|
|
||||||||
,
,
*
Molecular Biology Graduate Program and Departments of
Microbiology and
Internal Medicine, University of Iowa, Iowa City, IA 52242; and
Veterans Affairs Medical Center, Iowa City, IA 52242
| Abstract |
|---|
|
|
|---|
B and
c-Jun N-terminal kinase. To better understand LMP1 signaling in
B lymphocytes, we performed a structure-function analysis of the LMP1
C-terminal cytoplasmic domain stably expressed in B cell lines. Our
results demonstrate that LMP1-stimulated Ig production, surface
molecule up-regulation, and NF-
B and c-Jun N-terminal kinase
activation require both CTAR1 and CTAR2, and that these two regions may
interact to mediate LMP1 signaling. Furthermore, we find that the
function of CTAR1, but not CTAR2, correlates with TRAF binding and
present evidence that as yet unidentified cytoplasmic proteins may
associate with LMP1 to mediate some of its signaling
activities. | Introduction |
|---|
|
|
|---|
During in vitro infection, EBV transforms primary human B lymphocytes from peripheral blood (4) into semiactivated lymphoblastoid cell lines (LCL),3 while in vivo the virus persistently infects memory B cells (5). EBV encodes >85 genes, but only 9 viral proteins are produced in LCL (reviewed in Refs. 6, 7). Of these nine, only Epstein-Barr nuclear Ags, 1, 2, 3A, and 3C, and latent membrane protein 1 (LMP1) are required for EBV-mediated B cell transformation (8, 9, 10). Not only is LMP1 required for B cell transformation by EBV, it is also the only EBV protein demonstrated to be directly oncogenic in rodent fibroblast cell lines (11, 12). However, although LMP1 is expressed in the majority of EBV-associated malignancies, LMP1 expression alone is not sufficient to transform primary human B cells (13).
The LMP1 protein consists of a short amino-terminal cytoplasmic domain,
six transmembrane domains, and a 200-aa carboxyl-terminal (CT)
domain (14). Although the protein lacks any recognizable
enzymatic motifs, LMP1 expression is sufficient to activate B
lymphocytes in culture, leading to increased surface expression of
activation Ags and adhesion molecules (15), and activation
of NF-
B (16, 17) and c-Jun N-terminal kinase (JNK)
(18, 19). More recent work has demonstrated that
aggregation of the LMP1 CT is required and sufficient to induce LMP1
signaling (20, 21, 22). The multitransmembrane domain LMP1
self-aggregates in the plasma membrane (15) and, as a
result, has constitutive signaling activity (20). LMP1
mimics CD40 signaling in B cells (22, 23), although
important differences in LMP1 vs CD40 signaling in B cells and other
cell types have been noted (24, 25).
Two regions have been identified as important in LMP1 signaling,
CT-activating region (CTAR) 1, aa 194232, and CTAR2, aa 351386
(26). The LMP1 CT has been shown to bind to several
intracellular adapter proteins. TNFR-associated factors (TRAFs) 1, 2,
3, and 5 bind via the PXQXT motif in CTAR1 (27, 28), the
TNFR-associated death domain protein (TRADD) binds via CTAR2
(29), and the Janus kinase 3 binds via a box 1 motif now
called CTAR3 (30). For LCL formation, CTAR1 is required,
CTAR2 contributes, and CTAR3 is dispensable in LCL formation
(31, 32, 33). Although both CTAR1 and CTAR2 play roles in
NF-
B activation, CTAR2 is a stronger activator of the transcription
factor (34, 35) and is solely responsible for JNK
activation (19). However, it is not clear that all of the
aforementioned structure-function requirements apply to LMP1 signaling
in B cells, as the majority of the studies cited obtained data using
transiently overexpressed LMP1 in epithelial cell lines.
In this study, we examine the ability of LMP1 CT mutants to signal in
stably transfected B cell lines. Investigating LMP1 signaling in B
lymphocytes is critical because B cells are the ultimate target of EBV
infection in vivo. The mutations of the LMP1 CT were designed to
determine CTAR function and were generated within the context of human
(h) CD40LMP1 chimeric molecules (25) to allow control of
the initiation of LMP1 signaling. Using this approach, we found that
CTAR1 and CTAR2 play equally important roles in LMP1-induced B cell
NF-
B and JNK activation as well as in up-regulation of CD80 and
stimulation of Ig secretion. Furthermore, CTAR1 and CTAR2 can
functionally cooperate in signaling. Mutations that disrupt the
function of CTAR1 also disrupt TRAF binding. However, the mutations
that disrupted CTAR2 function could not be correlated with the ability
to bind any known cellular proteins, indicating that LMP1 signaling to
B cells is additionally mediated through one or more as yet
unidentified factors.
| Materials and Methods |
|---|
|
|
|---|
M12.4.1 and CH12.LX are mouse B lymphoma cell lines, which have been described previously (36, 37), and were cultured in RPMI 1640 supplemented with 10% FCS, 10 µM 2-ME, and antibiotics (B cell medium with 10% FCS (BCM-10)). Cell lines were stably transfected with hCD40LMP1 constructs, as described elsewhere (38), and were maintained in 400 µg/ml geneticin (Life Technologies, Grand Island, NY) in BCM-10. Transcomplementation mutants were maintained in BCM-10 with 400 µg/ml geneticin and 600 µg/ml hygromycin B (Calbiochem, La Jolla, CA). Chinese hamster ovary (CHO-KI) cells, obtained from the American Type Culture Collection (Manassas, VA), were cultured in DMEM (high glucose) supplemented with 10% FCS, 1x MEM nonessential amino acids (Sigma, St. Louis MO), 10 µM 2-ME, and antibiotics (DMEM-10). CHO cells expressing human CD154 (CHO.hCD154) were kindly provided by Dr. A. Black (IDEC Pharmaceuticals, San Diego, CA) and were maintained in DMEM-10 supplemented with 50 nM methotrexate. Sheep erythrocytes, used as a source of Ag for CH12.LX cells, were purchased from Elmira Biologicals (Iowa City, IA).
Antibodies
The mAbs 16/10A1 (FITC-labeled anti-mouse CD80-FITC, Armenian hamster IgG) and G235-2356 (FITC-labeled isotype control, Armenian hamster IgG) were purchased from BD PharMingen (San Diego, CA). MOPC-21 (isotype control, mouse IgG1) was purchased from Sigma. Goat anti-rabbit IgG-HRP and goat anti-mouse IgG-HRP were purchased from Bio-Rad (Hercules, CA). The polyclonal Abs anti-mouse TRAF2 (C-20), TRAF1 (N-19), and TRAF3 (H122) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
The following hybridomas were purchased from the American Type Culture
Collection and grown in our laboratory, or were the generous gifts from
the indicated individuals: anti-hCD40 (G28-5, mouse IgG1);
anti-mouse CD54 (YN1/1.7.4, rat IgG2a); anti-mouse CD11
(M17/4.4.11.9, rat IgG2a); anti-mouse CD40 (1C10, rat IgG2a): Dr.
F. Lund (Trudeau Institute, Saranac Lake, NY); anti-mouse IgE
(EM95.3, isotype control, rat IgG2a) and anti-mouse CD23 (B3B4, rat
IgG2a): Dr. T. Waldschmidt (University of Iowa, Iowa City, IA);
anti-LMP1 (S12, mouse IgG2a): Dr. F. Wang (Harvard University,
Boston, MA); anti-HLA-A2 (CR11-351, isotype control, mouse IgG1):
Dr. C. Lutz (University of Iowa).
DNA constructs
The hCD40LMP1 construct was generated by PCR SOEing
(39) as described previously (25). The
hCD40LMP1 mutants
213232, C
53, Sub2, and Sub4 were made using
the same primers (5' primer, AAGTCGACGCCTCGCTCGGGCGCCA; 3' primer,
AATCTAGAAAGCCTATGACATGGTAATGCC; SOEing primer,
CATCACTGTGTCGTTGTCATGGATAAAGACCAGCACCAAGAG) with LMP1 templates
p1342 (34), p907 (40), p1649, and p1651
(41), respectively, all of which were the generous gift
from Dr. B. Sugden (University of Wisconsin, Madison, WI). phCD40LMP1
PQAA3 was made with the same method as hCD40LMP1 but used
AATCTAGAGGTTAGTCATAGTAGCTTAGAGCAACTGCGCCGTGGGGGTCGTCAT as the
3' primer. The PQAA1 and PQAA2 mutations were made by SOEing using the
template phCD40LMP1 and the same 5' and 3' primers. SOEing primers were
GACTCCCTCCCGCACGCTCAAGCAGCTACCGATGATTCTGG and
GGAAATGATGGAGGCGCACCTGCATTGACGGAAGAGGTTGA, respectively. The
hCD40LMP1 CTAR1 construct was generated by using the 3' primer
CGTCTAGAGTCAGTTTTGAGAGCAGAGTG which introduces a stop codon following
LMP1 aa 241. The hCD40LMP1 CTAR1 and all PCR SOEing products were
cloned into the pRSV.5(neo) plasmid (42) using
SalI and XbaI for stable expression in B cells.
Mutants utilizing the external and transmembrane domains of the HLA-A2
molecule linked to the cytoplasmic domain of LMP1 used as a template a
wild-type (wt) version of this chimeric protein (A2LMP1) that has been
previously characterized and shown to signal B cells similarly to Wt
LMP1 (22). A2LMP1 PQAA1 and A2LMP1 CTAR2 were generated in
a similar manner to A2LMP1, except that
AAGGATCCATAATGGGCCTAGGCGCACCTGGAGGT was used as the 5' primer for
A2LMP1 CTAR2. The A2LMP1 constructs were subcloned into pRSV.5(hyg)
(42) for stable expression in B cells. The nucleotide
sequence of all PCR products was verified. Constructs were stably
transfected into B cells using electroporation as described elsewhere
(38). Expression-matched clones were selected and all
experiments were verified with two separate clones.
Ab secretion assay
CH12.LX and its transfected subclones express surface IgM specific for phosphatidylcholine, an Ag found on the surface of SRBC (43). Cells (1.5 x 103/200 µl) were stimulated in flat-bottom 96-well microtiter plates for 3 days with 0.1% SRBC, 1 µg/ml anti-mCD40, or 1 µg/ml anti-hCD40 before enumeration of SRBC-specific IgM-secreting cells by direct hemolytic plaque assay, as described previously (44, 45). During the transcomplementation assays, cells were stimulated with 1 µg/ml anti-mouse (m) CD40 Ab (1C10) or with combinations of 1 µg/ml isotype control (MOPC-21), anti-A2 (CR11-351), or anti-hCD40 (G28-5) Abs to total 2 µg/ml mAb in the presence or absence of 1 µg/ml goat anti-mouse IgG, F(ab')2 (Jackson ImmunoResearch Laboratories, West Grove, PA).
Surface molecule up-regulation
M12.4.1 cells expressing wt hCD40LMP1 or hCD40LMP1 mutants were stimulated, as previously described (37), for 72 h with 0.2 µg/ml isotype control or anti-hCD40 Abs (CR11-351 or G28-5), or with 2 µg/ml isotype control or anti-mCD40 Abs (EM-95 or 1C10). For the transcomplementation assay, cells were stimulated for 72 h with 2 µg/ml isotype control or anti-mCD40 Abs or combinations of 0.1 µg/ml biotinylated isotype control (MOPC-21), anti-A2 (CR11-351), or anti-hCD40 (G28-5) Abs to total 0.2 µg/ml Ab in the presence or absence of 0.1 µg/ml avidin (Sigma). Cells were stained with FITC-labeled mAb against surface markers or FITC-labeled isotype control mAb. Staining was detected by immunofluorescence flow cytometry using a FACScan bench top flow cytometer (BD Biosciences, Mountain View, CA). Mean channel fluorescence was determined by WinMDI 2.8 (http:facs.scripps.edu). Mean channel fluorescence shift (MCFS) was calculated as follows: (specific staining - isotype staining) of stimulated cells - (specific staining - isotype staining) of isotype-stimulated cells.
Nuclear extraction and EMSA
Viable cells (5 x 106) were
stimulated for 3 h with 1 µg/ml mAb at a concentration of 1
x 106 cells/ml. This time point was chosen as
maximal for LMP1-stimulated NF-
B nuclear translocation, which is
sustained compared with CD40-stimulated translocation
(25). Both nuclear extraction and EMSA were performed as
previously described (46, 47) except the binding buffer
used was 10 mM Tris (pH 7.5), 150 mM KCl, 0.5 mM EDTA, 1 mM
MgCl2, 0.1% Triton X-100, 12.5% glycerol, and 1
mM DTT. The gel was dried and used to expose x-ray film overnight at
-70°C. Radiodensitometry was performed using the Packard Instant
Imager (Packard Instrument, Downers Grove, IL).
In vitro Jun kinase assay
The pGEX-GST-c-Jun(1-79) plasmid was a gift from Dr. G. Koretzky (University of Pennsylvania, Philadelphia, PA). The GST-c-Jun(1-79) was expressed and affinity purified using glutathione-agarose beads (Sigma) as described elsewhere (48). M12.hCD40LMP1 and M12 expressing hCD40LMP1 mutants were stimulated at 2 x 106 cells/1 ml per 3 µg of mAb for 30 min at 37°C. An in vitro kinase assay was performed as described previously (49, 50). The kinase reactions were stopped by the addition of 2x SDS-PAGE loading dye and were separated by SDS-PAGE. Gels were dried, and phosphorylated c-Jun was visualized by autoradiography. Radiodensitometry was performed using the Packard Instant Imager (Packard Instrument).
Immunoprecipitation from detergent-insoluble microdomains (rafts) and Western blotting
M12.hCD40LMP1- and M12-expressing hCD40LMP1 mutants were
stimulated at 2 x 107 cells/2.5 x
106 CHO cells per 1 ml for 10 min at 37°C to
allow the LMP1 signaling complexes to form. Cells were lysed in 400
µl of Brij lysis buffer, which does not disrupt rafts
(51). Supernatants were removed and raft-containing
pellets were resolubilized in 400 µl of octylglucoside buffer (based
on Ref. 52 ; 60 mM octylglucopyranoside, 150 mM NaCl, 20 mM
Tris (pH 7.5), 50 mM
-glycerophosphate, 1% Triton X-100, and 0.1%
SDS) by sonication, followed by a 30-min incubation on ice. The
octylglucoside lysate was clarified by centrifugation at
14,000
x g for 10 min at 4°C to remove the remaining insoluble
material. The supernatant was then rotated with protein G-agarose beads
(Sigma) armed with anti-hCD40 for 2 h at 4°C. The immune
complexes were washed four times with octylglucoside buffer (minus
octylglucoside), separated by SDS-PAGE, transferred to Immobilon-P
(Millipore, Bedford, MA), and sequentially blotted for TRAF2, TRAF1,
TRAF3, and LMP1. Visualization was performed with a chemiluminescent
detection system (Pierce, Rockford, IL). Quantification of
chemiluminescence was done using the Fuji Film Intelligent Dark Box,
image reader Las-1000, V1.01, and image gauge V3.12 (Fuji Medical
Systems USA, Stamford, CT).
NF-
B reporter assay
M12 subclones expressing both hCD40LMP1CTAR1 and
A2LMP1CTAR2 were electroporated at 4 x 107
B cells/400 µl cytomix (53) per 36 µg 4x
NF-
B luciferase reporter construct/4 µg of pRL-null
(Promega, Madison, WI). The 4x NF-
B construct contains four copies
of the NF-
B binding sites from the promoter of the invariant chain
of MHC II to drive luciferase (54) and the pRL-null was
used to control for transfection efficiency. The transfection was done
using the BTX ECM 830 square wave electroporator (Genetronics, San
Diego, CA) set for 225 V and 30 ms. Transfections were rested on ice
for 15 min. Then they were evenly divided between 10 wells and
stimulated with 10 µg (each) of 1C10, EM95, or with combinations of
10 µg/ml biotinylated isotype control (MOPC-21), anti-A2
(CR11-351), or anti-hCD40 (G28-5) Abs to total 20 µg/ml Ab in the
presence or absence of 10 µg/ml avidin (Sigma). Cells were harvested
(5 x 105) and prepared as per the
manufacturers instructions (Promega Dual Luciferase kit; Promega).
Luciferase activity was measured on the TD-20/20 Luminometer (Turner
Designs, Sunnyvale, CA) using a 2-s delay and 10-s read time.
| Results |
|---|
|
|
|---|
To understand the importance of structural features of the LMP1 CT in B cell signaling, we generated mutations of the CT in the context of a hCD40LMP1 chimeric receptor (hCD40 extracellular and transmembrane fused to the LMP1 CT) (25). We chose to use the chimeric system for expression of LMP1 mutants because the wt LMP1 self-associates and constitutively signals, whereas the chimera will only signal when agonistic Ab or cells expressing hCD154 are present. This allows us to control the initiation of signaling, and we have previously shown that this technique results in signal indistinguishable from wt LMP1 (22, 25). Both wt CD40 and hCD40LMP1 translocate to lipid-enriched membrane microdomains when engaged; LMP1 localizes constitutively to microdomains (25). The different chimeras were stably transfected into the mouse B cell lines M12.4.1 or CH12.LX and selected for matching surface expression of the chimera. The endogenous mCD40 of each cell line was used as an internal control in all signaling experiments.
Mutations were made in the LMP1 CT as described in Materials and
Methods and are outlined in Fig. 1
.
They were chosen to dissect the roles of CTAR1 and CTAR2,
(26) in LMP1 signaling to B cells, as discussed in the
Introduction. To examine the role of CTAR1, we used two point mutants,
Sub2 and Sub4, which change charged amino acids (H203, D209, D209, and
E221, R223, H224, H225, respectively) to alanines within the CTAR1
region and were shown to decrease TRAF3 binding by 90% in GST fusion
protein experiments (41). Additionally, we examined the
mutant
213232 (34), which deletes the second half of
the CTAR1 region, including the region changed in the Sub4 mutation. To
examine the role of CTAR2, we tested C
53 (40), which
deletes the last 53 aa of LMP1, including the entire CTAR2 region. To
individually examine the role of the three PXQXT motifs in LMP1
signaling, we changed the proline and glutamine in the motif to
alanines. PQAA1 (residues P204 and Q206) is in the first motif, which
resides in CTAR1, and is the only motif that has been implicated in
TRAF binding to LMP1. Likewise, the second motif mutation is designated
PQAA2 (P320 and Q222), and the third motif mutation, which resides in
CTAR2, is called PQAA3 (PQ379 and Q381). We also mutated all three
PXQXT motifs simultaneously (PQAA1, 2, 3), to see whether there is any
redundancy in the function of the motifs in LMP1 signaling. Other
groups have used PQAA or PQTAAA mutations as "CTAR dead" mutations
(21, 55, 56).
|
Upon activation by both CD40 and LMP1, a B cell will up-regulate
several surface molecules including CD23, CD80, and adhesion molecules
such as CD11
(LFA-1) and CD54 (ICAM-1) (22, 37, 57). To
test the effect of the LMP1 CT mutations on the up-regulation of these
molecules, transfected M12.4.1 cell lines were stimulated for 72
h. M12 subclones were examined for this function as they have
relatively low basal expression of surface molecules and therefore
demonstrate better up-regulation than CH12.LX subclones which have
higher basal expression of molecules, allowing differences between LMP1
mutants to be more readily detected. Two of the CT mutants, C
53 and
213232, were also cloned into an
isopropyl-
-D-thiogalactopyranoside-inducible system in
the context of the full-length LMP1 molecule (22) and were
tested for their ability to stimulate CD80 up-regulation in stably
transfected M12.4.1 lines. This allowed us to once again confirm that
the hCD40LMP1 chimeric receptor signals similarly to wt LMP1 (22, 25). As shown in Fig. 2
A, C
53 failed to
up-regulate CD80, while
213232 up-regulated CD80 to a level
similar to wt LMP1. These results were recapitulated in the chimeric
receptor system.
|
213-, Sub4, and PQAA2 were similar to wt LMP1 in
the ability to up-regulate the four surface receptors tested (Fig. 2
53, Sub2, PQAA1, and PQAA1,2,3. In all cases
the defects in CD80 up-regulation were most severe, whereas the defects
in CD23 and CD54 up-regulation were less marked. CD11
up-regulation
was least affected by the CT mutations, although the up-regulation seen
by C
53, Sub2, PQAA1, and PQAA1, 2, and 3 was 2050% lower than for
wt LMP1. The subclone of Sub4 shown in Fig. 2
53, and a
second subclone tested was indistinguishable from wt LMP1. In all
subclones, surface molecule up-regulation by stimulation of mCD40 was
normal (Fig. 2IgM secretion
Production of Ab is the key unique function of the B cell, so we
continued our study of the LMP1 CT mutants by testing their ability to
stimulate Ig secretion in stably transfected B cell subclones. The
mouse B cell line CH12.LX responds to CD40 and LMP1 signaling by
producing phosphatidylcholine-specific IgM (22, 58), so
Ig-secreting cells can be enumerated by a direct plaque-forming cell
assay. CH12.LX and its subclones are not stimulated to produce Ig
following engagement of the B cell Ag receptor, but respond similarly
to signals delivered via endogenous mCD40 or stably transfected hCD40
molecules (37). We have previously shown that the
hCD40LMP1 chimera stimulates 4- to 9-fold more Ig secretion than does
mCD40 (Ref. 25 and Fig. 3
A). Of the LMP1 CT mutants
tested, only
213232 stimulated IgM production as well as did wt
LMP1 (Fig. 3
B). All other mutants, although expressed in
CH12.LX subclones as well as wt hCD40LMP1, showed a decreased ability
to signal, stimulating IgM secretion approximately as well as did
endogenous mCD40. Thus, the LMP1 CT mutants signaled at a reduced
level, similar to hCD40 rather than hCD40LMP1 with a wt CT.
|
CH12.LX cells respond (as do normal splenic B cells) to CD40 or LMP1 signaling by secreting IL-6 (22, 59). The ability of the LMP1 CT mutants to stimulate IL-6 production was measured by an IL-6 specific ELISA following stimulation for 48 h with CHO cells expressing mCD154 or hCD154 (59). All of the LMP1 CT mutants stimulated IL-6 secretion similarly to wt LMP1 (data not shown). This indicates that neither CTAR1 nor CTAR2 are required for this function, suggesting that additional functional motifs in the LMP1 CT remain to be characterized.
NF-
B and JNK activation
Five of the eight mutants tested showed defects in LMP1-induced
IgM secretion and surface molecule up-regulation, but not IL-6
production (see above). Interestingly, studies of CD40 signaling have
shown that Ig production and up-regulation of CD80, CD23, and CD54 are
dependent upon increased NF-
B activation (60), whereas
IL-6 production is not (59). Additionally, both
CD40-induced IgM production and surface molecule up-regulation involve
TRAF2 (37, 61), whereas IL-6 production does not
(59). TRAF2 has also been shown to be important for JNK
activation (51, 62). We thus tested the ability of the
LMP1 CT mutants to activate NF-
B and JNK. All LMP1 CT mutants were
able to activate NF-
B (Fig. 4
, A and B). The majority of the LMP1 mutations
showed a 5060% decrease in activity when compared with the
endogenous mCD40, but the mutants
213232, Sub4, and PQAA2 showed
no detectable defect in NF-
B activation. Results of JNK activation
were qualitatively similar. The mutants
213232, Sub4, and PQAA2
showed no defect in JNK activation, but the other mutants were
completely unable to activate JNK (Fig. 4
, C and
D). This indicates that in B cells, in contrast to
epithelial cell lines, both CTAR1 and CTAR2 play functionally important
roles in NF-
B and JNK activation, and that both must be intact for
optimal LMP1 signaling.
|
The next question addressed was whether the defects we saw in Ig
secretion, surface molecule up-regulation, and NF-
B and JNK
activation correlated with the ability to bind to intracellular adapter
proteins such as the TRAFs and TRADD. The ability of the CT mutants to
bind TRAFs and TRADD will provide evidence for or against these adapter
proteins playing an important role in LMP1 signaling in B lymphocytes.
To ensure physiologic relevance of interactions seen between LMP1 and B
cell proteins at their endogenous levels, we performed
immunoprecipitations (IP) from stimulated and unstimulated B cell
stable transfectants expressing the following mutants: hCD40LMP1,
C
53, PQAA3, Sub2, Sub4, and
213232. These mutants were chosen
for analysis because they affect the CTAR1 and CTAR2 regions and showed
functional defects in B cell activation (see above). Both LMP1 and CD40
signal from detergent-insoluble membrane microdomains or rafts
(51, 52), as does the chimeric hCD40LMP1
(25); therefore, the IP was done from material enriched in
rafts.
As expected (25), there was more hCD40LMP1 and associated
proteins present in the membrane rafts from cells that had received a
hCD154 stimulus (Fig. 5
), although the
total amount of hCD40LMP1 in the precipitates varied between cell
lines. TRAFs 1, 2, and 3 were easily found in the hCD40LMP1 IP and were
detectable in precipitates from cells expressing the various CT
mutants. Only the Sub2 mutation showed a consistent, substantial 80%
decrease in the ability to bind to TRAF proteins, which was even more
striking considering that the IP of Sub2 was typically more efficient
than hCD40LMP1 although the two lines had similar surface expression of
hCD40. Although the mutants C
53 and PQAA3, which have dramatic
signaling defects, did show a 2040% decrease in their ability to
bind to TRAF proteins, this was not significantly different from the
decrease in TRAF binding seen with Sub4 and
213232, both of which
signal indistinguishably from wt LMP1 CT in all (
213232) or most
(Sub4) B cell effector assays. The IP were also blotted for TRADD;
however a TRADD-LMP1 interaction was never seen, even in the context of
the wt CT (data not shown). Perhaps the interaction was not detectable
due to the small amount of endogenous TRADD present in B cells.
However, we could detect TRADD in cellular lysates and TRADD was not
observed to move to Brij 58-insoluble microdomains (rafts) upon LMP1
signaling (data not shown).
|
Mutations in CTAR1 and CTAR2 have a similar phenotype, but only
CTAR1 function correlates with TRAF binding (Fig. 5
), suggesting that
either the two nonredundant regions physically interact during
signaling or that they initiate converging signaling pathways, both of
which need to be present for optimal signaling to occur. To examine
CTAR interaction in B cells, M12.4.1 and CH12.LX B cells were stably
transfected with both an HLA-A2LMP1 CTAR2 chimera (LMP1 aa
242386, see Materials and Methods) and a hCD40LMP1 CTAR1
chimera (LMP1 aa 187241, see Materials and Methods). This
allows us to signal through either CTAR separately with mAbs or to
supercrosslink the mAbs with an anti-IgG secondary Ab or avidin and
biotinylated primary mAbs, which will bring the CTARs into physical
proximity.
As seen in Fig. 6
A, either
CTAR alone stimulated IgM secretion similarly to endogenous mCD40. The
combination of the two CTARs is also similar to endogenous mCD40;
however, the supercrosslinking of both CTARs simultaneously produces a
marked increase in IgM secretion. The supercrosslinking of either CTAR
alone was identical to the stimulation seen in the absence of
supercrosslinking (data not shown). Biotinylated primary mAbs and
avidin were used to stimulate the M12 subclones because M12.4.1
expresses a very low level of surface IgG and we wanted to avoid
cross-linking the B cell Ag receptor. In M12 subclones, either CTAR
alone is largely unable to stimulate CD80 up-regulation, but signaling
through both molecules induces a 7- to 10-fold greater CD80
up-regulation when compared with either CTAR alone (Fig. 6
B). The addition of avidin to supercrosslink the chimeras
results in a small, but reproducible additional increase in CD80
up-regulation following stimulation by both Abs, but not when
stimulating through either chimera alone. We could not detect
transcomplementation of JNK by in vitro kinase assay or of NF-
B by
EMSA (data not shown), but some cooperation between the CTARs was seen
in a NF-
B reporter assay (Fig. 6
C). However,
supercrosslinking had no additional effect on NF-
B reporter
activity. Similar results were seen when experiments were performed
using a hCD40LMP1 PQAA3-A2LMP1 PQAA1 transcomplementation system.
|
B
reporter assay. Because supercrosslinking does not restore LMP1
signaling to that seen with the wt LMP1 CT, we cannot rule out
the possibility that the two CTARs activate separate but converging
signaling pathways. However, both CD40LMP1 and A2LMP1 chimeras signal
from Brij 58-insoluble membrane microdomains (Ref. 25 and
L. K. Busch, unpublished observation). Thus, it is possible that
the microdomains are small enough to concentrate the chimeras and allow
for physical cooperation between the CTARs, hence supercrosslinking
does little to enhance cooperation. | Discussion |
|---|
|
|
|---|
B and JNK activation by LMP1 in B cells as well as in
LMP1-mediated Ig secretion and surface molecule up-regulation,
summarized in Fig. 7
B activation
(26, 34) and plays no role in JNK activation
(19). However, those studies were performed by transiently
overexpressing both LMP1and epitope-tagged JNK or artificial NF-
B
reporter plasmids, usually in the transformed epithelial cell line 293.
Our results indicate that both CTAR1 and CTAR2 play essential,
distinct, and similarly important roles in LMP1 signaling in B
lymphocytes, the target of EBV infection in vivo.
|
|
B activation (Table I
213232, Sub4, and PQAA2 were able
to stimulate most B cell effector functions as robustly as the wt LMP1
CT. This indicates that the second PXQXT motif does not play a major
role in LMP1 signaling in B lymphocytes. However, PQAA2 and Sub4 both
showed a partial decrease in stimulation of Ig secretion (Fig. 2
213232 does not differ significantly from the wt CT, and Sub4 is
similarly not defective in delivering other LMP1-mediated B cell
activation signals. It may be that the point mutations made in Sub4
allow association with an uncharacterized negative regulatory protein
that is not bound by wt LMP1, and whose binding site is of course
removed in
213232. Because the IgM secretion assay is more
sensitive to LMP1 alterations than other assays, it may detect subtle
negative regulation better or such regulation may be specific to this
particular function. These ideas will require further
investigation.
LMP1 is believed to mediate signaling via the TRAF proteins, a
family of adapter molecules that bind to the PXQXT motif in CTAR1 of
LMP1 (27), and by TRADD, which binds to CTAR2 (29, 63). Our data indicating mutations within CTAR1 affect
LMP1-stimulated effector functions support a role for the TRAF proteins
in LMP1 signaling, but also indicate involvement of other factors. The
CTAR1 mutant Sub2 has a dramatically reduced ability to recruit and
bind to TRAFs 1, 2, and 3 in B cells (Fig. 5
), but stimulates IL-6
secretion at wt levels (data not shown) and still partially mediates
NF-
B activation and CD23, CD11
, and CD54 up-regulation (Figs. 2
and 4
), indicating that these signaling pathways are at least partially
TRAF independent.
Interestingly, CTAR2 mutations also show functional defects in LMP1
signaling to B cells (Table I
), although these mutants bind to the TRAF
proteins at levels similar to Sub4 and
213232, which do not show
the same signaling defects (Fig. 5
). This finding also supports a role
for TRAF-independent mechanisms of LMP1-mediated B cell activation.
TRADD is an obvious candidate for a CTAR2-interacting protein in B
cells, but controversy remains about whether LMP1 interacts with the
death domain (29) or the TRAF-interacting domain
(64) of TRADD. Although we cannot rule out a role for
TRADD in CTAR2-mediated signal transduction, we feel it is unlikely to
play a major role in LMP1 signaling to B cells, as we were unable to
detect recruitment of endogenous TRADD or a stably transfected TRADDGFP
to LMP1 signaling complexes in B cells (data not shown). Similar
findings have been reported in nasopharyngeal carcinoma cells
(52). Although the identity of crucial CTAR2 binding
protein(s) remains unknown, it is clear that TRAFs alone cannot mediate
all LMP1 signaling. It has been demonstrated that TRAF6 is the only
known TRAF important to CD40-mediated IL-6 secretion in B cells
(59, 65). However, LMP1 stimulates IL-6 secretion in B
cells (22) but does not bind to TRAF6 (28, 66). Furthermore, mutations in either CTAR1 or CTAR2 showed no
reduction in stimulation of IL-6 secretion (data not shown), indicating
that LMP1 has a TRAF-independent route to IL-6 secretion or that it is
using as yet uncharacterized TRAF homologues.
The finding that CTAR1 and CTAR2 mutants have similar phenotypes
suggests that the regions physically cooperate in LMP1 signaling or
that they mediate separate signaling cascades which converge downstream
to stimulate B cell activation (Fig. 7
). The second possibility is
unlikely since the CTAR double mutant PQAA1,2,3 does not show a further
reduction in its ability to stimulate surface molecule up-regulation,
Ig secretion, or NF-
B activation when compared with single CTAR
mutations. We are able to partially restore CD80 up-regulation and Ig
secretion by concurrently signaling through a hCD40LMP1 CTAR1 and an
A2LMP1 CTAR2 chimera (Fig. 6
). The stimulus is greater after
supercrosslinking, suggesting that the physical proximity of the CTARs
is important. Recent work supports the idea that CTAR-CTAR interactions
are critical both by demonstrating that CTAR transcomplementation can
occur in transiently transfected Jurkat T cells (24), and
that the lytic LMP1 and a CTAR12 mutated LMP1 can function as
inhibitors of LMP1 signaling in a dose-dependent manner (67, 68). It is also relevant to note that simultaneous physical
interactions between distinct regions of the CD40 cytoplasmic domain
and TRAF3 have been proposed on the basis of studies of the crystal
structure of a CD40 CT peptide complexed with a peptide of the TRAF3 C
terminus (69). These findings allows us to propose a model
in which the LMP1 CT folds back upon itself and the CTARs physically
interact via CTAR-interacting proteins (Fig. 7
). Future work will focus
on the nature of the CTAR interaction and identification of novel LMP1
signaling pathways and binding proteins.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Gail A. Bishop, Department of Microbiology, University of Iowa, 3-570 BSB, Iowa City, IA 52242. E-mail address: gail-bishop{at}uiowa.edu ![]()
3 Abbreviations used in this paper: LCL, lymphoblastoid cell line; CHO, Chinese hamster ovary; CT, carboxyl-terminal; CTAR, CT-activating region; IP, immunoprecipitation; JNK, c-Jun N-terminal kinase; LMP1, latent membrane protein 1; MCFS, mean channel fluorescence shift; TRAF, TNFR-associated factor; TRADD, TNFR-associated death domain protein; wt, wild type; h, human; m, mouse. ![]()
Received for publication July 9, 2001. Accepted for publication September 14, 2001.
| References |
|---|
|
|
|---|
B. J. Biol. Chem. 267:24157.
B by targeting the inhibitory molecule I
B
. J. Virol. 69:2168.[Abstract]
B activation. Oncogene 15:1851.[Medline]
B and cell surface phenotype via two effector regions in its carboxy-terminal cytoplasmic domain. Oncogene 10:549.[Medline]
B activation. Mol. Cell. Biol. 16:7098.[Abstract]
B-activating site and the sole TRAF3 binding site of LMP-1 defines two distinct signaling motifs. J. Biol. Chem. 272:19777.
B. Proc. Natl. Acad. Sci. USA 94:12592.
B-mediated transcription by mutant derivatives of the latent membrane protein of EBV. J. Virol. 69:2968.[Abstract]
B activation by LMP1, the EBV transforming protein. Proc. Natl. Acad. Sci. USA 93:11085.
B activation in B lymphocytes. J. Immunol. 159:4898.[Abstract]
B. J. Immunol. 153:4357.[Abstract]
B activation. J. Virol. 71:586.[Abstract]
B-independent IL-6 production in B cells. Eur J. Immunol. 29:3855.[Medline]
B activation by a distinct subset of CD40-mediated effector functions in B lymphocytes. J. Immunol. 162:2804.
B activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity 7:715.[Medline]
B activation. Mol. Cell. Biol. 19:5759.This article has been cited by other articles:
![]() |
J. P. Graham, C. R. Moore, and G. A. Bishop Roles of the TRAF2/3 Binding Site in Differential B Cell Signaling by CD40 and Its Viral Oncogenic Mimic, LMP1 J. Immunol., September 1, 2009; 183(5): 2966 - 2973. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Ikeda, Y. Sekine, T. Yasui, K. Oritani, K. Sugiyma, R. Muromoto, N. Ohbayashi, A. Yoshimura, and T. Matsuda STAP-2 Negatively Regulates both Canonical and Noncanonical NF-{kappa}B Activation Induced by Epstein-Barr Virus-Derived Latent Membrane Protein 1 Mol. Cell. Biol., August 15, 2008; 28(16): 5027 - 5042. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Rowland, M. M. Tremblay, J. M. Ellison, L. L. Stunz, G. A. Bishop, and B. S. Hostager A Novel Mechanism for TNFR-Associated Factor 6-Dependent CD40 Signaling J. Immunol., October 1, 2007; 179(7): 4645 - 4653. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Mainou, D. N. Everly Jr., and N. Raab-Traub Unique Signaling Properties of CTAR1 in LMP1-Mediated Transformation J. Virol., September 15, 2007; 81(18): 9680 - 9692. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wu, P. Xie, K. Welsh, C. Li, C.-Z. Ni, X. Zhu, J. C. Reed, A. C. Satterthwait, G. A. Bishop, and K. R. Ely LMP1 Protein from the Epstein-Barr Virus Is a Structural CD40 Decoy in B Lymphocytes for Binding to TRAF3 J. Biol. Chem., September 30, 2005; 280(39): 33620 - 33626. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Lu, R. L. Dryer, C. Song, and L. R. Covey Maintenance of the CD40-related immunodeficient response in hyper-IgM B cells immortalized with a LMP1-regulated mini-EBV J. Leukoc. Biol., September 1, 2005; 78(3): 620 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Xie and G. A. Bishop Roles of TNF Receptor-Associated Factor 3 in Signaling to B Lymphocytes by Carboxyl-Terminal Activating Regions 1 and 2 of the EBV-Encoded Oncoprotein Latent Membrane Protein 1 J. Immunol., November 1, 2004; 173(9): 5546 - 5555. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Xie, B. S. Hostager, and G. A. Bishop Requirement for TRAF3 in Signaling by LMP1 But Not CD40 in B Lymphocytes J. Exp. Med., March 1, 2004; 199(5): 661 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Hostager, S. A. Haxhinasto, S. L. Rowland, and G. A. Bishop Tumor Necrosis Factor Receptor-associated Factor 2 (TRAF2)-deficient B Lymphocytes Reveal Novel Roles for TRAF2 in CD40 Signaling J. Biol. Chem., November 14, 2003; 278(46): 45382 - 45390. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ning, A. M. Hahn, L. E. Huye, and J. S. Pagano Interferon Regulatory Factor 7 Regulates Expression of Epstein-Barr Virus Latent Membrane Protein 1: a Regulatory Circuit J. Virol., September 1, 2003; 77(17): 9359 - 9368. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Bishop, B. S. Hostager, and K. D. Brown Mechanisms of TNF receptor-associated factor (TRAF) regulation in B lymphocytes J. Leukoc. Biol., July 1, 2002; 72(1): 19 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Brown, B. S. Hostager, and G. A. Bishop Regulation of TRAF2 Signaling by Self-induced Degradation J. Biol. Chem., May 24, 2002; 277(22): 19433 - 19438. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |