H-2b+Dd- cells in vitro
and in vivo. However, upon the removal of
H-2b+Dd- cells in vitro
the reactivity of H-2b+Dd+
NK cells to H-2b+Dd-
target cells was observed. Based on these findings it was proposed that
NK cell tolerance may also be ensured by NK cell silencing (17, 18).
To further address the function of NK cells in relation to variable patterns of MHC class I expression we have engineered a genetic "off switch" for an H-2Dd Tg using Cre recombinase. The shut down of H-2Dd expression in a fraction of cells prevented NK cell reactivity to H-2b+Dd- cells. This was associated with the inability of the Ly49A+ NK cell subset to perform missing Dd recognition. However, these Ly49A+ NK cells were able to react to target cells, which were completely lacking MHC class I molecules, suggesting that they were not silent but rather specifically unable to react to cells lacking Dd. These findings are discussed in the context of the adaptation of NK cells to self-MHC class I.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
An oligo containing two loxP sites (GenBank accession no. M10494, nucleotides 14–47), an internal SpeI site, and external XbaI sites was cloned into the XbaI site of pSK II (Stratagene, La Jolla, CA). The 1.8-kb XbaI fragment from pDd1 (19) was then inserted into the loxP-flanked SpeI site, which destroyed both SpeI and XbaI sites. The loxP-1.8-kb Dd1-loxP fragment was removed from the vector (using the external XbaI sites) and reinserted into pDd1. The 8.1-kb loxDd construct was liberated from vector sequence using EcoRI digestion and injected into fertilized (C57BL/6 x DBA/2)F2 oocytes. Six Tg founder mice termed loxDd Tg were identified by PCR using the following primers: P1, 5'-CTGCCCACGCCCACTGTCT-3'; and P2, 5'-GACCATTCACCACTGTAGG-3'. This resulted in a 283-bp fragment for the loxDd Tg and 243 bp for wild-type H-2Db or H-2Dd alleles. Tg lines were established from five founders by backcrossing to C57BL/6 (B6) (H-2b) mice. For the experiments shown in this work Dd-Tg mice (line 28) B6 backcross (bc) 2–4 were used.
Mx-1-Cre (20) B6 bc 1 and CMV-Cre estrogen receptor (ER) (21) Tg mice B6 bc 3 were kindly provided by M. Aguet (Swiss Institute for Experimental Cancer Research, Epalinges, Switzerland) and P. Chambon (Institut de Génétique et de Biologie Moléculaire et Cellulaire, Strasbourg, France), respectively. LoxDd x Cre double Tg mice were obtained by breeding. Double Tg offspring were identified by flow cytometry for H-2Dd and by Southern-blot of tail DNA probed with a 700-bp MluI fragment derived from Cre cDNA (kindly provided by M. Aguet, Swiss Institute for Experimental Cancer Research).
B6 (H-2b) and B10.D2 (H-2d)
mice were obtained from Harlan Olac (Zeist, The Netherlands).
2m-deficient mice were purchased from The Jackson
Laboratory (Bar Harbor, ME). Ly49A-Tg mice (B6 bc 8) were described
before (9). All mice were >6 wk of age when used for
experiments. They were homozygous for a B6-derived NK gene complex and
had a defined MHC based on flow cytometric analysis using appropriate
Abs. In all experiments appropriate littermate mice were used as
controls.
Polymerase chain reaction
Recombination of the loxDd Tg was analyzed
using a semiquantitative PCR approach. Starting with 
1 µg, serial
(10-fold) dilutions of lymph node or tail DNA were used as a template
for PCR with the following primers: P2,
5'-GACCATTCACCACTGTAGG-3'; and P3,
5'-TGGGAAGAAACAGGAGGAG-3'. This results in a 420-bp amplification
product for recombined loxDd. In
nonrecombined loxDd and non-Tg mice the two
primers are separated by 2.2 kb and no PCR product is detected.
Thy-1-specific PCR was performed as a control: Thy-1, 5' (775–795) CCATCCAGCATGAGTTCAGCC; and Thy-1, 3' (1432–1451) GCATCCAGGATGTGTTCTGA. This results in a 676-bp amplification product.
PCR was performed using 1 µM of each primer and 200 nM dNTPs. After denaturing for 3' at 92°C PCR was performed at 92°C for 1 min, 55°C for 1 min, and 72°C for 1 min for 40 cycles. Comparable data were obtained when a fixed amount of DNA template was analyzed using variable numbers (25, 30, or 35) of PCR cycles. PCR products were run on agarose gel containing ethidium bromide and visualized under UV.
Flow cytometry
For mouse typing, whole blood was stained with FITC-labeled anti-H2 mAbs: H-2Kd (SF1.1.1.1), Dd (34.2.12), and Db (KH95). A PE-labeled mAb (PK136) to the NK1.1 Ag was used to confirm the B6 origin of the NK gene complex (all mAbs were obtained from BD PharMingen, San Diego, CA). Erythrocytes were removed with FACS lysis solution according to the manufacturer’s recommendation (BD Biosciences, San Jose, CA).
Spleen, lymph node, and bone marrow cell suspensions (usually 106 cells) were incubated with 24G2 (anti-CD16/32) hybridoma supernatant to reduce background. Cells were further stained with a mixture of NK1.1-PE, CD3-CyChrome (CD3-Cy), and biotinylated anti-H-2 mAbs. Alternatively, NK1.1-PE and CD3-Cy were used in conjunction with appropriate combinations of FITC-labeled and biotinylated anti-Ly49 mAbs: Ly49A (JR9-318) kindly provided by J. Roland (Institut Pasteur, Paris, France), Ly49C/I (SW5E6), Ly49G2 (4D11), and Ly49D (4E5). All mAbs were purchased from BD PharMingen, except JR9-318, which was labeled in this lab. Biotinylated mAbs were revealed using streptavidin-allophycocyanin (Molecular Probes, Eugene, OR). In general 5 x 104–105 cells were analyzed on a FACSCalibur flow cytometer using CellQuest software (BD Biosciences).
Cytotoxicity assays
NK cell-mediated lysis of lymphoblast targets was done as described in Ref. 22 . Briefly, erythrocyte-depleted spleen cells were passed over a nylon wool column. Nonadherent cells were cultured in complete DMEM plus 500 ng/ml recombinant human IL-2 (a gift from Glaxo Wellcome, Geneva, Switzerland). At day 3 adherent and nonadherent cells were harvested and used as effectors. T cell blasts were obtained by culturing spleen cells (2 x 106 cells/ml) in DMEM plus 2.5 µg/ml Con A (Sigma-Aldrich, Buchs, Switzerland). After 2 days dead cells were removed by Ficoll density gradient centrifugation (Pharmacia Biotech, Uppsala, Sweden). Cells (3 x 106) were labeled with 50 µCi of 51Cr for 1 h at 37°C. After three washes, 5 x 103 labeled target cells were mixed with effector cells in duplicate at various E:T ratios in 96-well U-bottom plates. Supernatants were harvested after 4 h and 51Cr release into the supernatant was determined using a gamma counter. The percentage of NK1.1+CD3- cells in the effector cell population was estimated using flow cytometry.
Detection of intracellular IFN-
Total splenocytes were cultured (10 ml at 2 x
106 cells/ml) in the presence of human IL-2 as
above. After 4 days, nonadherent cells were discarded and adherent
cells (containing normally 30–50% NK cells) were detached
using PBS/EDTA. After washing, 1.5 x 106
cells were plated in a 24-well culture plate in a final volume of 2 ml
in the presence of IL-2. Stimulator cells (2 x
106) were added: C1498
(H-2b, thymoma),
Dd-transfected C1498 (kindly provided by W.
Seaman, University of California, San Francisco, CA). Brefeldin A (10
µg/ml; Sigma-Aldrich) was added 3 h after the onset of cultures.
After overnight culture, the cells were harvested, washed, and
surface-labeled as described above using biotinylated anti-NK1.1
followed by a mixture of CD3-Cy, Ly49A-FITC, and
streptavidin-allophycocyanin to reveal the biotinylated mAb. After two
washes in PBS 5% FCS, cells were fixed and permeabilized according to
the supplier’s instructions (BD PharMingen). The cells were then
stained intracellularly with the PE-conjugated anti-IFN-
(XMG1.2) or an isotype-matched control mAb (BD PharMingen). After
washing, the samples were analyzed using four-color flow cytometry as
above.
Bone marrow graft rejection
Recipient mice were lethally irradiated (960 rad from a
137Cs source) and reconstituted 24 h later
by i.v. inoculation of 106
(H-2b) or 5 x 106
(2m-/-) bone marrow cells. To
deplete NK cells some recipient mice received 100 µg of purified mAb
PK136 i.p. 24 h before irradiation. Five days after irradiation
the mice were injected with 3 µCi of
[125I]UdR (Amersham, Dübendorf,
Switzerland) i.p. Twenty-four hours later the incorporation of
radioactivity into the spleen was measured using a gamma counter.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
An 8-kb EcoRI fragment containing the entire
H-2Dd gene (19) was modified
by introducing two loxP sites into noncoding regions. The DNA sequence,
which is flanked by two loxP sites, is deleted upon the action of the
Cre recombinase. Because the two loxP sites in the
H-2Dd gene flank the promoter region and
the exons that encode the 
1 and 2 domains, de novo expression of
H-2Dd will be prevented following Cre-mediated
recombination (Fig. 1
).
|
The loxP-modified H-2Dd gene was
injected into fertilized (B6 x DBA/2) F2 oocytes to generate Tg
mice. Five Tg lines were initially established by backcrossing to B6
mice. Offspring of H-2b haplotype and with a NK
gene complex of B6 origin were selected as detailed in Materials
and Methods. The different lines expressed
H-2Dd on lymphoid cells at levels slightly below
to twice as high as compared with B10.D2 (H-2d)
mice (data not shown). One Tg line (28) termed hereafter
Dd Tg, that expressed H-2Dd
at levels similar (
80%) to B10.D2 (H-2d)
mice, was analyzed in more detail (Fig. 2A).
|
Short-term (3–4 days) IL-2-activated NK cells from
Dd Tg
(H-2b+Dd+) mice killed
H-2b lymphoblast targets. They did not kill
syngeneic (H-2b+Dd+)
lymphoblast targets, indicating self-tolerance. Moreover, Tg and non-Tg
NK cells killed MHC class I-deficient (due to a disruption of the
2m gene) target cells equally well (Fig. 3A). These results suggest
that Dd-Tg NK cells have adapted to the presence
of the class I Tg and react to its absence in agreement with missing
self-recognition. Thus, the introduction of two loxP sites into
the H-2Dd Tg did not alter the expected
effects of Dd Tg expression on NK cell
reactivity.
|
The presence of two loxP sites in the Dd Tg
offered the opportunity to manipulate H-2Dd
expression in vivo using Cre-Tg mice. Dd-Tg mice
were thus crossed with Mx-Cre-Tg mice. The Mx promoter allows the
induction of Cre expression via an IFN--inducible regulatory
element (20). Second, Dd-Tg mice
were crossed with CMV-CreER-Tg mice, which constitutively express a
fusion protein of Cre recombinase with the ligand binding domain of the
human ER driven by the CMV promoter (21). The activity of
the fusion protein can be induced upon the administration of the
synthetic ligand 4-hydroxytamoxifen.
Without deliberate induction of Cre expression or of its activity we
have assessed H-2Dd expression in double Tg mice
using flow cytometry. Approximately one-third of PBL or lymph node
cells in young adult Dd x Mx-Cre double Tg mice
were completely H-2Dd-negative (Fig. 2
B). A similar fraction of cells expressed
H-2Dd at the same level as
Dd single Tg mice while the remaining cells
expressed intermediate H-2Dd levels. These latter
cells may harbor a partial recombination of the multicopy Tg locus. No
or very little H-2Dd loss (<1% of cells) had
occurred in lymphoid cells of Dd x
CMV-CreER mice.
Recombination of the loxDd Tg was confirmed at
the level of genomic DNA. Lymph node cell-derived DNA was subjected to
PCR amplification using primers specific for the
H-2Dd gene, which are normally separated
by 2.2 kb of intervening sequence (p2–p3, as indicated in Fig. 1).
Following recombination of the H-2Dd gene
these primers were expected to yield an amplification product of 420
bp. Indeed, a PCR product specific for a recombined
Dd Tg was exclusively observed in lymphoid tissue
of Dd x Mx-Cre double Tg but not of
Dd single Tg or Dd x
CMV-CreER double Tg mice (Fig. 4A), consistent with the
cytometric analysis. This assay allowed us to determine whether
Dd recombination has also occurred in nonlymphoid
tissues. Indeed, Dd recombination was observed in
tail DNA of both Dd x Mx-Cre and
Dd x CMV-CreER mice (Fig. 4B). The two
Dd x Cre double Tg mice thus displayed distinct
patterns of H-2Dd expression. Mx-Cre led to
H-2Dd loss on some but not all lymphocytes
(hematopoietic origin) and in tail (nonhematopoietic origin). In
contrast, lymphocytes in Dd x CMV-CreER mice
were homogeneously H-2Dd positive while
Dd recombination was evident in tail. These
findings indicated considerable leakiness of the two Cre induction
systems, yet they clearly established the functionality of the
H-2Dd off switch.
|
The partial loss of H-2Dd expression had no
significant effects on the abundance of NK cells or the representation
of several MHC class I-specific Ly49 receptors (Fig. 2C and
data not shown). The impact of the H-2Dd
expression patterns on NK cell reactivity was tested using bone marrow
graft rejection experiments. Lethally irradiated
Dd x Cre double Tg mice were challenged with
bone marrow cells from H-2b
(Dd-negative) mice. The proliferation of bone
marrow stem cells (indicating acceptance of the graft and thus the
absence of a NK cell reaction against it) was read out by
[125I]UdR incorporation into spleens of
recipient mice. As shown in Fig. 5, Dd
(H-2bDd) single Tg mice
rejected H-2b bone marrow grafts judged by the
low incorporation of [125I]UdR into the
recipients’ spleens. This was not due to the inability of the grafted
cells to expand, as a high [125I]UdR
incorporation was observed in B6 (H-2b) recipient
mice. In contrast to Dd single Tg mice, both
types of Dd x Cre double Tg mice were unable to
reject the H-2b graft (Fig. 5). The extent of
H-2Dd loss in the two types of double Tg mice was
thus sufficient to prevent missing Dd
recognition. The nonreactive state was specific for
H-2b grafts, as all mice rejected MHC class
I-deficient bone marrow grafts. While the data recapitulate those
obtained in another model of H-2Dd mosaic mice
(17), they further establish that
H-2Dd loss from some nonlymphoid cells was
sufficient to abolish missing Dd recognition.
|
We next determined whether H-2Dd
recombination in double Tg mice influenced NK cell reactivity in vitro.
Short-term (3 days) IL-2-activated NK cells from
Dd x Mx-Cre mice were unable to kill
H-2b lymphoblasts (Fig. 3B). MHC class
I-deficient targets were readily killed, consistent with the bone
marrow rejection experiments. However, in contrast to the in vivo data,
NK cells from Dd x CMV-CreER-Tg mice
killed H-2b target cells as efficiently as
NK cells from Dd single Tg mice (Fig. 3B). The in vitro culture may thus enable missing
Dd reactivity perhaps due to an IL-2-dependent
reactivation of silenced NK cells, as suggested before
(23). In addition, the separation from nonlymphoid cells,
some of which lack H-2Dd, may be required to
restore reactivity in vitro. Indeed, missing Dd
reactivity by NK cells from mosaic mice was restored upon the removal
of hematopoietic cells lacking H-2Dd
(17).
Ly49A+ NK cells from Dd x Mx-Cre mice perform missing class I but not missing Dd recognition
Missing Dd recognition by NK cells from
H-2bDd mice is mediated by
the Ly49A+ NK cell subset (12). This
suggested that in Dd x Mx-Cre-Tg mice, the
inability to perform missing Dd reactions was due
to a malfunction of the Ly49A+ NK cell subset.
This further raised the issue of whether these
Ly49A+ cells were completely nonreactive
(anergic) or whether they were selectively nonreactive to cells lacking
Dd. To address these questions we crossed
Dd x Mx-Cre mice to mice expressing a Tg Ly49A
on all their NK cells. Like Dd x Mx-Cre double
Tg (Fig. 3), NK cells from Ly49A x Dd x
Mx-Cre triple Tg mice showed minimal cytotoxic activity to
H-2b lymphoblasts (Fig. 6). However, NK cells from triple Tg mice
efficiently killed 2m-deficient lymphoblasts or YAC-1
target cells (Fig. 6 and data notshown). Ly49A+
NK cells in Dd x Mx-Cre mice are thus not
anergic but rather selectively impaired in their reactivity to cells
lacking Dd.
|
at the single cell level
using intracellular flow cytometry (Fig. 7) (24). A significant
fraction of Ly49A+ NK cells from B6 mice
(25.6 ± 6.0%) produced IFN- following overnight exposure to
the syngeneic (H-2b) tumor cell line C1498 (Table I). Even though values were variable
between experiments, significantly more
Ly49A+ NK cells (36.7 ± 7.3%,
p < 0.02) from Dd-Tg mice
produced IFN- in response to C1498 (Table I). This assay thus
appropriately indicates a contribution of missing
Dd reactivity to IFN- production by
Ly49A+ NK cells from
H-2bDd mice.
Ly49A+ NK cells from Dd x
Mx-Cre mice behaved essentially like those from B6; i.e., a similarly
small fraction (26.0 ± 9.6%) of Ly49A+ NK cells
produced IFN- (Table I). These data are compatible with the above
lysis assays and suggest that Ly49A+ NK cells
from Mx-Cre mice behave similarly to those from B6 mice: they do not
react to missing Dd, yet are able to produce
IFN- in response to C1498 target cells. The exposure to
Dd-transfected C1498 cells reduced the percentage
of IFN--expressing Ly49A Dd x Mx-Cre NK cells
4-fold as compared with C1498 cells (Table I). The capacity of Ly49A
to function as an inhibitory receptor is thus intact in
Dd x Mx-Cre mice. It is interesting to note that
while Ly49A reduced the fraction of IFN--expressing cells in
response to C1498 Dd targets, the mean
fluorescence intensity of IFN- staining in the residual
Ly49A+IFN-+ NK cells was
not significantly lowered (data not shown). Therefore, this single cell
assay suggests that the engagement of the inhibitory Ly49A receptor
affects NK cell effector function in an all-or-none fashion.
IFN- production by Ly49A+ NK cells was
independent from the coexpression of the
Dd-specific activating Ly49D receptor (data not
shown), which is able to initiate IFN- production
(25).
|
|
), which are inhibitory receptors
specific for H-2b MHC class I molecules
(1). Variegated Dd expression thus
impacts specifically the NK cell subset expressing the
Dd-specific inhibitory Ly49A receptor and
prevents selectively missing Dd reactivity.
However, the failure to acquire missing Dd
reactivity is not related to an inability of Ly49A to function as an
inhibitory receptor. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
These novel mouse strains allowed us to study the function of NK cells, which develop and exist in the presence of two types of host cells. Some cells express and others lack the strong Ly49A ligand H-2Dd, whereas all host cells express H-2b class I molecules. The use of two distinct Cre Tgs (Mx- and CMV-Cre) resulted in Dd loss in different compartments. The reactivity of NK cells arising in these situations was compared with NK cells that develop in an environment where all or no cells express H-2Dd, respectively. Our data revealed functional differences among NK cells from the different types of mice. Both Dd mosaic mouse strains failed to reject H-2b bone marrow grafts, similar to mice completely lacking Dd. In contrast to NK cells from Dd x CMV-CreER mice, those from Mx-Cre mice were further unable to kill H-2b lymphoblasts. This prompted us to specifically investigate the NK cell subset expressing the relevant inhibitory MHC receptor Ly49A. We found that Ly49A+ NK cells in mosaic mice were indeed unable to perform missing Dd recognition; however, these cells were not completely unreactive, as MHC class I-deficient targets were readily killed.
Two distinct models may account for our data as well as previous
findings (17). In the first one, the absence of
Dd from some host cells may have a negative
effect and silence NK cell clones that would normally perform missing
Dd recognition. The concept of NK cell silencing
is primarily supported by the observation that missing
Dd reactivity is restored when
Dd-positive NK cells are cultured separately from
Dd-negative hematopoietic (17) or
nonhematopoietic host cells (Fig. 3). However, because these
Ly49A+ NK cells perform missing class I
recognition and are thus not silent, we propose an alternative
interpretation of our observations. The encounter with
Dd-deficient host cells during NK cell
development may not allow complete adaptation to self-MHC class I.
Whereas these NK cells acquire missing H-2b
recognition, they do not acquire proper missing
Dd reactivity. This scenario is in line with a
number of recent observations. Mature NK cells are inhibited in a
cumulative fashion when NK cells express multiple self-specific Ly49
receptors (26, 27). This suggests that self-specific
inhibitory MHC receptors function independently, each contributing to
NK cell inhibition. The acquisition of missing self-reactivity during
NK cell development may thus similarly occur independently, such that
NK cells in a Dd mosaic mouse acquire missing
H-2b reactivity (using
H-2b-specific inhibitory receptors) but fail to
acquire missing Dd reactivity (using Ly49A).
However, the selective failure to acquire missing
Dd reactivity was not due to a defective
inhibitory function of Ly49A (Table I). We have recently provided
evidence that Ly49A-H-2d interaction during NK
cell development has a positive impact on NK cell development
(28). This positive effect was only observed when
H-2d was present on both the radioresistant and
radiosensitive compartments. In addition, the expression of a human
Ig-like killer inhibitory receptor may enhance the survival of memory T
cells in Tg mice (29). These findings are consistent with
the idea that MHC-specific receptors, in addition to the
well-established inhibitory role, may perform additional functions.
Indeed, besides SHP-1, the inhibitory motif in the Ly49A cytoplasmic
tail recruited also SHP-2 (30). The role of SHP-2 is
unclear; however, it seems to be involved preferentially in activating
signaling cascades (31). Finally, killer inhibitory
receptors were shown to recruit phosphatidylinositol 3-kinase and thus
potentially couple to signaling pathways that provide growth and/or
survival signals (32, 33). It is thus possible that
negative and putative positive functions of Ly49A are dissociated in
Dd mosaic mice. Finally, the fact that NK cells
react to missing Dd once they are cultured
separately from Dd-negative host cells could also
be interpreted as a rapid acquisition of missing
Dd reactivity as soon as Ly49A is continuously
engaged by neighboring cells. Although we currently favor the second
hypothesis, additional experiments will be required to discriminate
between the two models.
The acquisition of missing self-reactivity seems to be completely prevented by ligand deficiency in some cells of the radioresistant or the radiosensitive (hematopoietic) compartment (Refs. 7, 17 , and 34 and this study). NK cells in all these mice encountered ligand-deficient host cells throughout the entire body, including the bone marrow, where NK cell adaptation to the MHC class I environment may take place. Therefore, it will be of interest to refine the analysis and to assess the function of NK cells that develop in a homogeneously Dd+ bone marrow yet encounter Dd-deficient host cells in the periphery. That can now be achieved using Tg mice, which express Cre in an organ-specific fashion. It will also be important to determine the minimal number of H-2Dd-deficient host cells required to prevent missing Dd recognition. In this context it has been known for a long time that NK cells have a limited capacity to eliminate grafted tumor cells (104–105 cells) even if these cells lack MHC class I partially or completely (35, 36). The relative inefficiency of NK cells has primarily been attributed to their limited capacity for clonal expansion. The data obtained in mosaic mice thus raise the possibility that the presence of sufficient numbers of class I-deficient tumor cells may at some stage disable NK cell reactions.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Werner Held, Ludwig Institute for Cancer Research, 155 Ch. des Boveresses, 1066 Epalinges, Switzerland. E-mail address: wheld{at}isrec.unil.ch
3 Abbreviations used in this paper: 2m, 2-microglobulin; Tg, transgene/transgenic; loxDd, H-2Dd gene flanked with loxP sites; bc, backcross; ER, estrogen receptor; CD3-Cy, CD3-CyChrome.
Received for publication June 28, 2001. Accepted for publication October 1, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-microglobulin-negative (2m-) T-cell blasts by natural killer cells from normal but not from 2m- mice: nonresponsiveness controlled by 2m- bone marrow in chimeric mice. Proc. Natl. Acad. Sci. USA 88:10332. production and cytotoxicity of IL-2-activated murine NK cells are differentially regulated by MHC class I molecules. J. Immunol. 163:6488. secretion. J. Immunol. 164:603.2-microglobulin transfection to EL-4 mutant cells. J. Exp. Med. 175:843.This article has been cited by other articles:
|
|
 |
|
  T. Grigoryan, P. Wend, A. Klaus, and W. Birchmeier Deciphering the function of canonical Wnt signals in development and disease: conditional loss- and gain-of-function mutations of {beta}-catenin in mice Genes & Dev., September 1, 2008; 22(17): 2308 - 2341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Coudert, L. Scarpellino, F. Gros, E. Vivier, and W. Held Sustained NKG2D engagement induces cross-tolerance of multiple distinct NK cell activation pathways Blood, April 1, 2008; 111(7): 3571 - 3578. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Back, A. Chalifour, L. Scarpellino, and W. Held Stable masking by H-2Dd cis ligand limits Ly49A relocalization to the site of NK cell/target cell contact PNAS, March 6, 2007; 104(10): 3978 - 3983. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Scarpellino, F. Oeschger, P. Guillaume, J. D. Coudert, F. Levy, G. Leclercq, and W. Held Interactions of Ly49 Family Receptors with MHC Class I Ligands in trans and cis J. Immunol., February 1, 2007; 178(3): 1277 - 1284. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. B. Voyle, F. Beermann, R. K. Lees, J. Schumann, J. Zimmer, W. Held, and H. R. MacDonald Ligand-dependent Inhibition of CD1d-restricted NKT Cell Development in Mice Transgenic for the Activating Receptor Ly49D J. Exp. Med., April 7, 2003; 197(7): 919 - 925. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and
H-2bDd (•) or 
). Graphs show mean percentage of specific lysis (±
SD) compiled from four values obtained in two independent experiments.
For 