The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busch, L. K.
Right arrow Articles by Bishop, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Busch, L. K.
Right arrow Articles by Bishop, G. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2001, 167: 5805-5813.
Copyright © 2001 by The American Association of Immunologists

Multiple Carboxyl-Terminal Regions of the EBV Oncoprotein, Latent Membrane Protein 1, Cooperatively Regulate Signaling to B Lymphocytes Via TNF Receptor-Associated Factor (TRAF)-Dependent and TRAF-Independent Mechanisms1

Lisa K. Busch* and Gail A. Bishop2,*,{dagger},{ddagger},§

* Molecular Biology Graduate Program and Departments of {dagger} Microbiology and {ddagger} Internal Medicine, University of Iowa, Iowa City, IA 52242; and § Veterans Affairs Medical Center, Iowa City, IA 52242


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Latent membrane protein 1 (LMP1) is an EBV-encoded transforming protein that strongly mimics the B cell-activating properties of a normal cellular membrane protein, CD40. LMP1 and CD40 both associate with the cytoplasmic adapter proteins called TNFR-associated factors (TRAFs). TRAFs 1, 2, and 3 bind to a region of LMP1 that is essential for EBV to transform B lymphocytes, carboxyl-terminal activating region (CTAR) 1. However, studies of transiently overexpressed LMP1 molecules, primarily in epithelial cells, indicated that a second region, CTAR2, is largely responsible for LMP1-mediated activation of NF-{kappa}B and c-Jun N-terminal kinase. To better understand LMP1 signaling in B lymphocytes, we performed a structure-function analysis of the LMP1 C-terminal cytoplasmic domain stably expressed in B cell lines. Our results demonstrate that LMP1-stimulated Ig production, surface molecule up-regulation, and NF-{kappa}B and c-Jun N-terminal kinase activation require both CTAR1 and CTAR2, and that these two regions may interact to mediate LMP1 signaling. Furthermore, we find that the function of CTAR1, but not CTAR2, correlates with TRAF binding and present evidence that as yet unidentified cytoplasmic proteins may associate with LMP1 to mediate some of its signaling activities.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epstein Barr virus is a pleiotropic human herpesvirus that infects >90% of the world population. Primary infection with EBV can be asymptomatic or can result in infectious mononucleosis (reviewed in Ref. 1), but in either case the individual will harbor latently infected B cells (2) for life. Although the majority of EBV-infected individuals will experience no effects from the latent viral infection, EBV has been associated with several human malignancies, most notably, endemic Burkitt’s Lymphoma, nasopharyngeal carcinoma in Southeast Asia, and immunoblastic B cell lymphoma in immunocompromised individuals (reviewed in Ref. 3).

During in vitro infection, EBV transforms primary human B lymphocytes from peripheral blood (4) into semiactivated lymphoblastoid cell lines (LCL),3 while in vivo the virus persistently infects memory B cells (5). EBV encodes >85 genes, but only 9 viral proteins are produced in LCL (reviewed in Refs. 6, 7). Of these nine, only Epstein-Barr nuclear Ags, 1, 2, 3A, and 3C, and latent membrane protein 1 (LMP1) are required for EBV-mediated B cell transformation (8, 9, 10). Not only is LMP1 required for B cell transformation by EBV, it is also the only EBV protein demonstrated to be directly oncogenic in rodent fibroblast cell lines (11, 12). However, although LMP1 is expressed in the majority of EBV-associated malignancies, LMP1 expression alone is not sufficient to transform primary human B cells (13).

The LMP1 protein consists of a short amino-terminal cytoplasmic domain, six transmembrane domains, and a 200-aa carboxyl-terminal (CT) domain (14). Although the protein lacks any recognizable enzymatic motifs, LMP1 expression is sufficient to activate B lymphocytes in culture, leading to increased surface expression of activation Ags and adhesion molecules (15), and activation of NF-{kappa}B (16, 17) and c-Jun N-terminal kinase (JNK) (18, 19). More recent work has demonstrated that aggregation of the LMP1 CT is required and sufficient to induce LMP1 signaling (20, 21, 22). The multitransmembrane domain LMP1 self-aggregates in the plasma membrane (15) and, as a result, has constitutive signaling activity (20). LMP1 mimics CD40 signaling in B cells (22, 23), although important differences in LMP1 vs CD40 signaling in B cells and other cell types have been noted (24, 25).

Two regions have been identified as important in LMP1 signaling, CT-activating region (CTAR) 1, aa 194–232, and CTAR2, aa 351–386 (26). The LMP1 CT has been shown to bind to several intracellular adapter proteins. TNFR-associated factors (TRAFs) 1, 2, 3, and 5 bind via the PXQXT motif in CTAR1 (27, 28), the TNFR-associated death domain protein (TRADD) binds via CTAR2 (29), and the Janus kinase 3 binds via a box 1 motif now called CTAR3 (30). For LCL formation, CTAR1 is required, CTAR2 contributes, and CTAR3 is dispensable in LCL formation (31, 32, 33). Although both CTAR1 and CTAR2 play roles in NF-{kappa}B activation, CTAR2 is a stronger activator of the transcription factor (34, 35) and is solely responsible for JNK activation (19). However, it is not clear that all of the aforementioned structure-function requirements apply to LMP1 signaling in B cells, as the majority of the studies cited obtained data using transiently overexpressed LMP1 in epithelial cell lines.

In this study, we examine the ability of LMP1 CT mutants to signal in stably transfected B cell lines. Investigating LMP1 signaling in B lymphocytes is critical because B cells are the ultimate target of EBV infection in vivo. The mutations of the LMP1 CT were designed to determine CTAR function and were generated within the context of human (h) CD40LMP1 chimeric molecules (25) to allow control of the initiation of LMP1 signaling. Using this approach, we found that CTAR1 and CTAR2 play equally important roles in LMP1-induced B cell NF-{kappa}B and JNK activation as well as in up-regulation of CD80 and stimulation of Ig secretion. Furthermore, CTAR1 and CTAR2 can functionally cooperate in signaling. Mutations that disrupt the function of CTAR1 also disrupt TRAF binding. However, the mutations that disrupted CTAR2 function could not be correlated with the ability to bind any known cellular proteins, indicating that LMP1 signaling to B cells is additionally mediated through one or more as yet unidentified factors.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells

M12.4.1 and CH12.LX are mouse B lymphoma cell lines, which have been described previously (36, 37), and were cultured in RPMI 1640 supplemented with 10% FCS, 10 µM 2-ME, and antibiotics (B cell medium with 10% FCS (BCM-10)). Cell lines were stably transfected with hCD40LMP1 constructs, as described elsewhere (38), and were maintained in 400 µg/ml geneticin (Life Technologies, Grand Island, NY) in BCM-10. Transcomplementation mutants were maintained in BCM-10 with 400 µg/ml geneticin and 600 µg/ml hygromycin B (Calbiochem, La Jolla, CA). Chinese hamster ovary (CHO-KI) cells, obtained from the American Type Culture Collection (Manassas, VA), were cultured in DMEM (high glucose) supplemented with 10% FCS, 1x MEM nonessential amino acids (Sigma, St. Louis MO), 10 µM 2-ME, and antibiotics (DMEM-10). CHO cells expressing human CD154 (CHO.hCD154) were kindly provided by Dr. A. Black (IDEC Pharmaceuticals, San Diego, CA) and were maintained in DMEM-10 supplemented with 50 nM methotrexate. Sheep erythrocytes, used as a source of Ag for CH12.LX cells, were purchased from Elmira Biologicals (Iowa City, IA).

Antibodies

The mAbs 16/10A1 (FITC-labeled anti-mouse CD80-FITC, Armenian hamster IgG) and G235-2356 (FITC-labeled isotype control, Armenian hamster IgG) were purchased from BD PharMingen (San Diego, CA). MOPC-21 (isotype control, mouse IgG1) was purchased from Sigma. Goat anti-rabbit IgG-HRP and goat anti-mouse IgG-HRP were purchased from Bio-Rad (Hercules, CA). The polyclonal Abs anti-mouse TRAF2 (C-20), TRAF1 (N-19), and TRAF3 (H122) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

The following hybridomas were purchased from the American Type Culture Collection and grown in our laboratory, or were the generous gifts from the indicated individuals: anti-hCD40 (G28-5, mouse IgG1); anti-mouse CD54 (YN1/1.7.4, rat IgG2a); anti-mouse CD11{alpha} (M17/4.4.11.9, rat IgG2a); anti-mouse CD40 (1C10, rat IgG2a): Dr. F. Lund (Trudeau Institute, Saranac Lake, NY); anti-mouse IgE (EM95.3, isotype control, rat IgG2a) and anti-mouse CD23 (B3B4, rat IgG2a): Dr. T. Waldschmidt (University of Iowa, Iowa City, IA); anti-LMP1 (S12, mouse IgG2a): Dr. F. Wang (Harvard University, Boston, MA); anti-HLA-A2 (CR11-351, isotype control, mouse IgG1): Dr. C. Lutz (University of Iowa).

DNA constructs

The hCD40LMP1 construct was generated by PCR SOEing (39) as described previously (25). The hCD40LMP1 mutants {Delta}213–232, C{Delta}53, Sub2, and Sub4 were made using the same primers (5' primer, AAGTCGACGCCTCGCTCGGGCGCCA; 3' primer, AATCTAGAAAGCCTATGACATGGTAATGCC; SOEing primer, CATCACTGTGTCGTTGTCATGGATAAAGACCAGCACCAAGAG) with LMP1 templates p1342 (34), p907 (40), p1649, and p1651 (41), respectively, all of which were the generous gift from Dr. B. Sugden (University of Wisconsin, Madison, WI). phCD40LMP1 PQAA3 was made with the same method as hCD40LMP1 but used AATCTAGAGGTTAGTCATAGTAGCTTAGAGCAACTGCGCCGTGGGGGTCGTCAT as the 3' primer. The PQAA1 and PQAA2 mutations were made by SOEing using the template phCD40LMP1 and the same 5' and 3' primers. SOEing primers were GACTCCCTCCCGCACGCTCAAGCAGCTACCGATGATTCTGG and GGAAATGATGGAGGCGCACCTGCATTGACGGAAGAGGTTGA, respectively. The hCD40LMP1 CTAR1 construct was generated by using the 3' primer CGTCTAGAGTCAGTTTTGAGAGCAGAGTG which introduces a stop codon following LMP1 aa 241. The hCD40LMP1 CTAR1 and all PCR SOEing products were cloned into the pRSV.5(neo) plasmid (42) using SalI and XbaI for stable expression in B cells. Mutants utilizing the external and transmembrane domains of the HLA-A2 molecule linked to the cytoplasmic domain of LMP1 used as a template a wild-type (wt) version of this chimeric protein (A2LMP1) that has been previously characterized and shown to signal B cells similarly to Wt LMP1 (22). A2LMP1 PQAA1 and A2LMP1 CTAR2 were generated in a similar manner to A2LMP1, except that AAGGATCCATAATGGGCCTAGGCGCACCTGGAGGT was used as the 5' primer for A2LMP1 CTAR2. The A2LMP1 constructs were subcloned into pRSV.5(hyg) (42) for stable expression in B cells. The nucleotide sequence of all PCR products was verified. Constructs were stably transfected into B cells using electroporation as described elsewhere (38). Expression-matched clones were selected and all experiments were verified with two separate clones.

Ab secretion assay

CH12.LX and its transfected subclones express surface IgM specific for phosphatidylcholine, an Ag found on the surface of SRBC (43). Cells (1.5 x 103/200 µl) were stimulated in flat-bottom 96-well microtiter plates for 3 days with 0.1% SRBC, 1 µg/ml anti-mCD40, or 1 µg/ml anti-hCD40 before enumeration of SRBC-specific IgM-secreting cells by direct hemolytic plaque assay, as described previously (44, 45). During the transcomplementation assays, cells were stimulated with 1 µg/ml anti-mouse (m) CD40 Ab (1C10) or with combinations of 1 µg/ml isotype control (MOPC-21), anti-A2 (CR11-351), or anti-hCD40 (G28-5) Abs to total 2 µg/ml mAb in the presence or absence of 1 µg/ml goat anti-mouse IgG, F(ab')2 (Jackson ImmunoResearch Laboratories, West Grove, PA).

Surface molecule up-regulation

M12.4.1 cells expressing wt hCD40LMP1 or hCD40LMP1 mutants were stimulated, as previously described (37), for 72 h with 0.2 µg/ml isotype control or anti-hCD40 Abs (CR11-351 or G28-5), or with 2 µg/ml isotype control or anti-mCD40 Abs (EM-95 or 1C10). For the transcomplementation assay, cells were stimulated for 72 h with 2 µg/ml isotype control or anti-mCD40 Abs or combinations of 0.1 µg/ml biotinylated isotype control (MOPC-21), anti-A2 (CR11-351), or anti-hCD40 (G28-5) Abs to total 0.2 µg/ml Ab in the presence or absence of 0.1 µg/ml avidin (Sigma). Cells were stained with FITC-labeled mAb against surface markers or FITC-labeled isotype control mAb. Staining was detected by immunofluorescence flow cytometry using a FACScan bench top flow cytometer (BD Biosciences, Mountain View, CA). Mean channel fluorescence was determined by WinMDI 2.8 (http:facs.scripps.edu). Mean channel fluorescence shift (MCFS) was calculated as follows: (specific staining - isotype staining) of stimulated cells - (specific staining - isotype staining) of isotype-stimulated cells.

Nuclear extraction and EMSA

Viable cells (5 x 106) were stimulated for 3 h with 1 µg/ml mAb at a concentration of 1 x 106 cells/ml. This time point was chosen as maximal for LMP1-stimulated NF-{kappa}B nuclear translocation, which is sustained compared with CD40-stimulated translocation (25). Both nuclear extraction and EMSA were performed as previously described (46, 47) except the binding buffer used was 10 mM Tris (pH 7.5), 150 mM KCl, 0.5 mM EDTA, 1 mM MgCl2, 0.1% Triton X-100, 12.5% glycerol, and 1 mM DTT. The gel was dried and used to expose x-ray film overnight at -70°C. Radiodensitometry was performed using the Packard Instant Imager (Packard Instrument, Downers Grove, IL).

In vitro Jun kinase assay

The pGEX-GST-c-Jun(1-79) plasmid was a gift from Dr. G. Koretzky (University of Pennsylvania, Philadelphia, PA). The GST-c-Jun(1-79) was expressed and affinity purified using glutathione-agarose beads (Sigma) as described elsewhere (48). M12.hCD40LMP1 and M12 expressing hCD40LMP1 mutants were stimulated at 2 x 106 cells/1 ml per 3 µg of mAb for 30 min at 37°C. An in vitro kinase assay was performed as described previously (49, 50). The kinase reactions were stopped by the addition of 2x SDS-PAGE loading dye and were separated by SDS-PAGE. Gels were dried, and phosphorylated c-Jun was visualized by autoradiography. Radiodensitometry was performed using the Packard Instant Imager (Packard Instrument).

Immunoprecipitation from detergent-insoluble microdomains (rafts) and Western blotting

M12.hCD40LMP1- and M12-expressing hCD40LMP1 mutants were stimulated at 2 x 107 cells/2.5 x 106 CHO cells per 1 ml for 10 min at 37°C to allow the LMP1 signaling complexes to form. Cells were lysed in 400 µl of Brij lysis buffer, which does not disrupt rafts (51). Supernatants were removed and raft-containing pellets were resolubilized in 400 µl of octylglucoside buffer (based on Ref. 52 ; 60 mM octylglucopyranoside, 150 mM NaCl, 20 mM Tris (pH 7.5), 50 mM {beta}-glycerophosphate, 1% Triton X-100, and 0.1% SDS) by sonication, followed by a 30-min incubation on ice. The octylglucoside lysate was clarified by centrifugation at >=14,000 x g for 10 min at 4°C to remove the remaining insoluble material. The supernatant was then rotated with protein G-agarose beads (Sigma) armed with anti-hCD40 for 2 h at 4°C. The immune complexes were washed four times with octylglucoside buffer (minus octylglucoside), separated by SDS-PAGE, transferred to Immobilon-P (Millipore, Bedford, MA), and sequentially blotted for TRAF2, TRAF1, TRAF3, and LMP1. Visualization was performed with a chemiluminescent detection system (Pierce, Rockford, IL). Quantification of chemiluminescence was done using the Fuji Film Intelligent Dark Box, image reader Las-1000, V1.01, and image gauge V3.12 (Fuji Medical Systems USA, Stamford, CT).

NF-{kappa}B reporter assay

M12 subclones expressing both hCD40LMP1CTAR1 and A2LMP1CTAR2 were electroporated at 4 x 107 B cells/400 µl cytomix (53) per 36 µg 4x NF-{kappa}B luciferase reporter construct/4 µg of pRL-null (Promega, Madison, WI). The 4x NF-{kappa}B construct contains four copies of the NF-{kappa}B binding sites from the promoter of the invariant chain of MHC II to drive luciferase (54) and the pRL-null was used to control for transfection efficiency. The transfection was done using the BTX ECM 830 square wave electroporator (Genetronics, San Diego, CA) set for 225 V and 30 ms. Transfections were rested on ice for 15 min. Then they were evenly divided between 10 wells and stimulated with 10 µg (each) of 1C10, EM95, or with combinations of 10 µg/ml biotinylated isotype control (MOPC-21), anti-A2 (CR11-351), or anti-hCD40 (G28-5) Abs to total 20 µg/ml Ab in the presence or absence of 10 µg/ml avidin (Sigma). Cells were harvested (5 x 105) and prepared as per the manufacturer’s instructions (Promega Dual Luciferase kit; Promega). Luciferase activity was measured on the TD-20/20 Luminometer (Turner Designs, Sunnyvale, CA) using a 2-s delay and 10-s read time.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Structure of LMP1 CT mutants

To understand the importance of structural features of the LMP1 CT in B cell signaling, we generated mutations of the CT in the context of a hCD40LMP1 chimeric receptor (hCD40 extracellular and transmembrane fused to the LMP1 CT) (25). We chose to use the chimeric system for expression of LMP1 mutants because the wt LMP1 self-associates and constitutively signals, whereas the chimera will only signal when agonistic Ab or cells expressing hCD154 are present. This allows us to control the initiation of signaling, and we have previously shown that this technique results in signal indistinguishable from wt LMP1 (22, 25). Both wt CD40 and hCD40LMP1 translocate to lipid-enriched membrane microdomains when engaged; LMP1 localizes constitutively to microdomains (25). The different chimeras were stably transfected into the mouse B cell lines M12.4.1 or CH12.LX and selected for matching surface expression of the chimera. The endogenous mCD40 of each cell line was used as an internal control in all signaling experiments.

Mutations were made in the LMP1 CT as described in Materials and Methods and are outlined in Fig. 1Go. They were chosen to dissect the roles of CTAR1 and CTAR2, (26) in LMP1 signaling to B cells, as discussed in the Introduction. To examine the role of CTAR1, we used two point mutants, Sub2 and Sub4, which change charged amino acids (H203, D209, D209, and E221, R223, H224, H225, respectively) to alanines within the CTAR1 region and were shown to decrease TRAF3 binding by 90% in GST fusion protein experiments (41). Additionally, we examined the mutant {Delta}213–232 (34), which deletes the second half of the CTAR1 region, including the region changed in the Sub4 mutation. To examine the role of CTAR2, we tested C{Delta}53 (40), which deletes the last 53 aa of LMP1, including the entire CTAR2 region. To individually examine the role of the three PXQXT motifs in LMP1 signaling, we changed the proline and glutamine in the motif to alanines. PQAA1 (residues P204 and Q206) is in the first motif, which resides in CTAR1, and is the only motif that has been implicated in TRAF binding to LMP1. Likewise, the second motif mutation is designated PQAA2 (P320 and Q222), and the third motif mutation, which resides in CTAR2, is called PQAA3 (PQ379 and Q381). We also mutated all three PXQXT motifs simultaneously (PQAA1, 2, 3), to see whether there is any redundancy in the function of the motifs in LMP1 signaling. Other groups have used PQAA or PQTAAA mutations as "CTAR dead" mutations (21, 55, 56).



View larger version (74K):
[in this window]
[in a new window]
 
FIGURE 1. Structure of the LMP1 CT in hCD40LMP1 constructs. LMP1 consists of the wt sequence from aa 187–386, with CTAR1 spanning aa 194–232 and CTAR2 spanning aa 351–386. C{Delta}53 contains wt sequence from aa 187–333, {Delta}213–232 deletes these aa from the wt tail, and Sub2 and Sub4 replace charged amino acids with alanine. PQAA1, PQAA2, and PQAA3 replace P204 and Q206, P320, and Q222, P379 and Q381 with alanine, respectively, while PQAA1,2,3 replaces these residues in all three PXQ motifs.

 
Surface molecule up-regulation

Upon activation by both CD40 and LMP1, a B cell will up-regulate several surface molecules including CD23, CD80, and adhesion molecules such as CD11{alpha} (LFA-1) and CD54 (ICAM-1) (22, 37, 57). To test the effect of the LMP1 CT mutations on the up-regulation of these molecules, transfected M12.4.1 cell lines were stimulated for 72 h. M12 subclones were examined for this function as they have relatively low basal expression of surface molecules and therefore demonstrate better up-regulation than CH12.LX subclones which have higher basal expression of molecules, allowing differences between LMP1 mutants to be more readily detected. Two of the CT mutants, C{Delta}53 and {Delta}213–232, were also cloned into an isopropyl-{beta}-D-thiogalactopyranoside-inducible system in the context of the full-length LMP1 molecule (22) and were tested for their ability to stimulate CD80 up-regulation in stably transfected M12.4.1 lines. This allowed us to once again confirm that the hCD40LMP1 chimeric receptor signals similarly to wt LMP1 (22, 25). As shown in Fig. 2GoA, C{Delta}53 failed to up-regulate CD80, while {Delta}213–232 up-regulated CD80 to a level similar to wt LMP1. These results were recapitulated in the chimeric receptor system.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 2. CTAR1 and CTAR2 both play important roles in surface molecule up-regulation. A, M12.4.1 cells expressing inducible wt LMP1, {Delta}213–232, or C{Delta}53 were stimulated for 72 h with isotype control or anti-mCD40 mAb, or with the isotype control Ab plus 100 µM isopropyl-{beta}-D-thiogalactopyranoside. Cells were analyzed with flow cytometry. Dashed profiles represent isotype staining and solid profiles represent anti-CD80 staining. B, M12.hCD40LMP1 (wt) and M12.hCD40LMP1 PQAA3 were stimulated for 72 h with either isotype control, anti-mCD40, or anti-hCD40 mAbs. Cells were stained for surface expression of CD80 as in A. The surface expression of CD80 in unstimulated cells is similar to that seen in A. C and D, M12.4.1 cells stably transfected with the various hCD40LMP1 mutant constructs were stimulated as in A and analyzed for surface expression of CD80, CD23, CD54, and CD11{alpha}. Data, presented as a ratio of LMP1-stimulated MCFS:mCD40-stimulated MCFS, are the mean ± SE from three separate experiments, and are representative of two clones tested for each hCD40LMP1 molecule.

 
The LMP1 CT mutants {Delta}213-, Sub4, and PQAA2 were similar to wt LMP1 in the ability to up-regulate the four surface receptors tested (Fig. 2Go, C–D). However, Fig. 2GoB shows that PQAA3 had a marked defect in LMP1-induced CD80 up-regulation as well as in up-regulation of the other surface molecules measured (Fig. 2GoB). Similar defects in surface molecule up-regulation were seen using the mutants C{Delta}53, Sub2, PQAA1, and PQAA1,2,3. In all cases the defects in CD80 up-regulation were most severe, whereas the defects in CD23 and CD54 up-regulation were less marked. CD11{alpha} up-regulation was least affected by the CT mutations, although the up-regulation seen by C{Delta}53, Sub2, PQAA1, and PQAA1, 2, and 3 was 20–50% lower than for wt LMP1. The subclone of Sub4 shown in Fig. 2GoC appears to be hyperresponsive for CD80 up-regulation. However, we believe this to be a trait inherent to that subclone as it was not seen in other subclones tested. Likewise, the PQAA2 subclone shown in Fig. 2GoD appears to be slightly defective for surface molecule up-regulation. However, it did not demonstrate the differential defects in surface molecule up-regulation seen in defective mutants such as C{Delta}53, and a second subclone tested was indistinguishable from wt LMP1. In all subclones, surface molecule up-regulation by stimulation of mCD40 was normal (Fig. 2Go, A and B). These results indicate that both the CTAR1 and CTAR2 regions make important contributions to induced surface molecule expression.

IgM secretion

Production of Ab is the key unique function of the B cell, so we continued our study of the LMP1 CT mutants by testing their ability to stimulate Ig secretion in stably transfected B cell subclones. The mouse B cell line CH12.LX responds to CD40 and LMP1 signaling by producing phosphatidylcholine-specific IgM (22, 58), so Ig-secreting cells can be enumerated by a direct plaque-forming cell assay. CH12.LX and its subclones are not stimulated to produce Ig following engagement of the B cell Ag receptor, but respond similarly to signals delivered via endogenous mCD40 or stably transfected hCD40 molecules (37). We have previously shown that the hCD40LMP1 chimera stimulates 4- to 9-fold more Ig secretion than does mCD40 (Ref. 25 and Fig. 3GoA). Of the LMP1 CT mutants tested, only {Delta}213–232 stimulated IgM production as well as did wt LMP1 (Fig. 3GoB). All other mutants, although expressed in CH12.LX subclones as well as wt hCD40LMP1, showed a decreased ability to signal, stimulating IgM secretion approximately as well as did endogenous mCD40. Thus, the LMP1 CT mutants signaled at a reduced level, similar to hCD40 rather than hCD40LMP1 with a wt CT.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Induction of IgM secretion via hCD40LMP1 mutant molecules. A, CH12.hCD40 and CH12.hCD40LMP1 were stimulated with Ag (SRBC), anti-hCD40, or anti-mCD40 mAb for 3 days and then assayed for IgM secretion. Plaque-forming cells (Pfc) per 106 viable recovered cells are presented as the mean ± SE of replicate cultures. B, CH12.LX cells stably transfected with various hCD40LMP1 constructs were stimulated as in A. Results are presented as a ratio of the IgM secretion stimulated through the hCD40LMP1 molecule:IgM secretion stimulated via mCD40 and represent the mean ± SE of three to four experiments with at least two clones expressing each different hCD40LMP1 molecule.

 
IL-6 secretion

CH12.LX cells respond (as do normal splenic B cells) to CD40 or LMP1 signaling by secreting IL-6 (22, 59). The ability of the LMP1 CT mutants to stimulate IL-6 production was measured by an IL-6 specific ELISA following stimulation for 48 h with CHO cells expressing mCD154 or hCD154 (59). All of the LMP1 CT mutants stimulated IL-6 secretion similarly to wt LMP1 (data not shown). This indicates that neither CTAR1 nor CTAR2 are required for this function, suggesting that additional functional motifs in the LMP1 CT remain to be characterized.

NF-{kappa}B and JNK activation

Five of the eight mutants tested showed defects in LMP1-induced IgM secretion and surface molecule up-regulation, but not IL-6 production (see above). Interestingly, studies of CD40 signaling have shown that Ig production and up-regulation of CD80, CD23, and CD54 are dependent upon increased NF-{kappa}B activation (60), whereas IL-6 production is not (59). Additionally, both CD40-induced IgM production and surface molecule up-regulation involve TRAF2 (37, 61), whereas IL-6 production does not (59). TRAF2 has also been shown to be important for JNK activation (51, 62). We thus tested the ability of the LMP1 CT mutants to activate NF-{kappa}B and JNK. All LMP1 CT mutants were able to activate NF-{kappa}B (Fig. 4Go, A and B). The majority of the LMP1 mutations showed a 50–60% decrease in activity when compared with the endogenous mCD40, but the mutants {Delta}213–232, Sub4, and PQAA2 showed no detectable defect in NF-{kappa}B activation. Results of JNK activation were qualitatively similar. The mutants {Delta}213–232, Sub4, and PQAA2 showed no defect in JNK activation, but the other mutants were completely unable to activate JNK (Fig. 4Go, C and D). This indicates that in B cells, in contrast to epithelial cell lines, both CTAR1 and CTAR2 play functionally important roles in NF-{kappa}B and JNK activation, and that both must be intact for optimal LMP1 signaling.



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 4. CTAR1 and CTAR2 both play important roles in NF-{kappa}B and JNK activation. A, M12.hCD40LMP1 and M12.hCD40LMP1 C{Delta}53 cells were stimulated for 3 h with isotype control (I), anti-mCD40 (M), or anti-hCD40 (H) mAbs before nuclear extracts were prepared and EMSA was performed. P, probe alone. The shifted complexes are indicated with a bracket to the right of the gel. B, M12.4.1 cells stably transfected with hCD40LMP1 mutant constructs were stimulated as in A for EMSA, and radiodensitometry was performed on the gels. Data are presented as (cells stimulated via LMP1 - isotype control stimulus) ÷ (cells stimulated via endogenous mCD40 - isotype control stimulus). Values represent the mean ± SE from three separate experiments and are representative of two clones tested for each LMP1 molecule. Similar results were seen in CH12.LX subclones. C, M12.hCD40LMP1 and M12.hCD40LMP1 C{Delta}53 cells were stimulated for 15 min with isotype control (I), anti-mCD40 (M), or anti-hCD40 (H) mAbs before an in vitro JNK assay was performed. The phosphorylated GST-c-Jun is indicated by the arrow to the right of the gel. D, M12.4.1 cells stably transfected with hCD40LMP1 mutant molecules were stimulated as in C, and radiodensitometry was performed on the gels. Data are presented as (cells stimulated via LMP1 - isotype control stimulus) ÷ (cells stimulated via endogenous mCD40 - isotype control stimulus). Values represent the mean ± SE from three separate experiments and are representative of two clones tested for each LMP1 molecule.

 
Interactions with TRAFs

The next question addressed was whether the defects we saw in Ig secretion, surface molecule up-regulation, and NF-{kappa}B and JNK activation correlated with the ability to bind to intracellular adapter proteins such as the TRAFs and TRADD. The ability of the CT mutants to bind TRAFs and TRADD will provide evidence for or against these adapter proteins playing an important role in LMP1 signaling in B lymphocytes. To ensure physiologic relevance of interactions seen between LMP1 and B cell proteins at their endogenous levels, we performed immunoprecipitations (IP) from stimulated and unstimulated B cell stable transfectants expressing the following mutants: hCD40LMP1, C{Delta}53, PQAA3, Sub2, Sub4, and {Delta}213–232. These mutants were chosen for analysis because they affect the CTAR1 and CTAR2 regions and showed functional defects in B cell activation (see above). Both LMP1 and CD40 signal from detergent-insoluble membrane microdomains or rafts (51, 52), as does the chimeric hCD40LMP1 (25); therefore, the IP was done from material enriched in rafts.

As expected (25), there was more hCD40LMP1 and associated proteins present in the membrane rafts from cells that had received a hCD154 stimulus (Fig. 5Go), although the total amount of hCD40LMP1 in the precipitates varied between cell lines. TRAFs 1, 2, and 3 were easily found in the hCD40LMP1 IP and were detectable in precipitates from cells expressing the various CT mutants. Only the Sub2 mutation showed a consistent, substantial 80% decrease in the ability to bind to TRAF proteins, which was even more striking considering that the IP of Sub2 was typically more efficient than hCD40LMP1 although the two lines had similar surface expression of hCD40. Although the mutants C{Delta}53 and PQAA3, which have dramatic signaling defects, did show a 20–40% decrease in their ability to bind to TRAF proteins, this was not significantly different from the decrease in TRAF binding seen with Sub4 and {Delta}213–232, both of which signal indistinguishably from wt LMP1 CT in all ({Delta}213–232) or most (Sub4) B cell effector assays. The IP were also blotted for TRADD; however a TRADD-LMP1 interaction was never seen, even in the context of the wt CT (data not shown). Perhaps the interaction was not detectable due to the small amount of endogenous TRADD present in B cells. However, we could detect TRADD in cellular lysates and TRADD was not observed to move to Brij 58-insoluble microdomains (rafts) upon LMP1 signaling (data not shown).



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 5. The Sub2 region of LMP1 is critical for TRAF binding. A, Western blots of hCD40 IP from Brij 58-insoluble membrane microdomains as described in Materials and Methods. M12.4.1 cells stably transfected with the various hCD40LMP1 mutant molecules were stimulated with CHO cells or CHO.hCD154 cells for 10 min before cell lysis. IP were subjected to SDS-PAGE, transferred to polyvinylidene difluoride and sequentially blotted for TRAF2, TRAF1, TRAF3, and LMP1. Results are representative of three separate experiments. B, Quantitation of the digital images generated in A was performed and the mean ± SE of three separate experiments is presented. The ratio of precipitated TRAFs was calculated as (TRAF from mutant CT ÷ TRAF from wt CT)/(LMP1 from mutant CT ÷ LMP1 from wt CT). The relative amount of LMP1 brought down in the IP is as follows: LMP1, 1; C{Delta}53, 1.30 ± 0.14; PQAA3, 0.94 ± 0.34; Sub2, 1.91 ± 0.39; Sub4 1.21 ± 0.36; and {Delta}213–232, 1.38 ± 0.45.

 
CTAR transcomplementation

Mutations in CTAR1 and CTAR2 have a similar phenotype, but only CTAR1 function correlates with TRAF binding (Fig. 5Go), suggesting that either the two nonredundant regions physically interact during signaling or that they initiate converging signaling pathways, both of which need to be present for optimal signaling to occur. To examine CTAR interaction in B cells, M12.4.1 and CH12.LX B cells were stably transfected with both an HLA-A2LMP1 CTAR2 chimera (LMP1 aa 242–386, see Materials and Methods) and a hCD40LMP1 CTAR1 chimera (LMP1 aa 187–241, see Materials and Methods). This allows us to signal through either CTAR separately with mAbs or to supercrosslink the mAbs with an anti-IgG secondary Ab or avidin and biotinylated primary mAbs, which will bring the CTARs into physical proximity.

As seen in Fig. 6GoA, either CTAR alone stimulated IgM secretion similarly to endogenous mCD40. The combination of the two CTARs is also similar to endogenous mCD40; however, the supercrosslinking of both CTARs simultaneously produces a marked increase in IgM secretion. The supercrosslinking of either CTAR alone was identical to the stimulation seen in the absence of supercrosslinking (data not shown). Biotinylated primary mAbs and avidin were used to stimulate the M12 subclones because M12.4.1 expresses a very low level of surface IgG and we wanted to avoid cross-linking the B cell Ag receptor. In M12 subclones, either CTAR alone is largely unable to stimulate CD80 up-regulation, but signaling through both molecules induces a 7- to 10-fold greater CD80 up-regulation when compared with either CTAR alone (Fig. 6GoB). The addition of avidin to supercrosslink the chimeras results in a small, but reproducible additional increase in CD80 up-regulation following stimulation by both Abs, but not when stimulating through either chimera alone. We could not detect transcomplementation of JNK by in vitro kinase assay or of NF-{kappa}B by EMSA (data not shown), but some cooperation between the CTARs was seen in a NF-{kappa}B reporter assay (Fig. 6GoC). However, supercrosslinking had no additional effect on NF-{kappa}B reporter activity. Similar results were seen when experiments were performed using a hCD40LMP1 PQAA3-A2LMP1 PQAA1 transcomplementation system.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 6. CTAR1 and CTAR2 cooperate in LMP1 signaling. A, A subclone of CH12.LX cells stably expressing both hCD40LMP1 CTAR1 and A2LMP1 CTAR2 was stimulated for 72 h with either isotype control, anti-mCD40, anti-A2, or anti-hCD40 mAbs in the presence or absence of goat anti-mIgG F(ab')2. Ab-secreting cells were enumerated by direct plaque assay. Data are presented as mean ± SE of replicate cultures and are representative of two separate experiments. B, M12 cells stably expressing both hCD40LMP1 CTAR1. A2LMP1 CTAR2 were stimulated for 72 h with either isotype control, anti-mCD40, anti-A2, or anti-hCD40 mAbs. Cells were analyzed for surface expression of CD80 by flow cytometry as in Fig. 2Go and MCFS from each stimulus was calculated. Results are representative of six separate experiments. C, Cells as in B were transiently transfected with a NF-{kappa}B reporter assay and stimulated for 12 h with either isotype control, anti-mCD40, anti-A2, or anti-hCD40 mAbs. Relative light units (RLU) were calculated by normalizing the NF-{kappa}B activity to the Renilla activity in each sample. Data are presented as the mean ± SE of triplicate samples and are representative of two separate experiments.

 
Supercrosslinking in CH12 subclones had a larger effect than that seen by supercrosslinking in M12 subclones. This may reflect inherent differences between the two B cell lines or a greater sensitivity in the Ig secretion assay than in CD80 up-regulation or the NF-{kappa}B reporter assay. Because supercrosslinking does not restore LMP1 signaling to that seen with the wt LMP1 CT, we cannot rule out the possibility that the two CTARs activate separate but converging signaling pathways. However, both CD40LMP1 and A2LMP1 chimeras signal from Brij 58-insoluble membrane microdomains (Ref. 25 and L. K. Busch, unpublished observation). Thus, it is possible that the microdomains are small enough to concentrate the chimeras and allow for physical cooperation between the CTARs, hence supercrosslinking does little to enhance cooperation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have developed a system to examine the effect of specific mutations in the LMP1 CT on B cell signaling. By generating stably transfected clones, we can match expression of the various hCD40LMP1 mutations in a homogeneous population and directly compare their signaling capabilities (Table IGo). Using this system we have uncovered an overlooked function for CTAR1 in endogenous NF-{kappa}B and JNK activation by LMP1 in B cells as well as in LMP1-mediated Ig secretion and surface molecule up-regulation, summarized in Fig. 7Go. Previous reports indicated that CTAR1 plays a subordinate role in NF-{kappa}B activation (26, 34) and plays no role in JNK activation (19). However, those studies were performed by transiently overexpressing both LMP1and epitope-tagged JNK or artificial NF-{kappa}B reporter plasmids, usually in the transformed epithelial cell line 293. Our results indicate that both CTAR1 and CTAR2 play essential, distinct, and similarly important roles in LMP1 signaling in B lymphocytes, the target of EBV infection in vivo.


View this table:
[in this window]
[in a new window]
 
Table I. Summary of the data from the mutant LMP1 CT analysis

 


View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 7. Model of the proposed functional cooperation between CTAR1 and CTAR2 in LMP1 signaling. The LMP1 CT is drawn as a thick black line. The ovals indicate TRAFs 1, 2, and 3 which bind to the membrane proximal CTAR1, and as yet uncharacterized CTAR2 binding protein(s) (see text) is indicated with a question mark. Due to the finding that mutations in CTAR1 and CTAR2 show similar phenotypes, we propose that the two regions interact in vivo, probably through TRAF and the CTAR2 binding protein(s). Thus, when either half of the complex is missing, a similar phenotype is seen. In support of this hypothesis, chimeric LMP1 molecules which contain only one functional CTAR can partially transcomplement each other and restore LMP1 signaling.

 
None of the mutations in the LMP1 CT completely abolished the ability of LMP1 to stimulate B cell activation as measured by IgM secretion, surface molecule up-regulation, and NF-{kappa}B activation (Table IGo). However, only the CTAR1 mutants {Delta}213–232, Sub4, and PQAA2 were able to stimulate most B cell effector functions as robustly as the wt LMP1 CT. This indicates that the second PXQXT motif does not play a major role in LMP1 signaling in B lymphocytes. However, PQAA2 and Sub4 both showed a partial decrease in stimulation of Ig secretion (Fig. 2Go), which is the LMP1 effector function most sensitive to perturbation of the LMP1 CT in our assays. It is not clear why Sub4 delivers a suboptimal IgM secretion signal, while the signal delivered by {Delta}213–232 does not differ significantly from the wt CT, and Sub4 is similarly not defective in delivering other LMP1-mediated B cell activation signals. It may be that the point mutations made in Sub4 allow association with an uncharacterized negative regulatory protein that is not bound by wt LMP1, and whose binding site is of course removed in {Delta}213–232. Because the IgM secretion assay is more sensitive to LMP1 alterations than other assays, it may detect subtle negative regulation better or such regulation may be specific to this particular function. These ideas will require further investigation.

LMP1 is believed to mediate signaling via the TRAF proteins, a family of adapter molecules that bind to the PXQXT motif in CTAR1 of LMP1 (27), and by TRADD, which binds to CTAR2 (29, 63). Our data indicating mutations within CTAR1 affect LMP1-stimulated effector functions support a role for the TRAF proteins in LMP1 signaling, but also indicate involvement of other factors. The CTAR1 mutant Sub2 has a dramatically reduced ability to recruit and bind to TRAFs 1, 2, and 3 in B cells (Fig. 5Go), but stimulates IL-6 secretion at wt levels (data not shown) and still partially mediates NF-{kappa}B activation and CD23, CD11{alpha}, and CD54 up-regulation (Figs. 2Go and 4Go), indicating that these signaling pathways are at least partially TRAF independent.

Interestingly, CTAR2 mutations also show functional defects in LMP1 signaling to B cells (Table IGo), although these mutants bind to the TRAF proteins at levels similar to Sub4 and {Delta}213–232, which do not show the same signaling defects (Fig. 5Go). This finding also supports a role for TRAF-independent mechanisms of LMP1-mediated B cell activation. TRADD is an obvious candidate for a CTAR2-interacting protein in B cells, but controversy remains about whether LMP1 interacts with the death domain (29) or the TRAF-interacting domain (64) of TRADD. Although we cannot rule out a role for TRADD in CTAR2-mediated signal transduction, we feel it is unlikely to play a major role in LMP1 signaling to B cells, as we were unable to detect recruitment of endogenous TRADD or a stably transfected TRADDGFP to LMP1 signaling complexes in B cells (data not shown). Similar findings have been reported in nasopharyngeal carcinoma cells (52). Although the identity of crucial CTAR2 binding protein(s) remains unknown, it is clear that TRAFs alone cannot mediate all LMP1 signaling. It has been demonstrated that TRAF6 is the only known TRAF important to CD40-mediated IL-6 secretion in B cells (59, 65). However, LMP1 stimulates IL-6 secretion in B cells (22) but does not bind to TRAF6 (28, 66). Furthermore, mutations in either CTAR1 or CTAR2 showed no reduction in stimulation of IL-6 secretion (data not shown), indicating that LMP1 has a TRAF-independent route to IL-6 secretion or that it is using as yet uncharacterized TRAF homologues.

The finding that CTAR1 and CTAR2 mutants have similar phenotypes suggests that the regions physically cooperate in LMP1 signaling or that they mediate separate signaling cascades which converge downstream to stimulate B cell activation (Fig. 7Go). The second possibility is unlikely since the CTAR double mutant PQAA1,2,3 does not show a further reduction in its ability to stimulate surface molecule up-regulation, Ig secretion, or NF-{kappa}B activation when compared with single CTAR mutations. We are able to partially restore CD80 up-regulation and Ig secretion by concurrently signaling through a hCD40LMP1 CTAR1 and an A2LMP1 CTAR2 chimera (Fig. 6Go). The stimulus is greater after supercrosslinking, suggesting that the physical proximity of the CTARs is important. Recent work supports the idea that CTAR-CTAR interactions are critical both by demonstrating that CTAR transcomplementation can occur in transiently transfected Jurkat T cells (24), and that the lytic LMP1 and a CTAR1–2 mutated LMP1 can function as inhibitors of LMP1 signaling in a dose-dependent manner (67, 68). It is also relevant to note that simultaneous physical interactions between distinct regions of the CD40 cytoplasmic domain and TRAF3 have been proposed on the basis of studies of the crystal structure of a CD40 CT peptide complexed with a peptide of the TRAF3 C terminus (69). These findings allows us to propose a model in which the LMP1 CT folds back upon itself and the CTARs physically interact via CTAR-interacting proteins (Fig. 7Go). Future work will focus on the nature of the CTAR interaction and identification of novel LMP1 signaling pathways and binding proteins.


    Acknowledgments
 
We are grateful to the members of the Bishop laboratory for their advice and discussion, and thank Dr. Bruce Hostager for critically reviewing this manuscript.


    Footnotes
 
1 This work was supported by grants to G.A.B. from the Veterans Affairs (Merit Review 383) and the National Institutes of Health (AI28847 and CA66570). Core molecular biology support was provided by National Institutes of Health Grant DK25295 to the University of Iowa Diabetes and Endocrinology Research Center. L.K.B. is the recipient of a Presidential Fellowship from the University of Iowa Graduate College. Back

2 Address correspondence and reprint requests to Dr. Gail A. Bishop, Department of Microbiology, University of Iowa, 3-570 BSB, Iowa City, IA 52242. E-mail address: gail-bishop{at}uiowa.edu Back

3 Abbreviations used in this paper: LCL, lymphoblastoid cell line; CHO, Chinese hamster ovary; CT, carboxyl-terminal; CTAR, CT-activating region; IP, immunoprecipitation; JNK, c-Jun N-terminal kinase; LMP1, latent membrane protein 1; MCFS, mean channel fluorescence shift; TRAF, TNFR-associated factor; TRADD, TNFR-associated death domain protein; wt, wild type; h, human; m, mouse. Back

Received for publication July 9, 2001. Accepted for publication September 14, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cohen, J. I.. 2000. Epstein-Barr virus infection. N. Engl. J. Med. 343:481.[Free Full Text]
  2. Miyashita, E. M., B. Yang, K. M. Lam, D. H. Crawford, D. A. Thorley-Lawson. 1995. A novel form of EBV latency in normal B cells in vivo. Cell 80:593.[Medline]
  3. Rickinson, A. B., E. Kieff. 1996. Epstein-Barr Virus. B. N. Fields, and D. M. Knipe, and P. M. Howley, eds. Fields Virology 2397. Lippincott-Raven, Philadelphia.
  4. Henle, G., W. Henle, V. Diehl. 1968. Relation of Burkitt’s tumor-associated herpes-type virus to infectious mononucleosis. Proc. Natl. Acad. Sci. USA 59:94.[Free Full Text]
  5. Miyashita, E. M., B. Yang, G. J. Babcock, D. A. Thorley-Lawson. 1997. Identification of the site of Epstein-Barr virus persistence in vivo as a resting B cell. J. Virol. 71:4882.[Abstract]
  6. Kieff, E.. 1996. Epstein-Barr virus and its replication. B. N. Fields, and D. M. Knipe, and P. M. Howley, eds. Fields Virology 2343. Lippincott-Raven, Philadelphia.
  7. Wensing, B., P. J. Farrell. 2000. Regulation of cell growth and death by EBV. Microb. Infect. 2:77.[Medline]
  8. Hammerschmidt, W., B. Sugden. 1989. Genetic analysis of immortalizing functions of EBV in human B lymphocytes. Nature 340:393.[Medline]
  9. Tomkinson, B., K. Robertson, E. Kieff. 1993. EBV nuclear proteins (EBNA) 3A and 3C are essential for B lymphocyte growth transformation. J. Virol. 67:5068.[Abstract/Free Full Text]
  10. Kaye, K. M., K. M. Izumi, E. Kieff. 1993. Epstein-Barr virus LMP1 is essential for B-lymphocyte growth transformation. Proc. Natl. Acad. Sci. USA 90:9150.[Abstract/Free Full Text]
  11. Wang, D., D. Liebowitz, E. Kieff. 1985. An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43:831.[Medline]
  12. Baichwal, V. R., B. Sugden. 1988. Transformation of BALB 3T3 cells by the BNLF-1 gene of EBV. Oncogene 2:461.[Medline]
  13. Zimber-Strobl, U., B. Kempkes, G. Marschall, R. Zeidler, C. Vankooten, J. Banchereau, G. W. Bornkamm, W. Hammerschmidt. 1996. Epstein-Barr virus LMP1 is not sufficient to maintain proliferation of B cells but both it and activated CD40 can prolong their survival. EMBO J. 15:7070.[Medline]
  14. Liebowitz, D., D. Wang, E. Kieff. 1986. Orientation and patching of the latent infection membrane protein encoded by EBV. J. Virol. 58:233.[Abstract/Free Full Text]
  15. Wang, D., D. Liebowitz, F. Wang, C. Gregory, A. Rickinson, R. Larson, T. Springer, E. Kieff. 1988. EBV latent infection membrane protein alters the human B-lymphocyte phenotype: deletion of the amino terminus abolishes activity. J. Virol. 62:4173.[Abstract/Free Full Text]
  16. Laherty, C. D., H. M. Hu, A. W. Opipari, F. Wang, V. M. Dixit. 1992. The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expression by activating nuclear factor {kappa}B. J. Biol. Chem. 267:24157.[Abstract/Free Full Text]
  17. Herrero, J. A., P. Mathew, C. V. Paya. 1995. LMP-1 activates NF-{kappa}B by targeting the inhibitory molecule I{kappa}B{alpha}. J. Virol. 69:2168.[Abstract]
  18. Kieser, A., E. Kilger, O. Gires, M. Ueffing, W. Kolch, W. Hammerschmidt. 1997. Epstein-Barr virus LMP1 triggers AP-1 activity via the JNK cascade. EMBO J. 16:6478.[Medline]
  19. Eliopoulos, A. G., L. S. Young. 1998. Activation of the JNK pathway by the Epstein-Barr virus-encoded LMP1. Oncogene 16:1731.[Medline]
  20. Gires, O., U. Zimber-Strobl, R. Gonnella, M. Ueffing, G. Marschall, R. Zeidler, D. Pich, W. Hammerschmidt. 1997. LMP1 of EBV mimics a constitutively active receptor molecule. EMBO J. 16:6131.[Medline]
  21. Floettmann, J. E., M. Rowe. 1997. Epstein-Barr virus LMP1 C-terminus activation region 2 (CTAR2) maps to the far C-terminus and requires oligomerization for NF-{kappa}B activation. Oncogene 15:1851.[Medline]
  22. Busch, L. K., G. A. Bishop. 1999. The EBV transforming protein, LMP1, mimics and cooperates with CD40 signaling in B lymphocytes. J. Immunol. 162:2555.[Abstract/Free Full Text]
  23. Kilger, E., A. Kieser, M. Baumann, W. Hammerschmidt. 1998. EBV-mediated B-cell proliferation is dependent upon LMP1, which simulates an activated CD40 receptor. EMBO J. 17:1700.[Medline]
  24. Floettmann, J. L., A. G. Eliopoulos, M. Jones, L. S. Young, M. Rowe. 1998. Epstein-Barr virus LMP1 signalling is distinct from CD40 and involves physical cooperation of its two C-terminus functional regions. Oncogene 17:2383.[Medline]
  25. Brown, K. D., B. S. Hostager, G. A. Bishop. 2001. Differential signaling and TRAF degradation mediated by CD40 and the EBV oncoprotein LMP1. J. Exp. Med. 193:943.[Abstract/Free Full Text]
  26. Huen, D. S., S. A. Henderson, D. Croom-Carter, M. Rowe. 1995. The Epstein-Barr virus LMP1 mediates activation of NF-{kappa}B and cell surface phenotype via two effector regions in its carboxy-terminal cytoplasmic domain. Oncogene 10:549.[Medline]
  27. Devergne, O., E. Hatzivassiliou, K. M. Izumi, K. M. Kaye, M. F. Kleijnen, E. Kieff, G. Mosialos. 1996. Association of TRAF1, TRAF2, and TRAF3 with an Epstein-Barr virus LMP1 domain important for B-lymphocyte transformation: role in NF-{kappa}B activation. Mol. Cell. Biol. 16:7098.[Abstract]
  28. Brodeur, S. R., G. Cheng, D. Baltimore, D. A. Thorley-Lawson. 1997. Localization of the major NF-{kappa}B-activating site and the sole TRAF3 binding site of LMP-1 defines two distinct signaling motifs. J. Biol. Chem. 272:19777.[Abstract/Free Full Text]
  29. Izumi, K. M., E. D. Kieff. 1997. The EBV oncogene product LMP1 engages the tumor necrosis factor receptor-associated death domain protein to mediate B lymphocyte growth transformation and activate NF-{kappa}B. Proc. Natl. Acad. Sci. USA 94:12592.[Abstract/Free Full Text]
  30. Gires, O., F. Kohlhuber, E. Kilger, M. Baumann, A. Kieser, C. Kaiser, R. Zeidler, B. Scheffer, M. Ueffing, W. Hammerschmidt. 1999. LMP1 of EBV interacts with JAK3 and activates STAT proteins. EMBO J. 18:3064.[Medline]
  31. Izumi, K. M., K. M. Kaye, E. D. Kieff. 1997. The Epstein-Barr virus LMP1 amino acid sequence that engages TRAFs is critical for primary B lymphocyte growth transformation. Proc. Natl. Acad. Sci. USA 94:1447.[Abstract/Free Full Text]
  32. Kaye, K. M., K. M. Izumi, H. Li, E. Johannsen, D. Davidson, R. Longnecker, E. Kieff. 1999. An Epstein-Barr virus that expresses only the first 231 LMP1 amino acids efficiently initiates primary B-lymphocyte growth transformation. J. Virol. 73:10525.[Abstract/Free Full Text]
  33. Izumi, K. M., E. C. McFarland, E. A. Riley, D. Rizzo, Y. Z. Chen, E. Kieff. 1999. The residues between the two transformation effector sites of Epstein-Barr virus LMP1 are not critical for B-lymphocyte growth transformation. J. Virol. 73:9908.[Abstract/Free Full Text]
  34. Mitchell, T., B. Sugden. 1995. Stimulation of NF-{kappa}B-mediated transcription by mutant derivatives of the latent membrane protein of EBV. J. Virol. 69:2968.[Abstract]
  35. Kaye, K. M., O. Devergne, J. N. Harada, K. M. Izumi, R. Yalamanchili, E. Kieff, G. Mosialos. 1996. TRAF2 is a mediator of NF-{kappa}B activation by LMP1, the EBV transforming protein. Proc. Natl. Acad. Sci. USA 93:11085.[Abstract/Free Full Text]
  36. Bishop, G. A., G. Haughton. 1986. Induced differentiation of a transformed clone of Ly-1+ B cells by clonal T cells and antigen. Proc. Natl. Acad. Sci. USA 83:7410.[Abstract/Free Full Text]
  37. Hostager, B. S., Y. Hsing, D. E. Harms, G. A. Bishop. 1996. Different CD40-mediated signaling events require distinct CD40 structural features. J. Immunol. 157:1047.[Abstract]
  38. Bishop, G. A., J. A. Frelinger. 1989. Haplotype-specific differences in signaling by transfected class II molecules to a Ly-1+ B-cell clone. Proc. Natl. Acad. Sci. USA 86:5933.[Abstract/Free Full Text]
  39. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51.[Medline]
  40. Martin, J., B. Sugden. 1991. Transformation by the oncogenic latent membrane protein correlates with its rapid turnover, membrane localization, and cytoskeletal association. J. Virol. 65:3246.[Abstract/Free Full Text]
  41. Sandberg, M., W. Hammerschmidt, B. Sugden. 1997. Characterization of LMP-1’s association with TRAF1, TRAF2, and TRAF3. J. Virol. 71:4649.[Abstract]
  42. Long, E. O., S. Rosen-Bronson, D. R. Karp, M. Malnati, R. P. Sekaly, D. Jaraquemada. 1991. Efficient cDNA expression vectors for stable and transient expression of HLA-DR in transfected fibroblast and lymphoid cells. Hum. Immunol. 31:229.[Medline]
  43. Mercolino, T. J., L. W. Arnold, G. Haughton. 1986. Phosphatidyl choline is recognized by a series of Ly-1+ murine B cell lymphomas specific for erythrocyte membranes. J. Exp. Med. 163:155.[Abstract/Free Full Text]
  44. Cunningham, A. J., A. Szenberg. 1968. Further improvements in the plaque technique for detecting single antibody-forming cells. Immunology 14:599.[Medline]
  45. Bishop, G. A.. 1991. Requirements of class II-mediated B cell differentiation for class II cross-linking and cyclic AMP. J. Immunol. 147:1107.[Abstract]
  46. Dyer, R. B., N. K. Herzog. 1995. Isolation of intact nuclei for nuclear extract preparation from a fragile B-lymphocyte cell line. BioTechniques 19:192.[Medline]
  47. Hsing, Y., B. S. Hostager, G. A. Bishop. 1997. Characterization of CD40 signaling determinants regulating nuclear factor-{kappa}B activation in B lymphocytes. J. Immunol. 159:4898.[Abstract]
  48. Smith, D. B., K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31.[Medline]
  49. Hibi, M., A. Lin, T. Smeal, A. Minden, M. Karin. 1993. Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev. 7:2135.[Abstract/Free Full Text]
  50. Latinis, K. M., G. A. Koretzky. 1996. Fas ligation induces apoptosis and JNK activation independently of CD45 and Lck in human T cells. Blood 87:871.[Abstract/Free Full Text]
  51. Hostager, B. S., I. M. Catlett, G. A. Bishop. 2000. Recruitment of CD40 and TRAFs 2 and 3 to membrane microdomains during CD40 signaling. J. Biol. Chem. 275:15392.[Abstract/Free Full Text]
  52. Ardila-Osorio, H., B. Clausse, Z. Mishal, J. Wiels, T. Tursz, P. Busson. 1999. Evidence of LMP1-TRAF3 interactions in glycosphingolipid-rich complexes of lymphoblastoid and nasopharyngeal carcinoma cells. Int. J. Cancer 81:645.[Medline]
  53. van den Hoff, M. J., A. F. Moorman, W. H. Lamers. 1992. Electroporation in ’intracellular’ buffer increases cell survival. Nucleic Acids Res. 20:2902.[Free Full Text]
  54. Berberich, I., G. L. Shu, E. A. Clark. 1994. Cross-linking CD40 on B cells rapidly activates NF-{kappa}B. J. Immunol. 153:4357.[Abstract]
  55. Miller, W. E., G. Mosialos, E. Kieff, N. Raab-Traub. 1997. Epstein-Barr virus LMP1 induction of the epidermal growth factor receptor is mediated through a TRAF signaling pathway distinct from NF-{kappa}B activation. J. Virol. 71:586.[Abstract]
  56. Eliopoulos, A. G., S. M. S. Blake, J. E. Floettmann, M. Rowe, L. S. Young. 1999. Epstein-Barr virus-encoded LMP1 activates the JNK pathway through its extreme C terminus via a mechanism involving TRADD and TRAF2. J. Virol. 73:1023.[Abstract/Free Full Text]
  57. Wang, F., C. Gregory, C. Sample, M. Rowe, D. Liebowitz, R. Murray, A. Rickinson, E. Kieff. 1990. Epstein-Barr virus LMP1 and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23. J. Virol. 64:2309.[Abstract/Free Full Text]
  58. Bishop, G. A., W. D. Warren, M. T. Berton. 1995. Signaling via MHC class II molecules and antigen receptors enhances the B cell response to gp39/CD40 ligand. Eur. J. Immunol. 25:1230.[Medline]
  59. Baccam, M., G. A. Bishop. 1999. Membrane-bound CD154, but not CD40-specific antibody, mediates NF-{kappa}B-independent IL-6 production in B cells. Eur J. Immunol. 29:3855.[Medline]
  60. Hsing, Y., G. A. Bishop. 1999. Requirement for NF-{kappa}B activation by a distinct subset of CD40-mediated effector functions in B lymphocytes. J. Immunol. 162:2804.[Abstract/Free Full Text]
  61. Hostager, B. S., G. A. Bishop. 1999. Cutting edge: contrasting roles of TRAF2 and TRAF3 in CD40-activated B lymphocyte differentiation. J. Immunol. 162:6307.[Abstract/Free Full Text]
  62. Yeh, W. C., A. Shahinian, D. Speiser, J. Kraunus, F. Billia, A. Wakeham, J. L. de la Pompa, D. Ferrick, B. Hum, N. Iscove, et al 1997. Early lethality, functional NF-{kappa}B activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity 7:715.[Medline]
  63. Izumi, K. M., E. C. McFarland, A. T. Ting, E. A. Riley, B. Seed, E. D. Kieff. 1999. The Epstein-Barr virus oncoprotein LMP1 engages the tumor necrosis factor receptor-associated proteins TRADD and receptor-interacting protein (RIP) but does not induce apoptosis or require RIP for NF-{kappa}B activation. Mol. Cell. Biol. 19:5759.[Abstract/Free Full Text]
  64. Kieser, A., C. Kaiser, W. Hammerschmidt. 1999. LMP1 signal transduction differs substantially from TNF receptor 1 signaling in the molecular functions of TRADD and TRAF2. EMBO J. 18:2511.[Medline]
  65. Jalukar, S. V., B. S. Hostager, G. A. Bishop. 2000. Characterization of the roles of TRAF6 in CD40-mediated B lymphocyte effector functions. J. Immunol. 164:623.[Abstract/Free Full Text]
  66. Ishida, T., S. Mizushima, S. Azuma, N. Kobayashi, T. Tojo, K. Suzuki, S. Aizawa, T. Watanabe, G. Mosialos, E. Kieff, T. Yamamoto, J. Inoue. 1996. Identification of TRAF6, a novel tumor necrosis factor receptor-associated factor protein that mediates signaling from an amino-terminal domain of the CD40 cytoplasmic region. J. Biol. Chem. 271:28745.[Abstract/Free Full Text]
  67. Erickson, K. D., J. M. Martin. 2000. The late lytic LMP-1 protein of EBV can negatively regulate LMP-1 signaling. J. Virol. 74:1057.[Abstract/Free Full Text]
  68. Brennan, P., J. E. Floettmann, A. Mehl, M. Jones, M. Rowe. 2001. Mechanism of action of a novel LMP1 dominant negative. J. Biol. Chem. 276:1195.[Abstract/Free Full Text]
  69. Ni, C. Z., K. Welsh, E. Leo, C. K. Chiou, H. Wu, J. C. Reed, K. R. Ely. 2000. Molecular basis for CD40 signaling mediated by TRAF3. Proc. Natl. Acad. Sci. USA 97:10395.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
O. Ikeda, Y. Sekine, T. Yasui, K. Oritani, K. Sugiyma, R. Muromoto, N. Ohbayashi, A. Yoshimura, and T. Matsuda
STAP-2 Negatively Regulates both Canonical and Noncanonical NF-{kappa}B Activation Induced by Epstein-Barr Virus-Derived Latent Membrane Protein 1
Mol. Cell. Biol., August 15, 2008; 28(16): 5027 - 5042.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. L. Rowland, M. M. Tremblay, J. M. Ellison, L. L. Stunz, G. A. Bishop, and B. S. Hostager
A Novel Mechanism for TNFR-Associated Factor 6-Dependent CD40 Signaling
J. Immunol., October 1, 2007; 179(7): 4645 - 4653.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. A. Mainou, D. N. Everly Jr., and N. Raab-Traub
Unique Signaling Properties of CTAR1 in LMP1-Mediated Transformation
J. Virol., September 15, 2007; 81(18): 9680 - 9692.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Wu, P. Xie, K. Welsh, C. Li, C.-Z. Ni, X. Zhu, J. C. Reed, A. C. Satterthwait, G. A. Bishop, and K. R. Ely
LMP1 Protein from the Epstein-Barr Virus Is a Structural CD40 Decoy in B Lymphocytes for Binding to TRAF3
J. Biol. Chem., September 30, 2005; 280(39): 33620 - 33626.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. T. Lu, R. L. Dryer, C. Song, and L. R. Covey
Maintenance of the CD40-related immunodeficient response in hyper-IgM B cells immortalized with a LMP1-regulated mini-EBV
J. Leukoc. Biol., September 1, 2005; 78(3): 620 - 629.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Xie and G. A. Bishop
Roles of TNF Receptor-Associated Factor 3 in Signaling to B Lymphocytes by Carboxyl-Terminal Activating Regions 1 and 2 of the EBV-Encoded Oncoprotein Latent Membrane Protein 1
J. Immunol., November 1, 2004; 173(9): 5546 - 5555.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. Xie, B. S. Hostager, and G. A. Bishop
Requirement for TRAF3 in Signaling by LMP1 But Not CD40 in B Lymphocytes
J. Exp. Med., March 1, 2004; 199(5): 661 - 671.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. S. Hostager, S. A. Haxhinasto, S. L. Rowland, and G. A. Bishop
Tumor Necrosis Factor Receptor-associated Factor 2 (TRAF2)-deficient B Lymphocytes Reveal Novel Roles for TRAF2 in CD40 Signaling
J. Biol. Chem., November 14, 2003; 278(46): 45382 - 45390.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Ning, A. M. Hahn, L. E. Huye, and J. S. Pagano
Interferon Regulatory Factor 7 Regulates Expression of Epstein-Barr Virus Latent Membrane Protein 1: a Regulatory Circuit
J. Virol., September 1, 2003; 77(17): 9359 - 9368.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. A. Bishop, B. S. Hostager, and K. D. Brown
Mechanisms of TNF receptor-associated factor (TRAF) regulation in B lymphocytes
J. Leukoc. Biol., July 1, 2002; 72(1): 19 - 23.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. D. Brown, B. S. Hostager, and G. A. Bishop
Regulation of TRAF2 Signaling by Self-induced Degradation
J. Biol. Chem., May 24, 2002; 277(22): 19433 - 19438.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busch, L. K.
Right arrow Articles by Bishop, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Busch, L. K.
Right arrow Articles by Bishop, G. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS