The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishimaru, N.
Right arrow Articles by Hayashi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishimaru, N.
Right arrow Articles by Hayashi, Y.
The Journal of Immunology, 2001, 167: 6031-6037.
Copyright © 2001 by The American Association of Immunologists

Possible Role of Organ-Specific Autoantigen for Fas Ligand-Mediated Activation-Induced Cell Death in Murine Sjögren’s Syndrome1

Naozumi Ishimaru*, Kumiko Yanagi*, Kouichi Ogawa*, Takashi Suda{dagger}, Ichiro Saito* and Yoshio Hayashi2,*

* Department of Pathology, Tokushima University School of Dentistry, Tokushima, Japan; and {dagger} Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, Ishikawa, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation-induced cell death (AICD) is a well-known mechanism of peripheral T cell tolerance that depends upon an interaction between Fas and Fas ligand (FasL). In this study, we demonstrate that the administration of a soluble form of anti-FasL Ab, FLIM58, results in severe destructive autoimmune exocrinopathy in the murine model of human Sjögren’s syndrome (SS), and we found that an organ-specific autoantigen may play an important role on down-modulation of AICD. A high titer of serum autoantibodies against 120-kDa {alpha}-fodrin autoantigen was detected in the FLIM58-treated mice, and splenic T cell culture supernatants contained high levels of IFN-{gamma}. In vitro T cell apoptosis assay indicated that FasL-mediated AICD is down-regulated by autoantigen stimulation in spleen cells from the murine SS model, but not from Fas-deficient MRL/lpr mice and FasL-deficient MRL/gld mice. FasL undergo metalloproteinase-mediated proteolytic processing in their extracellular domains, resulting in the release of soluble trimeric ligands (soluble FasL). We showed that the processing of soluble FasL occurs in autoantigen-specific CD4+ T cells, and that a significant increase in expressions of metalloproteinase-9 mRNA was observed in spleen cells from SS model mice. These findings indicate that the increased generation of soluble FasL inhibits the normal AICD process, leading to the proliferation of effector CD4+ T cells in the murine SS model.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fas ligand (FasL)3 and its receptor, Fas, are essential in the homeostasis of the peripheral immune system (1, 2, 3, 4, 5). After T cells are activated by responding to antigenic stimuli, they are generally killed by apoptotic mechanisms. Among the apoptotic mechanisms, activation-induced cell death (AICD) plays a central role, especially in killing autoreactive T cells and in preventing autoimmune responses (6, 7, 8). AICD in T cells in vivo has been proposed to limit the expansion of an immune response by eliminating effector cells that are no longer needed (9). It has been recently reported that activation of T cell clones or T cell lines induces FasL expression and that interaction between Fas and its ligand is the major mechanism involved in AICD (10, 11). A defect in AICD of effector T cells may result in the development of autoimmune disease (12, 13), but an in vivo role of organ-specific autoantigen for AICD is still unclear.

Organ-specific autoimmune diseases are characterized by tissue destruction and functional decline due to autoreactive T cells that escape self-tolerance (14, 15). Sjögren’s syndrome (SS) is an autoimmune disorder characterized by lymphocytic infiltrates and tissue damage of the salivary and lacrimal glands, and systemic production of autoantibodies to the ribonucleoprotein particles SS-A/Ro and SS-B/La (16, 17). We have identified a cleavage product of 120-kDa {alpha}-fodrin as an important autoantigen in the pathogenesis of SS in both an animal model and humans (18). Moreover, we have recently demonstrated that anti-Fas mAb-stimulated apoptosis was significantly down-regulated in peripheral CD4+ T cells in the advanced stage of SS lesions, suggesting that there may be a dysregulation of FasL-mediated apoptosis on AICD in the peripheral immune system (19). Although elucidation of the physiological effects of FasL signaling has been facilitated greatly by the identification of the spontaneous mutation of the fas gene in lpr/lpr mice (20, 21, 22, 23) and of the fas ligand gene in gld/gld mice (24), it is uncertain whether organ-specific autoantigen may interfere with FasL-mediated AICD during the development of autoimmune disorders. In contrast, matrix metalloproteinases (MMPs) in immune cells serve numerous specialized immunologic functions in addition to extracellular matrix degradation (25, 26). In in vitro studies, T cells have been shown to produce MMP-9, whereas MMP-2 expression is induced by IL-2 and VCAM-1-dependent adhesion to endothelial cells (27, 28). These MMPs mediate secretion of FasL and TNF-{alpha} by cleavage of their membrane-bound forms (29, 30). Although several recent studies have shown that FasL is efficiently released from the activated T cell surface and that some MMP inhibitors could inhibit the shedding (29, 31), in vivo role of MMPs in FasL-mediated AICD is entirely obscure.

In this study, we investigated the mechanisms involved in the regulation of peripheral tolerance in animal model of human SS by the administration of neutralizing mAb to FasL (FLIM58) (32), and demonstrated evidence that a down-modulation of FasL-mediated AICD is due to the increased generation of soluble FasL (sFasL) as a consequence of an exacerbated MMP expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

Female NFS/N strain carrying the mutant gene sld (33) were reared in our specific pathogen-free mouse colony and given food and water ad libitum. Thymectomy was performed on day 3 after birth (3day-Tx) in NFS/sld mice, because a murine model of primary SS spontaneously develops a disease with many of the characteristics of patients (34). MRL/Mp-lpr/lpr (MRL/lpr) mice, and MRL/Mp-gld/gld (MRL/gld) mice, purchased from Japan SLC (Shizuoka, Japan), were investigated to elucidate the role of autoantigen on Fas/FasL-mediated AICD in the SS model mice. C57BL/6 mice, purchased from Charles River Japan (Atsugi, Japan), and normal NFS/sld mice were used as controls.

In vivo administration of anti-FasL neutralizing Abs

Anti-murine FasL inhibitory mAb, FLIM58, was established from an Armenian hamster immunized with the WR19L mouse lymphoma-expressing recombinant mouse FasL (32). FLIM58 neutralizes mouse but not human FasL activity. FLIM58 (0.5 mg/dose, n = 11) was administered s.c. once every 3 days between wk 3 and wk 7, and then analyzed at 8 wk, and compared with 3day-Tx NFS/sld mice injected with normal hamster serum Ab (n = 8), and PBS alone (n = 7). In addition, autoantibody production against the 120-kDa {alpha}-fodrin in sera was tested in both treated and nontreated murine SS model.

Histology and immunohistology

All organs were removed from the mice, fixed with 4% phosphate-buffered formaldehyde (pH 7.2), and prepared for histologic examination. The sections were stained with H&E. Histological grading of the inflammatory lesions was done according to the method proposed by White and Casarett (35). Immunohistology was performed on freshly frozen sections (4 µm in thickness) by the biotin-avidin immunoperoxidase method using ABC reagent (Vector Laboratories, Burlingame, CA). mAbs used are as follows: biotinylated rat mAbs to CD3 (Life Technologies, Grand Island, NY), B220, CD4, CD8, Mac-1 (BD Biosciences, San Jose, CA), murine Fas (BD PharMingen, San Diego, CA), and murine FasL (BD PharMingen).

Flow cytometric analysis

Surface markers were identified by mAbs with a EPICS flow cytometer (Beckman Coulter, Miami, FL). Rat mAbs to CD3 (Life Technologies), B220, CD4, CD8 (BD Biosciences), murine Fas (Jo2; BD PharMingen), and murine FasL (K-10; BD PharMingen) were used. Double-labeled surface phenotypes such as CD3/B220, CD4/FasL, CD8/FasL were analyzed. Apoptotic cells were also detected by flow cytometry with a EPICS flow cytometer (Beckman Coulter) using the annexin V-FITC Apoptosis Detection kit (Genzyme, Cambridge, MA). For detection of T cell activation makers, spleen cells and regional lymph node cells from FLIM58-treated and nontreated SS model mice were analyzed. Single cell suspensions were stained with Abs conjugated to PE (anti-CD3, Life Technologies; anti-CD4, Cedarlane Laboratories, Hornby, Ontario, Canada; B220, BD PharMingen), and FITC (anti-CD8, Cedarlane Laboratories; Thy1.2, anti-CD44, anti-CD45RB, anti-Mel-14, BD PharMingen), and analyzed with EPICS (Beckman Coulter).

Production of recombinant {alpha}-fodrin

Recombinant {alpha}-fodrin protein, the cDNA encoding human {alpha}-fodrin (JS-1, 1–1784 bp) (18) was constructed by inserting cDNA into EcoRI site of pGEX-2T. GST fusion protein was expressed and purified using a GST gene fusion system (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, U.K.).

Proliferation assay

Single-cell suspensions of spleen cells were cultured in 96-well flat-bottom microtiter plates (5 x 105 cells/well) in RPMI 1640 containing 10% FCS, penicillin/streptomycin, and 2-ME. Cells were cultured with recombinant {alpha}-fodrin protein (JS-1), 2.0 µg/ml Con A (EY Laboratories, San Mateo, CA) for 72 h, and pulsed with 1 µCi/well [3H]thymidine (NEN Life Science Products, Boston, MA) during the final 20 h of the culture. [3H]Thymidine incorporation was evaluated using an automated {beta} liquid scintillation counter.

Western blot analysis

Western blot analysis with mouse mAb to {alpha}-fodrin (AFFINITI, Mamhead, U.K.) was performed. Briefly, the cells were homogenated in 20 mM Tris-HCl buffer (pH 7.4), containing 5 mM diisopropylfluorophosphate, 5 mM EDTA, 5 mM benzamidine, 2 mM PMSF, and 2 mM N-ethylmaleimide. After centrifugation for 20 min at 12,000 rpm at 4°C, supernatant was extracted and used for cytoplasmic protein. Pellets were homogenized in 20 mM Tris-HCl buffer containing 2% Triton X-100. Protein binding was visualized with ECL Western blotting reagent (Amersham, Arlington Heights, IL). To detect serum autoantibodies against 120-kDa {alpha}-fodrin Ag (18), mouse IgG was isolated from serum samples. Samples were solubilized by heating and separated by 10% SDS-PAGE. The autoantigen was electrotransferred to nitrocellulose, which was then quenched with 1% powdered milk in borate-buffered saline. Nitrocellulose membranes were incubated with testing serum at a 1/200 dilution in borate-buffered saline, then incubated with peroxidase-conjugated horse anti-mouse IgG (Vector Laboratories) at a 1/1000 dilution. A soluble form of FasL, sFasL, was examined in autoantigen (JS-1)-, anti-CD3Ab-, and OVA-stimulated splenic T cells on Western blotting using anti-murine FasL Ab (k-10; BD PharMingen). The generation of sFasL was tested by incubation with MMP inhibitor GM1479 (100 nM; Merck, Darmstadt, Germany).

Measurement of fluid secretion

Detection of tear and saliva volume of the SS model of NFS/sld mice was done according to a modified method as described (36).

Measurement of cytokines and MMP-9 production

Cytokine production was tested by two-step sandwich ELISA using a mouse IL-2, IL-4, and IFN-{gamma} kit (Genzyme). In brief, sera were added to microtiter plates precoated with anti-IL-2, IL-4, and IFN-{gamma} capture Ab and incubated overnight at 4°C. After addition of biotinylated detecting Ab and incubation at room temperature for 45 min, avidin-peroxidase was added and incubated at room temperature for 30 min. Plates were washed extensively with 1% Tween in PBS between each step. Finally, ABTS substrate containing H2O2 was added and the colorimetric reaction was read at an absorbance of 450 nm using an automatic microplate reader (Flow Laboratories, McLean, VA). The concentrations of IL-2 (picograms per milliliter), IL-4 (picograms per milliliter), and IFN-{gamma} (units per milliliter) were calculated according to the standard curves produced by various concentrations of recombinant cytokines. MMP-9 production was tested by two-step sandwich ELISA using a human MMP-9 kit (Genzyme).

Measurement of serum autoantibodies

Serum autoantibodies from indicated mice were detected using recombinant {alpha}-fodrin protein (JS-1). After coating with JS-1 protein in 96-well ELISA plate, biotinylated anti-mouse IgG (Vector Laboratories) was added as second Ab. Measurement of JS-1-specific autoantibodies was read by automatic ELISA reader (Flow Laboratories).

Effect of in vitro stimulation with JS-1 autoantigen

To analyze an in vitro T cell deletion system (5), splenic T cells (5 x 105 cells/well) from various strains of mice were stimulated with JS-1 autoantigen (10 µg/ml), anti-CD3 Ab (2C11, 10 µg/ml) and OVA (5 µg/ml) for 24 h, and then incubated with anti-Fas Ab (Jo2, 100 ng/ml) or anti-FasL mAb (10 µg/ml) for 24 h. After washing three times with PBS, cells were cultured with JS-1, CD3, and OVA for 24 h, respectively, and [3H]thymidine incorporation was evaluated.

Detection of MMP mRNAs by RT-PCR

RNA was isolated from the spleen cells by using a reagent (TRIzol; Life Technologies) followed by formaldehyde gel analysis to confirm the integrity and quantity of RNA. Cultured spleen cells (1 x 106 cells/well) were stimulated with autoantigen (JS-1), CD3, or OVA, and analyzed for reverse transcription-polymerase chain reaction (RT-PCR). First-strand cDNA was prepared from 0.5 µg of total RNA using an oligo(dT) primer and reverse transcriptase (Superscript; Life Technologies). For semiquantitative PCR, 1 µl of each first-strand reaction was then amplified with primers specific for MMP-1, MMP-2, MMP-3, MMP-9, and {beta}-actin. The primer sequences were MMP-1: ATGGTGGGGATGCCCATTTT and CAGCATCTACTTTGTTGCC; MMP-2: GAGTTGGCAGTGCAATACCT and GCCATCCTTCTCAAAGTTGT; MMP-3: GAAATGCAGAAGTTCCTCGG and GAGTTCCATAGAGGGACTGA; MMP-9: CCATGAGTCCCTGGCAG and AGTATGTGATGTTATGATG; {beta}-actin: GTGGGCCGCTCTAGGCACCA and CGGTTGGCCTTAGGGTTCAGGGGG. Standard PCR amplification was performed at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min for 30 cycles, which has been determined to be within the linear range of product amplification. After completion of PCR, 20 µl of the reactions were analyzed by agarose gel electrophoresis and ethidium bromide staining to determine the presence or absence of specific transcripts, as well as the levels of transcript relative to the control transcript 18S RNA. Quantitation of band density was performed using image analysis software (Imager 2200; Alpha Innotech, San Leandro, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phenotypic analysis of murine SS lesions

Immunohistochemical analysis revealed that a major proportion of infiltrating mononuclear cells were CD3+ and CD4+ cells, and a small number of cells were CD8+ and B220+ in the salivary and lacrimal glands of the FLIM58-treated and nontreated SS model mice. Mac-1+ mononuclear cells were found, but sporadically within these lesions. Epithelial duct cells express Fas on their cell surface, and the majority of tissue-infiltrating lymphoid cells bear FasL in SS model (data not shown).

Expression of Fas and FasL in spleens

To examine whether the phenotypic changes of peripheral T cell were related to the autoimmune response, Fas and FasL expression in splenic T cells from Tx-NFS/sld and non-Tx controls was analyzed by flow cytometry. A significant increase of CD4+ T cells expressing Fas in the 3day-Tx NFS/sld model mice was found as compared with those in the non-Tx normal mice, while no difference in CD8+ T cells expressing Fas was found (Fig. 1GoA). Moreover, a significant increase in FasL-expressing CD4+ T cells, but not in CD8+ T cells, was found in the murine SS model (Fig. 1GoA). These data indicate that the Fas-FasL system plays an important role in the development of autoimmune lesions in the murine SS model of 3day-Tx NFS/sld strain.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 1. A, Flow cytometric analysis of Fas and FasL expression on splenic CD4+ and CD8+ T cells from 3day-Tx, non-Tx NFS/sld. A significant increase of CD4+ T cells expressing Fas in the 3day-Tx NFS/sld model mice was found as compared with those in the non-Tx normal mice, while no difference in CD8+ T cells expressing Fas was found. A significant increase in FasL-expressing CD4+ T cells, but not in CD8+ T cells, was found in 3day-Tx NFS/sld model mice. B, Autoantigen-specific T cell proliferation in the spleen cells of different ages. The spleen cells in 3day-Tx NFS/sld mice showed a significant increase in autoantigen-specific T cell proliferation, which increased with age, but not in non-Tx control mice (*, p < 0.05; **, p < 0.005). No significant differences were observed in the proliferative response stimulated with Con A and OVA between 3day-Tx and non-Tx NFS/sld mice. Five mice of each age group were analyzed. Data are expressed as counts per minute per culture ± SD in triplicate.

 
Autoantigen-specific T cell proliferation

To address the role of {alpha}-fodrin autoantigen-reactive T cells, we examined the proliferative T cell responses against {alpha}-fodrin autoantigen in the spleen cells of different ages. We found that the spleen cells in 3day-Tx NFS/sld mice showed a significant increase in autoantigen-specific T cell proliferation, which increased with age, but not in non-Tx control mice (Fig. 1GoB). No significant differences were observed in the proliferative response stimulated with Con A and OVA between 3day-Tx and non-Tx NFS/sld mice (Fig. 1GoB).

In vivo administration of anti-FasL neutralizing Ab (FLIM58)

FLIM58 (0.5 mg/dose, n = 11) was administered s.c. once every 3 days from wk 3 to wk 7, and then analyzed at 8 wk and compared with 3day-Tx NFS/sld mice injected with hamster IgG (n = 8), and nontreated SS model (n = 7). Severe destructive inflammatory lesions were frequently observed in the salivary and lacrimal glands of 3day-Tx NFS/sld mice treated with FLIM58 (Fig. 2GoA). Representative histological features in the salivary and lacrimal glands were shown in Fig. 2GoB. Moreover, the average saliva and tear volume of anti-FasL-treated SS animal model was significantly lower than those of the hamster IgG-treated and nontreated group (Fig. 2GoC).



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 2. Effects of in vivo administration of anti-FasL neutralizing Ab in murine SS model. A, Severe destructive inflammatory lesions were observed in the salivary and lacrimal glands of 3day-Tx NFS/sld mice treated with FLIM58 (n = 11; *, p < 0.05; **, p < 0.005). B, Representative histological features showing severe lesions in the salivary and lacrimal glands (original magnification x120). C, The average saliva and tear volume in FLIM58-treated SS model (n = 11) was significantly lower than those of the hamster IgG-treated (n = 8) and nontreated group (n = 7) (*, p < 0.05, **, p < 0.005).

 
Effects on autoantibody production, cytokine profile, and cell proliferation

A higher titer of serum autoantibodies against 120-kDa {alpha}-fodrin was detected in the FLIM58-treated mice as compared with those in the nontreated mice by ELISA (Fig. 3GoA). Splenic T cell culture supernatants from the FLIM58-treated mice contained higher levels of IFN-{gamma}, while no differences were observed in IL-2 and IL-4 production by ELISA (Fig. 3GoB). When we analyzed proliferative response of splenic T cells against autoantigens, Con A and OVA, it was demonstrated that significant increase in blastogenesis of splenic T cells to the autoantigen was detected in the FLIM58-treated SS model mice (Fig. 3GoC).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3. A, A higher titer of serum autoantibodies against {alpha}-fodrin autoantigen (JS-1) was detected in the FLIM58-treated mice as compared with those in the nontreated mice by ELISA (*, p < 0.05). B, Splenic T cell culture supernatants from the FLIM58-treated mice contained significantly high levels of IFN-{gamma}, while no differences were observed in IL-2 and IL-4 production by ELISA (*, p < 0.05). C, A significant increase in blastogenesis of splenic T cells to the JS-1 autoantigen, but not Con A and OVA, was detected in the FLIM58-treated SS model mice (**, p < 0.05). Five mice in the same group were analyzed.

 
Effect on FasL-mediated AICD

We analyzed the cell number of splenic T cells expressing CD4+ and CD8+ from the FLIM58-treated, nontreated, and non-Tx NFS/sld mice. A significantly increased number of splenic CD4+ T cells was observed in FLIM58-treated mice, but not in the number of splenic CD8+ T cells (Fig. 4GoA). We next investigated FasL-mediated apoptosis in freshly isolated splenic CD4+ T cells in vitro from the FLIM58-treated and nontreated mice. Anti-Fas mAb (Jo2)-stimulated apoptosis was significantly increased in CD4+ T cells, but not in CD8+ T cells, in FLIM58-treated mice compared with those in the nontreated mice (Fig. 4GoB), suggesting that there appears to be an down-modulation of AICD in the FLIM58-treated SS model mice. When spleen cells from various strains were stimulated with {alpha}-fodrin (JS-1) for 24 h in vitro, it was demonstrated that CD4+ T cells, but not CD8+ T cells, express a high proportion of Fas, while not in Fas-deficient MRL/lpr, FasL-deficient MRL/gld, and normal C57BL/6 mice (Fig. 5Go). In contrast, no significant proportion of CD4+ T cells expresses FasL in various strains of mice examined (Fig. 5Go). These results indicate that a large number of CD4+Fas+ T cells is present in the periphery of the murine SS model, while not in Fas-deficient MRL/lpr and FasL-deficient MRL/gld mice.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. A, The surface phenotype in splenic T cells expressing CD4+ and CD8+ in FLIM58-treated, nontreated, and non-Tx mice. A significantly increased number of splenic CD4+ T cells was observed in FLIM58-treated mice, but not in the number of CD8+ T cells, compared with nontreated mice (*, p < 0.05). Five mice in the same group were analyzed. B, Anti-Fas mAb-stimulated apoptosis was significantly increased in CD4+ T cells, but not in CD8+ T cells, in FLIM58-treated mice (n = 5) compared with those in the nontreated mice (n = 5) (*, p < 0.05).

 


View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 5. Flow cytometric analysis demonstrating that splenic CD4+ T cells, but not CD8+ T cells, express a high proportion of Fas molecule in 3day-Tx NFS/sld mice, while not in Fas-deficient MRL/lpr, FasL-deficient MRL/gld, C57BL/6, and non-Tx NFS/sld normal mice (**, p < 0.005). No significant proportion of CD4+FasL+ and CD8+FasL+ T cells was observed. After spleen cells from various strains were stimulated with {alpha}-fodrin (JS-1) for 24 h in vitro, Fas or FasL expressions on T cell subsets were analyzed. Five mice in the same group were examined.

 
Role of autoantigen in FasL-mediated AICD

To compare the proliferative responses against JS-1, CD3, and OVA, we examined in vitro T cell apoptosis assay (5) using spleen cells from SS model, non-Tx NFS/sld, MRL/lpr, MRL/gld, and normal C57BL/6 mice. A significant proliferative response against JS-1 autoantigen was observed in anti-FasL mAb-treated spleen cells exclusively from SS model mice, but not from other strain of mice (Fig. 6Go), suggesting that an organ-specific autoantigen may play an important role on FasL-mediated AICD in SS model mice.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 6. Comparison with the proliferative responses against {alpha}-fodrin autoantigen (JS-1), anti-CD3 Ab, and OVA using spleen cells from SS model, non-Tx NFS/sld, MRL/lpr, and MRL/gld, and normal C57BL/6 mice. A, A significant proliferative response against JS-1 autoantigen was observed in anti-FasL-treated spleen cells exclusively from SS model mice, but not from other strains of mice. No significant proliferative responses against anti-CD3 Ab (B) and OVA (C) were observed in spleen cells from various strains of mice examined. Five mice in the same group were analyzed.

 
Detection of sFasL and expression of MMP-9

It has been shown that membrane FasL is cleaved into a 26-kDa soluble form by a metalloprotease (29, 30). We detected a 26-kDa soluble form of FasL, sFasL, exclusively in JS-1-stimulated splenic T cells on Western blotting (Fig. 7GoA). The level of sFasL production by stimulation with anti-CD3 mAb is negligible compared with that of JS-1 stimulation. The generation of sFasL was blocked by incubation with MMP inhibitor GM1479 (100 nM). RT-PCR was used to determine the message levels of MMP-1, MMP-2, MMP-3, and MMP-9 in experimental animals relative to control samples. The mRNA for MMP-9 increased significantly from JS-1-stimulated splenic T cells, but not in controls (Fig. 7GoB). Moreover, a significantly increased concentration of MMP-9 was detected in culture supernatant from JS-1-stimulated splenic T cells activated with anti-CD3 mAb from the murine SS model than was detected from anti-CD3 mAb-stimulation alone (Fig. 7GoC).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 7. Detection of sFasL and MMP-9. A, A 26-kDa soluble form of FasL exclusively was detected in autoantigen (JS-1)-stimulated splenic T cells, but not in anti-CD3 Ab- and OVA-stimulated cells on Western blotting. A soluble form of FasL was blocked by incubation with MMP inhibitor GM1479. B, The mRNA for MMP-9 increased significantly from JS-1-stimulated splenic T cells, but not in controls by RT-PCR analysis. C, A significantly higher concentration of MMP-9 was detected in culture supernatant from JS-1-stimulated splenic T cells activated with anti-CD3 mAb from murine SS model, than was detected from anti-CD3 mAb-stimulation alone (*, p < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fas/FasL interaction down-regulates the immune response by inducing apoptosis, as activated lymphocytes express both Fas and FasL (10, 11). The fact that dysregulation of the Fas system leads to uncontrolled lymphoproliferation and severe autoimmune disorders (21, 22, 23, 24) means that the Fas/FasL system plays a central role in the control of immune reactions via AICD in physiological and pathological conditions (37, 38, 39). However, it is unclear whether organ-specific autoantigen may interfere with FasL-mediated AICD during the development of autoimmune disorders in vivo.

The discovery that Ag can delete Ag-reactive mature T cells through the induction of AICD has raised great interest in the potential clinical application of this approach in the treatment of certain autoimmune diseases. A widely studied model of T cell-mediated autoimmune disease is experimental autoimmune encephalomyelitis (EAE). During the spontaneous recovery from EAE, Ag-specific down-regulation of myelin basic protein-reactive T cells occurs, due to the selective apoptotic elimination of autoreactive T cells from the target organ (40, 41). Recently, we have shown an increased cleavage product of organ-specific autoantigen, and a significant increase in serum autoantibody production in association with disease severity in the murine SS model (19). It is possible that dysregulation of FasL-mediated AICD plays a major role in acceleration of organ-specific autoimmune lesions in the murine SS model. Thus, it was speculated that in vivo administration with anti-FasL Ab into SS mouse model may prevent the development of autoimmune lesions. However, to our surprise, severe destructive autoimmune lesions developed in the salivary and lacrimal glands of SS model mice administered with anti-FasL Ab in vivo. When we compared anti-Fas-induced apoptosis in T cell subsets, we found that CD4+ T cells from the SS model mice treated with anti-FasL Ab are susceptible to Fas-induced apoptosis. In vitro FasL-mediated AICD assay demonstrated that CD4+ T cells from the SS model mice are indeed sensitive to Fas-induced apoptosis, while those from Fas-deficient MRL/lpr and FasL-deficient MRL/gld mice are not. These results suggest that a down-modulation of FasL-mediated AICD may occur in the CD4+ T cells of SS model mice. CD4+ T cells are susceptible to AICD induced through TCR-mediated recognition of allogeneic MHC class II molecules (42, 43). In addition, AICD is triggered in CD4+ T cells by the specific antigenic peptide, e.g., tetanus toxoid or myelin basic protein, presented by the appropriate MHC class II molecules (44, 45, 46), supporting the notion that AICD can be triggered in activated cells through the TCR-mediated recognition of Ag. Our data in the present study showed that AICD through FasL-mediated apoptosis is a crucial process that regulates the autoantigen-dependent primary T cell response. AICD triggered in transformed T cells and T cell hybridomas by stimulation of the CD3/TCR complex is mediated via the induction of FasL expression and subsequent interaction of FasL with the Fas Ag (3, 4, 5). The maintenance of peripheral tolerance is a multistep process that may involve functional "anergy" down-modulation of cell surface TCR expression (47, 48). Stimulation of activated T cells up-regulates the expression of the FasL, and the interaction of FasL with the corresponding Fas receptor triggers an apoptosis program that culminates in cellular suicide usually associated with the fragmentation of DNA into oligonucleosomal bands (Fig. 8Go).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 8. Diagram of FasL-mediated AICD in the periphery. AICD results from the interaction between Fas and FasL, and activated T cells expressing both Fas and FasL are usually killed either by themselves or by interacting with each other. A defect in AICD may result in the development of autoimmune diseases. The anti-FasL-treatment exacerbated the autoimmunity through autoantigen-induced activation of MMPs, suggesting a predominant role for sFasL in the elimination of autoreactive T cells.

 
The exact role and scope of MMPs in T cell function in vivo are unlear and remain to be determined. Most MMPs have the capacity to degrade extracellular matrix and basement membrane proteins, while some of them have also been shown to mediate the proteolytic processing of other immune system regulatory molecules. In an in vitro assay, MMP-1, MMP-3, and MMP-7 were able to cleave a GST-TNF-{alpha} fusion protein to a 17-kDa protein that contains the same amino terminus as the mature form of TNF-{alpha} (31). MMP-2 and MMP-9 also mediate this cleavage, but with less efficiency. The release of FasL from human CD4+ T cells or mouse T lymphoma cell lines stably transfected with human FasL cDNA was inhibited by MMP inhibitors, but not by inhibitors of other proteases, suggesting that MMPs play a significant role in FasL release (30). In the present study, we detected a 26-kDa sFasL and an exacerbation of MMP-9 expression exclusively in autoantigen-stimulated splenic T cells from the murine SS model. These results are suggestive of the reduced proapoptotic activity of sFasL on activated T cells, as compared with the membrane-bound form in the periphery (49, 50, 51). Although the sFasL is shown to have a crucial role in AICD of peripheral T cells, it remains unclear how sFasL would correlate with autoimmune response in vivo.

Taken together, our data demonstrate evidences that in the SS murine model there is an increased generation of sFasL as a consequence of an exacerbated MMP-9 expression in effector cells upon specific activation with organ-specific autoantigen. Thus, it is feasible that sFasL could be used as a therapeutic agent for a variety of autoimmune disorders in which T cells are the major effector cells, such as autoimmune diabetes, EAE, and SS.


    Footnotes
 
1 This work was supported in part by a Grant-in-Aid for Scientific Research (Nos. 12307040 and 12557022) from the Ministry of Education, Science and Culture of Japan. Back

2 Address correspondence and reprint requests to Dr. Yoshio Hayashi, Department of Pathology, Tokushima University School of Dentistry, 3 Kuramotocho, Tokushima 770, Japan. E-mail address: hayashi{at}dent.tokushima-u.ac.jp Back

3 Abbreviations used in this paper: FasL, Fas ligand; sFasL, soluble FasL; AICD, activation-induced cell death; SS, Sjögren’s syndrome; MMP, matrix metalloproteinase; EAE, experimental autoimmune encephalomyelitis; MRL/lpr, MRL/Mp-lpr/lpr; MRL/gld, MRL/Mp-gld/gld. Back

Received for publication May 14, 2001. Accepted for publication September 10, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Suda, T., T. Takahashi, P. Golstein, S. Nagata. 1993. Molecular cloning and expression of the Fas ligand: a novel member of the tumor necrosis factor family. Cell 75:1169.[Medline]
  2. Nagata, S., P. Golstein. 1995. The Fas death factor. Science 267:1449.[Abstract/Free Full Text]
  3. Dhein, J., H. Walczak, C. Baumler, K.-M. Debatin, P. H. Krammer. 1995. Autocrine T cell suicide mediated by Apo-1/(Fas/CD95). Nature 373:438.[Medline]
  4. Brunner, T., R. J. Mogil, D. LaFace, N. J. Yoo, A. Mahboubi, F. Echeverri, S. J. Martin, W. R. Force, D. H. Lynch, C. F. Ware, D. R. Green. 1995. Cell-autonomous Fas(CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature 373:441.[Medline]
  5. Ju, S.-T., D. J. Panka, H. Cui, R. Ettinger, M. El-Khatib, D. H. Sherr, B. Z. Stanger, A. Marshak-Rothstein. 1995. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature 373:444.[Medline]
  6. Critchfield, J. M., M. K. Racke, J. C. Zuniga-Pflucker, B. Cannella, C. S. Raine, J. Goverman, M. J. Lenardo. 1994. T cell deletion in high antigen dose therapy of autoimmune encephalomyelitis. Science 263:1139.[Abstract/Free Full Text]
  7. Chen, Y., J.-I. Inobe, R. Marks, P. Gonnella, V. K. Kuchroo, H. L. Weiner. 1995. Peripheral deletion of antigen-reactive T cells in oral tolerance. Nature 376:1277.
  8. Thompson, C. B.. 1995. Apoptosis in the pathogenesis and treatment of disease. Science 267:1456.[Abstract/Free Full Text]
  9. Webb, S., C. Morris, J. Sprent. 1990. Extrathymic tolerance of mature T cells: clonal elimination as a consequence of immunity. Cell 63:1249.[Medline]
  10. Nagata, S., T. Suda. 1995. Fas and Fas ligand: lpr and gld mutations. Immunol. Today 16:39.[Medline]
  11. Van Parijs, L., A. Ibraghimov., A. K. Abbas. 1996. The roles of costimulation and Fas in T cell apoptosis and peripheral tolerance. Immunity 4:321.[Medline]
  12. Drappa, J., N. Brot., K. B. Elkon. 1993. The Fas protein is expressed at high levels on CD4+CD8+ thymocytes and activated mature lymphocytes in normal mice but not in the lupus-prone strain, MRL lpr/lpr. Proc. Natl. Acad. Sci. USA 90:10340.[Abstract/Free Full Text]
  13. Russell, J. H., B. Rush, C. Weaver, R. Wang. 1993. Mature T cells of autoimmune lpr/lpr mice have a defect in antigen-stimulated suicide. Proc. Natl. Acad. Sci. USA 90:4409.[Abstract/Free Full Text]
  14. Gianani, R., N. Satventnick. 1989. Virus, cytokine, antigens, and autoimmunity. Proc. Natl. Acad. Sci. USA 93:2252.
  15. Feldmann, M., F. M. Bennan, R. N. Maini. 1996. Rheumatoid arthritis. Cell 85:307.[Medline]
  16. Chan, E. K., J. C. Hamel, J. P. Buyon, E. T. Tan. 1991. Molecular definition and sequence motifs of the 52-kD component of human SS-A/Ro autoantigen. J. Clin. Invest. 87:68.
  17. Kruize, A. A., R. J. T. Smeenk, L. Kater. 1995. Diagnostic criteria and immunopathogenesis of Sjögren’s syndrome: implications for therapy. Immunol. Today 16:557.[Medline]
  18. Haneji, N., T. Nakamura, K. Takio, K. Yanagi, H. Higashiyama, I. Saito, S. Noji, H. Sugino, Y. Hayashi. 1997. Identification of {alpha} fodrin as a candidate autoantigen in primary Sjögren’s syndrome. Science 276:604.[Abstract/Free Full Text]
  19. Ishimaru, N., T. Yoneda, K. Saegusa, K. Yanagi, N. Haneji, K. Moriyama, I. Saito, Y. Hayashi. 2000. Severe destructive autoimmune lesions with aging in murine Sjögren’s syndrome through Fas-mediated apoptosis. Am. J. Pathol. 156:1557.[Abstract/Free Full Text]
  20. Watanabe Fukunaga, R., C. I. Brannan, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356:314.[Medline]
  21. Wu, J., T. Zhou, J. He, J. D. Mountz. 1993. Murine autoimmune disease due to integration of an endogenous retrovirus in an apoptosis gene. J. Exp. Med. 178:461.[Abstract/Free Full Text]
  22. Adachi, M., R. Watanabe Fukunaga, S. Nagata. 1993. Aberrant transcription caused by the insertion of an early transposable element in an intron of the Fas antigen gene of lpr mice. Proc. Natl. Acad. Sci. USA 90:1756.[Abstract/Free Full Text]
  23. Chu, J. L., J. Drappa, A. P. Parnassa, K. B. Elkon. 1993. The defect in Fas mRNA expression in MRL/lpr mice is associated with insertion of the retro-transposon, ETn. J. Exp. Med. 178:723.[Abstract/Free Full Text]
  24. Takahashi, T., M. Tanaka, C. I. Brannan, N. A. Jenkins, N. G. Copeland, T. Suda. 1994. Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand. Cell 76:969.[Medline]
  25. Goetzl, E. J., M. J. Banda, D. Leppert. 1996. Matrix metalloproteinases in immunity. J. Immunol. 156:1.[Abstract]
  26. Mariani, S. M., B. Matiba, C. Baumler, P. H. Krammer. 1995. Regulation of cell surface APO-1/Fas(CD95) ligand expression by metalloproteases. Eur. J. Immunol. 25:2302.
  27. Leppert, D., E. Waubant, R. Galardy, N. W. Bunnett, S. L. Hauser. 1995. T cell gelatinases mediate basement membrane transmigration in vitro. J. Immunol. 154:4379.[Abstract]
  28. Romanic, A. M., J. A. Madri. 1994. The induction of 72-kD gelatinase in T cells upon adhesion to endothelial cells is VCAM-1 dependent. J. Cell Biol. 125:1165.[Abstract/Free Full Text]
  29. Kayagaki, N., A. Kawasaki, T. Ebata, H. Ohmoto, S. Ikeda, S. Inoue, K. Yoshino, K. Okumura, H. Yagita. 1995. Metalloproteinase-mediated release of human Fas ligand. J. Exp. Med. 182:1777.[Abstract/Free Full Text]
  30. Gearing, A. J., P. Beckett, M. Christodoulou, M. Churchill, J. Clements, A. H. Davidson, A. H. Drummond, W. A. Galloway, R. Gilbert, J. L. Gordon, et al 1994. Processing of tumor necrosis factor-{alpha} precursor by metalloproteinases. Nature 370:555.[Medline]
  31. Hattori, K., T. Hirano, C. Ushiyama, H. Miyajima, N. Yamakawa, T. Ebata, Y. Wada, S. Ikeda, K. Yoshino, M. Tateno, et al 1997. A metalloproteinase inhibitor prevents lethal acute graft-versus-host disease in mice. Blood. 90:542.[Abstract/Free Full Text]
  32. Miwa, K., H. Hashimoto, T. Yatomi, N. Nakamura, S. Nagata, T. Suda. 1999. Therapeutic effect of an anti-Fas ligand mAb on lethal graft-versus-host disease. Int. Immunol. 11:925.[Abstract/Free Full Text]
  33. Hayashi, Y., A. Kojima, M. Hata, K. Hirokawa. 1988. A new mutation involving the sublingual gland in NFS/N mice: partially arrested mucous cell differentiation. Am. J. Pathol. 132:187.[Abstract]
  34. Haneji, N., H. Hamano, K. Yanagi, Y. Hayashi. 1994. A new animal model for primary Sjögren’s syndrome in NFS/sld mutant mice. J. Immunol. 153:2769.[Abstract]
  35. White, S. C., G. W. Casarett. 1974. Induction of experimental autoallergic sialadenitis. J. Immunol. 112:178.[Abstract/Free Full Text]
  36. Saito, I., K. Haruta, M. Shimuta, H. Inoue, H. Sakurai, K. Yamada, N. Ishimaru, H. Higashiyama, T. Sumida, H. Ishida, et al 1999. Fas ligand-mediated exocrinopathy resembling Sjögren’s syndrome in mice transgenic for IL-10. J. Immunol. 162:2488.[Abstract/Free Full Text]
  37. Chu, J. L., P. Ramos, A. Rosendonf, J. Nikolic-Zugic, E. Lacy, A. Matsuzawa, K. B. Elkon. 1995. Massive upregulation of the Fas ligand in lpr and gld mice: implications for Fas regulation and the graft-versus-host disease-like wasting syndrome. J. Exp. Med. 181:393.[Abstract/Free Full Text]
  38. Chervonsky, A. V., Y. Wang, F. S. Wong, I. Visintin, R. A. Flavell, C. A. Janeway, L. A. Matis. 1997. The role of Fas in autoimmune diabetes. Cell 89:17.[Medline]
  39. Itoh, N., A. Imagawa, T. Hanafusa, M. Waguri, K. Yamamoto, H. Iwahashi, M. Moriwaki, H. Nakajima, M. Miyagawa, M. Namba, et al 1997. Requirement of Fas for the development of autoimmune diabetes in nonobese diabetic mice. J. Exp. Med. 186:613.[Abstract/Free Full Text]
  40. Tabi, Z., P. A. McCombwe, M. P. Pender. 1994. Apoptotic elimination of V{beta}8.2+ cells from the central nervous system during recovery from experimental autoimmune encephalomyelitis induced by the passive transfer of V{beta}8.2+ encephalitogenic T cells. Eur. J. Immunol. 24:2609.[Medline]
  41. Tabi, Z., P. A. McCombe, M. P. Pender. 1995. Antigen-specific down-regulation of myelin basic protein-reactive T cells during spontaneous recovery from experimental autoimmune encephalomyelitis: further evidence of apoptotic deletion of autoreactive T cells in the central nervous system. Int. Immunol. 7:967.[Abstract/Free Full Text]
  42. Kabelitz, D., H.-H. Oberg, T. Pohl, K. Pechhold. 1994. Antigen- induced death of mature T lymphocytes: analysis by flow cytometry. Immunol. Rev. 142:157.[Medline]
  43. Damle, N. K., K. Klussman, G. Leytze, A. Aruffo, P. S. Linsley, J. A. Ledbetter. 1993. Costimulation with integrin ligands intercellular adhesion molecule-1 or VCAM-1 augments activation-induced death of antigen-specific CD4+ T lymphocytes. J. Immunol. 151:2368.[Abstract]
  44. Bettens, F., E. Frei, K. Frutig, D. Mauri, W. J. Pichler, T. Wyss- Coray. 1995. Noncytotoxic human CD4+ T-cell clones presenting and simultaneously responding to an antigen die of apoptosis. Cell. Immunol. 161:72.[Medline]
  45. Pelfrey, C. M., L. R. Tranquill, S. A. Boehme, H. F. McFarland, M. J. Lenardo. 1995. Two mechanisms of antigen-specific apoptosis of myelin basic protein-specific T lymphocytes derived from multiple sclerosis patients and normal individuals. J. Immunol. 154:6191.[Abstract]
  46. Nag, B., T. Kendrick, S. Arimilli, S. C. T. Yu, S. Sriram. 1996. Soluble MHC II-peptide complexes induce antigen-specific apoptosis in T cells. Cell. Immunol. 170:25.[Medline]
  47. O’Hehir, R. E., J. R. Lamb. 1990. Induction of specific clonal anergy in human T lymphocytes by Staphylococcus aureus enterotoxins. Proc. Natl. Acad. Sci. USA 87:8884.[Abstract/Free Full Text]
  48. Falb, D., T. J. Briner, G. H. Sunshine, C. R. Bourque, M. Luqman, M. L. Gefter, T. Kamradt. 1996. Peripheral tolerance in T cell receptor-transgenic mice: evidence for T cell anergy. Eur. J. Immunol. 26:130.[Medline]
  49. Suda, T., H. Hashimoto, M. Tanaka, T. Ochi, T., and S. Nagata. 1997. Membrane Fas ligand kills human peripheral blood T lymphocytes, and soluble Fas ligand blocks the killing. J. Exp. Med. 186:2045.
  50. Schneider, P., N. Holler, J. L. Bodmer, M. Hahne, K. Frei, A. Fontana, J. Tschopp. 1997. Conversion of membrane-bound Fas(CD95) ligand to its soluble form is associated with downregulation of its proapoptotic activity and loss of liver toxicity. J. Exp. Med. 187:1205.[Abstract/Free Full Text]
  51. Tanaka, M., T. Itai, M. Adachi, S. Nagata. 1998. Downregulation of Fas ligand by shedding. Nat. Med. 4:31.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
T. Izawa, N. Ishimaru, K. Moriyama, M. Kohashi, R. Arakaki, and Y. Hayashi
Crosstalk between RANKL and Fas signaling in dendritic cells controls immune tolerance
Blood, July 1, 2007; 110(1): 242 - 250.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
G. Gannot, M. A. Tangrea, J. W. Gillespie, H. S. Erickson, B. S. Wallis, R. A. Leakan, V. Knezevic, D. P. Hartmann, R. F. Chuaqui, and M. R. Emmert-Buck
Layered Peptide Arrays: High-Throughput Antibody Screening of Clinical Samples
J. Mol. Diagn., October 1, 2005; 7(4): 427 - 436.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Miyazaki, N. Takeda, N. Ishimaru, F. Omotehara, R. Arakaki, and Y. Hayashi
Analysis of in Vivo Role of {alpha}-Fodrin Autoantigen in Primary Sjogren's Syndrome
Am. J. Pathol., October 1, 2005; 167(4): 1051 - 1059.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishimaru, N.
Right arrow Articles by Hayashi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishimaru, N.
Right arrow Articles by Hayashi, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS