| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Schering-Plough Laboratory for Immunological Research, Dardilly, France;
Cell Biology and Institute of Biomembranes, University Medical Centre, Utrecht, The Netherlands;
Institut National de la Santé et de la Recherche Médicale Unité 346, Centre Hospitalier Edouard Herriot, Lyon, France; and
DNAX Research Institute, Palo Alto, CA 94304
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This function is achieved either through macropinocytosis, which allows concentration of solutes present in large volumes of fluid (3), or through specialized surface-membrane endocytic receptors. DC thus express several Ca2+-dependent (C-type) endocytic lectins, exemplified by DEC205 (4), the mannose receptor (MR) (3), or Langerin (5). Cell-surface receptors, such as low-density lipoprotein receptors, transferrin receptors, or scavenger receptors, including type II lectins, are also involved in endocytic processes in other cell types (6, 7, 8). For example, parenchymal cells of mammalian liver and macrophages express hepatic asialoglycoprotein receptor (ASGPR) H1 and H2 subunits, and macrophage-ASGPR (human macrophage lectin (HML)), respectively (9). The HML is homologous to H1 and is a type II lectin with a single Ca2+-dependent carbohydrate recognition domain (CRD), a neck domain, and an intracytoplasmic domain containing internalization motifs (10). Endocytosis and recycling of the hepatic ASGPR receptor, which internalizes desialylated serum glycoproteins with exposed galactose residues, have been well characterized (11). Thus, ligand bound to receptors is directed to coated pits, which bud off to form coated vesicles. The receptor-ligand complex is delivered by these vesicles to endosomes, where dissociation occurs, so that the receptor can recycle to the plasma membrane and the ligand can be directed to other intracellular locations, such as lysosomes.
To identify novel receptors expressed by DC, we searched for lectins selectively expressed by DC subpopulations. Using random sequence analysis, we have characterized the DC-ASGPR as representing isoforms of the HML. The two forms of DC-ASGPR described in this report differ by the presence of a unique 27-aa insert in the extracellular region of the long form. Both forms display a 3-aa deletion as compared with the HML. DC-ASGPR/HML is preferentially expressed in immature monocyte-derived and interstitial-type DC where it localizes both at the cell surface and in early endosomes. Finally, anti-DC-ASGPR mAb rapidly provokes internalization from the DC surface at 37°C. Together, our data demonstrate that DC-ASGPR/HML constitute another set of receptors by which immature DC can efficiently capture Ag.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recombinant human (rh)GM-CSF (specific activity: 2 x
106 U/mg; Schering-Plough Research Institute,
Kenilworth, NJ) was used at a saturating concentration of 100 ng/ml
(200 U/ml). rhTNF-
(specific activity: 2 x
107 U/mg; Genzyme, Boston, MA) was used at an
optimal concentration of 2.5 ng/ml (50 U/ml). Recombinant human stem
cell factor (SCF) (specific activity: 4 x
105 U/mg; R&D Systems, Abington, U.K.) and
rhM-CSF (specific activity: 2 x 106 U/mg;
R&D Systems) were used at an optimal concentration of 25 ng/ml. PBMC
were obtained from healthy donors after Ficoll-Hypaque gradient
centrifugation (density = 1.077; Eurobio, Paris, France). T
cells were purified from PBMC by immunomagnetic depletion (Dynal, Oslo,
Norway) using a mixture of mAbs (CD14, CD16, CD35, HLA-DR
(Immunotech, Marseille, France), CD19 (ascites), NKH1 (Beckman Coulter,
Hialeah, FL), and CD40 (mAb 89, produced in our laboratory)).
The purity of CD3+ T cells was >95%. B cells
were obtained from human tonsils as described (12).
Briefly, T cells were first depleted by rosetting SRBC, and then the
residual non-B cells were removed by immunomagnetic depletion using a
mixture of mAbs (CD2, CD3, CD4, CD14, CD16, NKH1, and CD35). The purity
of CD19+ B cells was >98%. LC were prepared
from normal skin by CD1a positive selection as described
(13). A >95% purity was systematically achieved.
Granulocytes were generated in vitro from CD34+ progenitors in the presence of SCF supplemented with G-CSF for 12 days (14) or isolated from peripheral blood by Polymorphprep gradient (Nycomed, Oslo, Norway). Macrophages were generated in vitro from CD34+ progenitors in the presence of SCF supplemented with M-CSF for 12 days (15). Cells were either resting or activated by PMA-ionomycin (PMA, 1 ng/ml (Sigma-Aldrich, St. Louis, MO); ionomycin, 1 µg/ml (Calbiochem, La Jolla, CA)) for 1 and 6 h and pooled. The MRC5 fibroblastic cell line was obtained from American Type Culture Collection (Manassas, VA) and stimulated by PMA-ionomycin for 1 and 6 h and pooled. Murine fibroblasts transfected with human CD40 ligand (CD40L L cells) were produced in the laboratory (12). All cell types were cultured in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with 10% (v/v) heat-inactivated FBS (Flow Laboratories, Irvine, U.K.), 10 mM HEPES, 2 mM L-glutamine, 5 x 10-5 M 2-ME, penicillin (100 U/ml) and streptomycin (100 µg/ml), hereafter referred to as complete medium.
Generation of DC from CD34+ cells and from monocytes
Umbilical cord blood samples were obtained according to
institutional guidelines. Isolation of CD34+
progenitors was achieved using Minimacs separation columns (Miltenyi
Biotec, Bergish Gladbach, Germany) as described (16). In
all experiments the isolated cells were 80–99%
CD34+ as judged by staining with anti-CD34
mAb. Cultures of CD34+ cells were established in
the presence of SCF, GM-CSF, and TNF- as described
(17). Culture medium was supplemented with 5%
AB+ pooled human serum at the initiation of the
cultures. By days 5–6 human serum was washed away, and cells were
further cultured in presence of GM-CSF and TNF- until days 12–17
when 70–90% of cells are CD1a+ DC. Monocytes
were purified by immunomagnetic depletion (Dynal) after preparation of
PBMC, followed by a 52% Percoll gradient. The depletion was performed
with anti-CD3, anti-CD19, and anti-CD8 ascites, purified
anti-NKH1 (Beckman Coulter), and anti-CD16 (Immunotech) mAbs.
Monocyte-derived DC were produced by culturing purified monocytes for 6
days in the presence of GM-CSF and IL-4 with or without activation with
LPS (25 ng/ml) for 1–72 h (18).
cDNA libraries and isolation of DC-ASGPR cDNA clones
Total RNA was isolated from 70% resting CD1a+ DC (at day 12 of the culture of CD34+ sorted cells). RNA was treated with DNase I before mRNA purification using the Oligotex-dT kit (Qiagen, Hilden, Germany). Poly(A)+ RNA (2 µg) was used to make a cDNA library using the SuperscriptII system (Life Technologies). An average of 650 bp of highly unambiguous expressed sequence tag from individual clones were determined. The sequences were analyzed for possible encoded function by basic local alignment search tool (BLAST)N searches vs the public databases, followed by BLASTP searches of the open reading frames (19). By this method, two DC-ASGPR expressed sequence tags from a total of 1190 (ETA10 and KKA07) were obtained and identified via BLASTX analysis as a homolog of the hepatic ASGPR. Then, two full-length clones, DC-ASGPR short (LWA11) and long (JLA6) were isolated by preparing a probe from the original ETA10 insert and using colony hybridization of DC cDNA libraries (20).
Northern and Southern blot analysis
Multiple tissue normal fetal and adult organ Northern blots (MTN blots #7760-1, #7759-1, #7767-1 and immune system (MTN) blot #7754-1; Clontech, Palo Alto, CA) were used according to the manufacturer’s recommendations. Southern blots were prepared as described (20). Genomic DNA was cut with the enzymes BamHI or SacI under standard conditions and fragments were separated on a 1% Tris-acetate-EDTA agarose gel, then transferred to Hybond-N (Amersham Pharmacia Biotech, Uppsala, Sweden) overnight in 0.4 M NaOH, 10x SSC. Hybridization of Southern and Northern blots was with a 700-bp original clone ETA10 labeled with [32P]dCTP using the High Prime kit (Boehringer Mannheim, Meylan, France). Unincorporated nucleotides were removed by spin column chromatography (Chromaspin-100; Clontech). Hybridization and washes were performed in stringent conditions (0.1x SSC/0.1% SDS at 65°C). The membranes were incubated with Biomax MR film (Kodak, Rochester, NY) for 21 days.
RNA, DNA, and RT-PCR analysis
Cells were lysed and total RNA was extracted (21)
and used for the preparation of first-strand cDNAs. First-strand cDNAs
were prepared after DNase I treatment (in the presence of RNase
inhibitor) of 5 µg of total RNA using oligo(dT) primers (Amersham
Pharmacia Biotech) and the Superscript kit. Synthesis of cDNAs
was controlled by performing RT-PCR using 
-actin primers. PCR were
performed in a 100-µl volume using 1 µl of cDNA, 10 µl of 10x
PCR buffer (PerkinElmer/Cetus, Norwalk, CT), 2.5 U of Taq
polymerase (Gene Amp PCR reagents kit; PerkinElmer/Cetus), 200 mM
dNTPs, and 500 nM of the 5' and 3' amplification primers. PCR were
performed in a DNA thermal cycler (PerkinElmer/Cetus) for 35 cycles
(1-min denaturation at 94°C, 1-min annealing at 60°C, and 2-min
elongation at 72°C). Sense (5'JF46: GGGTTTCAAGCAGGAACGGCAGG) and
antisense (nucleotides 5'JF52: ATCCACCCACTTCCAGGCTCC) primers were
used to amplify human DC-ASGPR cDNA (1 ng/ml). Double-stranded plasmid
DNA was sequenced on an ABI 373A sequencer (Applied Biosystems, Foster
City, CA) using dye terminator technology. Sequencher (Gene Codes, Ann
Arbor, MI) and Lasergene (DNAstar, London, U.K.) software was used to
analyze sequences. Comparisons against GenBank databases were performed
using the BLAST algorithm.
Production of recombinant DC-ASGPR and generation of mAbs
Human DC-ASGPR (JLA6) exodomain-IgG and HRP fusion proteins were produced, and mAbs were generated as described (22). Briefly, the pFlagCMV3 (Kodak) vector was used for expression, first transiently in the COS cell line and later from stable CHO lines. The Ig fusion protein was purified from supernatant by HiTrapA chromatography (Amersham Pharmacia Biotech). For production of the hDC-ASGPR-HRP fusion protein, COS cells were transfected with the DC-ASGPR-HRP vector using the FuGENE 6 transfection reagent (Boehringer Mannheim) according to the manufacturer’s instructions. After 4–5 days of culture in RPMI 1640 medium without phenol red and FCS, the cell supernatant was collected and used as a protein source.
mAbs were produced by immunizing BALB/c mice (Iffa Credo, Les Oncins,
France) with three i.p. injections of 2 µg of purified DC-ASGPR-Ig
fusion protein in IFA (Sigma-Aldrich). Spleens were removed 3 days
after a final i.v. injection of DC-ASGPR-Ig in PBS and splenocytes were
fused with the murine SP2 myeloma cell line using polyethylene
glycol-1000 and cultured in 96-well plates using standard procedures.
Hybridoma supernatants were screened for their reactivity against
DC-ASGPR-HRP fusion protein by ELISA. Briefly, supernatants were
incubated in microtiter plates (Nunc, Glostrup, Denmark) previously
coated with goat anti-mouse IgG (Fc
fragment-specific; Jackson
ImmunoResearch Laboratories, West Grove, PA). After two washes, 100
µl of supernatants of COS cells transfected with the DC-ASGPR-HRP
vector were added and plates were incubated for 2 h at room
temperature. Plates were then washed twice, and the presence of
anti-DC-ASGPR mAbs complexed to the DC-ASGPR-HRP fusion protein was
determined by adding 100 µl of 3,3',5,5'-tetramethylbenzidine
Microwell peroxidase substrate (Kirkegaard & Perry Laboratories,
Gaithersburg, MD). After cloning of selected hybridomas, mAbs were
produced as ascites fluids and purified. By flow cytometric analysis,
all mAbs recognized COS cells transfected with the full-length cDNA
encoding DC-ASGPR, but not mock-transfected cells (data not shown).
Data presented in the present study were obtained with the
anti-DC-ASGPR mAb AS-3 of IgG1 isotype. mAb AS-3 recognizes both
the long and short forms of DC-ASGPR as based on reactivity on cellular
transfectants.
Cytofluorometric and immunohistological analysis of DC-ASGPR protein
Cell-surface expression of DC-ASGPR was determined by immunofluorescence staining and flow cytometric analysis with a FACSCalibur (BD Biosciences, Mountain View, CA). For single staining, cells were incubated for 30 min at 4°C with 10 µg/ml purified anti-DC-ASGPR mAb, then washed twice in PBS, 1% BSA, and 0.1% NaN3, and labeled with PE- or FITC-conjugated F(ab')2 goat anti-mouse Ig (DAKO, Glostrup, Denmark). Nonspecific staining was determined by using isotype-matched control mAb. All procedures were performed in the presence of 0.5 mM EDTA to avoid cell aggregation, and intracytoplasmic staining was performed in saponin.
Microscope slides of acetone-fixed cryocut tonsil sections were incubated with 10 µg/ml anti-DC-ASGPR mAb for 60 min, and subsequently with sheep anti-mouse IgG1 (The Binding Site, Birmingham, U.K.) followed by mouse alkaline phosphatase anti-alkaline phosphatase technique (DAKO). Alkaline phosphatase activity was revealed using the Fast Blue substrate (Sigma-Aldrich). For double staining, tonsil sections were incubated with mouse IgG1 anti-MR (DCGM1, produced in our laboratory) mAb and IgG2b anti-CD1a (BD Biosciences), revealed by sheep anti-mouse IgG1 and alkaline phosphate anti-alkaline phosphatase technique (as described above) and biotinylated sheep anti-mouse isotype-specific IgG (The Binding Site) followed by ExtrAvidin-peroxidase (Sigma-Aldrich). Alkaline phosphatase activity and peroxidase activity were respectively demonstrated using Fast Blue substrate and 3-amino-ethyl carbazole (Sigma-Aldrich).
Internalization of anti-DC-ASGPR mAb
CD34-derived DC were generated as detailed above and internalization was performed as described (23). One aliquot of cells was fixed with 0.1% paraformaldehyde for 5 min at room temperature and another aliquot was used without fixation. Both samples were stained with mAb anti-DC-ASGPR, mAb anti-CD1a, or mAb DCGM1 for 40 min on ice and incubated with biotin-labeled F(ab')2 goat anti-mouse IgG (Jackson ImmunoResearch Laboratories) for 1 h on ice. Cells were placed in a 37°C water bath for various time periods, cooled on ice, and stained with PE-conjugated streptavidin (BD Biosciences). After washing, cells were analyzed by FACS. The measure of internalization is given by the percentage decrease of cell-surface median fluorescence intensity (MFI) as compared with control samples kept at 4°C. The percentage decrease of MFI observed in fixed cells was taken as a measure of the off-rate of the Ab at 37°C. mAb DCGM1 (anti-MR) was used as positive control for receptor-mediated endocytosis.
Biochemistry
Proteins were extracted from CD34-derived DC supplemented with
TGF- by addition to a frozen pellet of 100
µl/107 cells of 50 mM Tris-HCL (pH 8) buffer
with 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, and protease inhibitor
(Complete Mini; Boehringer Mannheim). After 1 h at 4°C,
samples were centrifuged to remove cellular debris. Supernatants were
then incubated for 1 h at 4°C with DC-ASGPR mAb covalently
linked to Dynabeads M-450 sheep anti-mouse IgG magnetic beads
(Dynal). Beads were washed with extraction buffer using a Dynal
magnetic particle-concentrator and boiled in the presence of 50 µl of
SDS-PAGE sample buffer or resuspended in 100 µl of 0.5 M glycine and
0.15 M NaCl (pH 2.3) for 4 min. Then supernatant was neutralized with
3.5 µl of saturated Tris solution. Two-dimensional analysis was
performed on a Excelgel SDS 8–18% for the second dimension (Amersham
Pharmacia Biotech), and gel was silver-stained.
Electron microscopy
Immunoelectron microscopy was performed as described previously (5). Briefly, cells were fixed in 2% paraformaldehyde, washed, and embedded in 10% gelatin. Small blocks were infiltrated with 2.3 M sucrose for 4 h at 4°C, mounted, and frozen in liquid nitrogen. Ultrathin cryosections were indirectly immunolabeled with DC-ASGPR mAb and polyclonal anti-HLA-DR (24) (the kind gift of Dr. H. L. Ploegh, Department of Pathology, Harvard Medical School, Boston, MA), and visualized with 15 and 10 nm gold particles, respectively. Sections were then embedded in a mixture of 2% methyl cellulose and 0.4% uranyl.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A 0.7-kbp partial cDNA, ETA10, was isolated by random sequence
analysis of a CD1a+-derived DC library, then a
full-length 1.5-kbp cDNA sequence (clone JLA6) was obtained. It
contains a 5'-untranslated sequence (nucleotides 1–256), a 951-bp open
reading frame (nucleotides 257-1207) starting with a methionine
codon situated in a consensus Kozak sequence, a 3'-untranslated
sequence of 252 nucleotides, and an AATAAA polyadenylation signal at
position 1440. The predicted polypeptide sequence of 316 amino acids
has the typical features of a type II integral membrane lectin
containing an NH2-cytoplasmic domain of 40 residues, a hydrophobic
transmembrane domain (20 residues), a long neck domain, and a single
CRD containing a QPD motif predictive of
Gal/N-acetyl-galactose reactivity (Fig. 1
A). The sequence also
indicates two potential N-glycosylation sites
(Asn-X-Ser/Thr). Finally, the intracytoplasmic portion contains two
putative internalization signals: a tyrosine-based YENF motif and a
dileucine motif (Fig. 1A).
|
The full-length cDNA (clone JLA6) revealed that DC-ASGPR is an
isoform of the HML (10) containing an insertion of 27
amino acids and a deletion of three amino acids in the neck domain.
Furthermore, we have also isolated a short form of the DC-ASGPR (clone
LWA11) containing only the 3-aa deletion as compared with HML (Fig. 1
A). The predicted amino acid sequence homology with other
type II lectins is highest between DC-ASGPR/HML and the human liver
ASGPR (50%) (25, 26), the rodent macrophage lectin (50%)
(27, 28), followed by the chicken hepatic lectin
(28%) (27) and rodent Kupffer cell receptor (20%)
(29). A phylogenetic analysis illustrating the
conservation of amino acid sequences of the different ASGPR
between species reveals that DC-ASGPR belongs to the family of
macrophage lectins (human, mouse, and rat) (Fig. 1B).
Finally, in accordance with the predicted sequence, immunoprecipitation
from DC extracts with mAb AS-3 anti-DC-ASGPR, followed by
two-dimensional electrophoresis revealed a major 40-kDa protein with an
approximate isoelectric point of 8.2 (Fig. 2).
|
Northern blots probed with the ETA10 clone showed a band at 1.5
kbp. This band is slightly smeared and occasional other bands can be
observed, in line with the existence of mRNA for different splice
variants of DC-ASGPR. mRNA was detected in greatest quantity in PBL,
spleen, lymph node, and fetal liver (Fig. 3). DC-ASGPR can also be observed at
lower levels in bone marrow, appendix, thymus, thyroid, stomach, colon,
small intestine, ovary, testis, prostate, and liver. No expression was
detected in pancreas, kidney, skeletal muscle, lung, placenta, brain,
adrenal gland, trachea, and spinal cord (Fig. 3 and data not shown).
These results indicate a preferential expression of DC-ASGPR in immune
tissues.
|
The expression pattern of DC-ASGPR was first analyzed by Southern
blot on various cDNA libraries using the ETA10 clone. As shown in Fig. 4A, DC-ASGPR was strongly
expressed in DC obtained in vitro from monocytes in cultures with
GM-CSF and IL-4, and to a lesser extent in DC obtained from
CD34+ progenitors with GM-CSF and TNF-. No
expression was detected in B cells, NK cells, or monocytes,
irrespective of their activation state (Fig. 4A). We next
performed RT-PCR to determine expression of the long and the short
forms of DC-ASGRP on primary cells and cell lines. Both forms of
DC-ASGPR (long and short) were detected in DC, granulocytes, and PBL,
but not in monocytes, T or B lymphocytes, or in any of the cell lines
analyzed (Fig. 4B).
|
DC-ASGPR is associated with monocyte-derived and interstitial-type DC, and down-regulated upon CD40 ligation
DC generated in vitro from cord blood progenitors represent a
heterogeneous population of cells that arise from different
precursor subsets
(CD1a-/CD14+ and
CD1a+/CD14-) and display
different functions (16). When such precursors were FACS
sorted at day 6 and further recultured for 6 days in the presence of
GM-CSF and TNF-, DC-ASGPR mRNA was expressed on the CD14-derived DC
(Fig. 4C), which are in vitro counterparts of interstitial
DC (16). In contrast, DC-ASGPR mRNA was not detected on
the CD1a-derived DC, which resemble LC in phenotype and function
(16) (Fig. 4C). Accordingly, DC-ASGPR mRNA was
not detected in LC, and anti-DC-ASGPR mAb failed to stain freshly
isolated LC (data not shown). Also, as shown in Fig. 4A,
while no DC-ASGPR mRNA expression was observed in monocytes, a strong
signal could be detected in DC derived from monocytes cultured with
GM-CSF and IL-4 (18). The same pattern was observed at the
protein level, as DC-ASGPR was expressed both at the cell surface and
intracellularly in DC obtained with GM-CSF and IL-4, but not detected
in monocytes and detected only weakly in macrophages (Fig. 5A). Consistently,
DC-ASGPR+ cells in tonsil sections were mostly
found beneath the epithelium and around the B cell follicles (Fig. 5, B and C) and were absent from germinal centers.
In serial sections, DC-ASGPR+ cells also
expressed MR and CD11c (Fig. 5, D and E, and
data not shown) but not CD1a (Fig. 5, D and E).
Finally, no transcription of DC-ASGPR was found in DC freshly isolated
from blood (data not shown).
|
, DC-ASGPR mRNA (long and short forms) was detected
at day 12 (Fig. 6A).
Activation with CD40 ligand, a strong DC maturation signal
(30), down-regulated DC-ASGPR mRNA (Fig. 6A).
At the protein level, both cell-surface and intracellular DC-ASGPR
staining were completely abrogated following CD40 ligation, while
cell-surface MHC-II was up-regulated as a consequence of maturation
(Fig. 6B). As observed for the CD34-derived DC, expression
of DC-ASGPR was down-regulated when monocyte-derived DC were cultured
with CD40 ligand (data not shown).
|
DC-ASGPR is rapidly internalized from the cell surface and localizes in early endosomes and recycling vesicles
As immature DC are specialized in Ag capture, we examined the role
of DC-ASGPR in endocytosis. Thus, we analyzed the capacity of DC-ASGPR
to internalize mAb anti-DC-ASGPR as a ligand. We found that Ab was
rapidly internalized by DC at 37°C (Fig. 7A). An 
75% decrease of
surface membrane-bound mAb anti-DC-ASGPR occurred within 10 min at
37°C, with kinetics as rapid as observed with an anti-MR mAb, as
indicator of receptor-mediated endocytosis (Fig. 7B). By
comparison, an anti-CD1a mAb was internalized only with much slower
kinetics (Fig. 7C). The disappearance of cell-surface
staining was due to receptor internalization, as it was not observed at
4°C, nor in paraformaldehyde-fixed DC incubated at 37°C as a
control for Ab dissociation (Fig. 7).
|
), a distribution reminiscent of
the MR (31). In contrast, the majority of MHC class II
molecules was localized in large vesicular, primarily multilaminar
structures (Fig. 8) reminiscent of MHC class II compartments (MIICs)
described previously (32).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As compared with HML, DC-ASGPR differ by a deletion of three amino
acids for the short form and, for the long form, an additional 27-aa
insertion in the neck domain preceding the CRD (10). A
similar polymorphism exists in the hepatic ASGPR. The human hepatic
ASGPR is exclusively expressed by hepatocytes and is constituted of two
subunits of related amino acid sequence, H1 (46 kDa) and H2 (50 kDa),
with several alternatively spliced variants of the H2 subunit
(34). The HML was cloned from IL-2-activated human
peripheral blood adherent cells, but the precise distribution of the
receptor is unknown. In this work, we show that the strongest
expression of DC-ASGPR mRNA is observed in immune tissues, with a
preferential expression in DC and granulocytes. In contrast to the
hepatic lectins, only a faint signal was observed in liver. Focusing
our study on DC as APC, we have shown that DC-ASGPR is present in DC
generated both in vitro from CD34+ progenitors
and from blood monocytes. We observed a preferential expression on
CD14-derived DC which are related to interstitial DC. Accordingly,
DC-ASGPR was not detected in LC (data not shown). In addition, DC-ASGPR
was not observed in monocytes and expression was decreased by signals
inducing maturation like LPS, CD40 ligand, or TNF-. Taken together,
these results indicate that DC-ASGPR is expressed on immature DC with
an interstitial phenotype. This conclusion was further assessed by
immunohistological studies. Indeed, in tonsil, mAb anti-DC-ASGPR
stained a subpopulation of
MR+CD11c+CD1a-
cells in subepithelial and perifollicular areas, whereas
CD1a+ cells were observed in the suprabasal layer
of the external epithelium.
Hepatic ASGPR are responsible for degradation of desialylated proteins
and were initially identified for their capacity to recognize
galactosylated terminated proteins (11). As DC-ASGPR/HML
contains intracytoplasmic tyrosine-based (YXX[/
]) and dileucine
internalization motifs (35), and displays considerable
homology with the hepatic ASGPR, we hypothesized that DC-ASGPR
functions as an endocytic receptor in DC. To test this possibility, we
compared the time kinetics and levels of internalization of
anti-DC-ASGPR mAb with those of an anti-MR mAb as indicator for
receptor-mediated endocytosis. Following mAb binding, DC-ASGPR was as
rapidly internalized as the MR, demonstrating its function as an
endocytic receptor.
Immature DC are specialized in endocytosis and for this purpose express a number of transmembrane lectins that appear to serve distinct functions. DC express type I multi-CRD lectins represented by the MR (3) or DEC205 (4), and type II single-CRD lectins exemplified by the CD23 low-affinity IgE receptor or the recently identified Langerin, specific for LC (5, 36). The MR and DEC205 deliver their ligands into Ag processing compartments that permit MHC class II-restricted presentation (4, 37), thus allowing DC to efficiently present low concentrations of glycosylated Ag to T cells (4, 18). The MR is not found in lysosomes but recycles constitutively in peripheral endosomes while releasing its cargo (37). Likewise, DC-ASGPR was not observed in MIIC but was observed in early endosomes, suggesting that DC-ASGPR functions like the MR in routing a different set of Ag (e.g., galactosylated) that may allow an increase in diversity of Ag specifically captured by DC.
The natural ligands for DC-ASGPR have not been identified, but, of interest, HML displays a remarkable specificity for Tn Ag (10), which bears a cluster of serine or threonine-linked terminal galactose and N-acetylgalactosamine, and is associated with human carcinomas (38). In addition, DC-ASGPR exhibits considerable homology with mouse macrophage lectin (MMGL), the murine counterpart of HML. Homology is striking (60%) within the CRD, which confers specificity to MMGL for galactose and N-acetylgalactosamine (27). This includes the QPD motif, also found in the H1 and H2 subunits of the hepatic ASGPR (25, 39). MMGL, which has a YENL internalization signal in its cytosolic domain, functions as a receptor for endocytosis of galactosylated glycoproteins (9) and allows recognition of malignant cells by tumoricidal macrophages (40). In this context, MMGL is expressed within lung metastatic nodules of mice bearing OV2944-HM-1 ovarian tumors (41).
Type II lectins have various ligands. Some have cellular ligands like DC-SIGN, which binds ICAM3 (42) and ICAM2 (43), or CD72, which recognizes CD5 (44). Other type II lectins that belong to the NK receptor family (e.g., NKG2; see Ref. 45) bind MHC class I molecules, and the LOX1 lectin binds oxidized low-density lipoprotein (46). Recently, SRCL, a scavenger receptor with a lectin CRD homologous to DC-ASGPR, was found to bind bacteria, suggesting a role in host defense (47). In addition, the Kupffer cell receptor, the hepatic ASGPR, and LOX1 are involved in binding apoptotic cell bodies (48, 49). Thus, identification of DC-ASGPR/HML ligands should give clues as to the range of function of this receptor in DC.
It has been shown that exogenous Ag can be processed and presented in the MHC class I pathway following receptor-mediated uptake, phagocytosis of microorganisms or apoptotic bodies, or fluid phase uptake, by a phenomenon known as cross-presentation (50, 51, 52). Because some type II lectins are involved in uptake of apoptotic bodies, it can be speculated that DC-ASGPR performs such a function in DC by allowing loading onto MHC-I molecules.
In conclusion, we have demonstrated that DC-ASGPR/HML is expressed by immature DC and efficiently mediates endocytosis. DC-ASGPR could potentially be a target for loading Ags into DC to enhance presentation to T cells in immune-based adjuvant therapy. The specificity of HML for Tn Ag (10) makes this carcinoma-associated Ag a candidate for selective delivery to DC-ASGPR in DC.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sem Saeland, Schering-Plough Laboratory for Immunological Research, 27 chemin des Peupliers, BP 11, 69571, Dardilly, France. E-mail address: sem.saeland{at}spcorp.com
3 Abbreviations used in this paper: DC, dendritic cell; CRD, carbohydrate recognition domain; ASGPR, asialoglycoprotein receptor; HML, human macrophage lectin; MMGL, mouse macrophage lectin; MR, mannose receptor; SCF, stem cell factor; LC, Langerhans cell; BLAST, basic local alignment search tool; MFI, median fluorescence intensity; MIIC, MHC class II compartment; rh, recombinant human.
Received for publication June 11, 2001. Accepted for publication September 18, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 integrin receptors. J. Leukocyte Biol. 51:415.[Abstract]
. J. Exp. Med. 184:695. cooperate in the generation of dendritic Langerhans cells. Nature 360:258.[Medline]
. J. Exp. Med. 179:1109.
RI). J. Exp. Med. 175:1285.-O-serine/threonine) density in primary breast carcinoma: a functional predictor of aggressiveness. Mol. Immunol. 26:1.[Medline]
receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J. Exp. Med. 189:371.This article has been cited by other articles:
|
|
 |
|
  P. A. Cohen, G. K. Koski, B. J. Czerniecki, K. D. Bunting, X.-Y. Fu, Z. Wang, W.-J. Zhang, C. S. Carter, M. Awad, C. A. Distel, et al. STAT3- and STAT5-dependent pathways competitively regulate the pan-differentiation of CD34pos cells into tumor-competent dendritic cells Blood, September 1, 2008; 112(5): 1832 - 1843. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Wilflingseder, Z. Banki, E. Garcia, M. Pruenster, G. Pfister, B. Muellauer, D. S. Nikolic, C. Gassner, C. G. Ammann, M. P. Dierich, et al. IgG Opsonization of HIV Impedes Provirus Formation in and Infection of Dendritic Cells and Subsequent Long-Term Transfer to T Cells J. Immunol., June 15, 2007; 178(12): 7840 - 7848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Gilbert, C. Barat, R. Cantin, and M. J. Tremblay Involvement of Src and Syk Tyrosine Kinases in HIV-1 Transfer from Dendritic Cells to CD4+ T Lymphocytes J. Immunol., March 1, 2007; 178(5): 2862 - 2871. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Sano, K. Usami, R. Izawa, K. Denda-Nagai, N. Higashi, T. Kimura, N. Suzuki, and T. Irimura Properties of Blocking and Non-blocking Monoclonal Antibodies Specific for Human Macrophage Galactose-type C-type Lectin (MGL/ClecSF10A/CD301) J. Biochem., January 1, 2007; 141(1): 127 - 136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Zhang, O. Schwartz, M. Pantelic, G. Li, Q. Knazze, C. Nobile, M. Radovich, J. He, S.-C. Hong, J. Klena, et al. DC-SIGN (CD209) recognition of Neisseria gonorrhoeae is circumvented by lipooligosaccharide variation J. Leukoc. Biol., April 1, 2006; 79(4): 731 - 738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Tyrer, A. R. Foxwell, A. W. Cripps, M. A. Apicella, and J. M. Kyd Microbial Pattern Recognition Receptors Mediate M-Cell Uptake of a Gram-Negative Bacterium Infect. Immun., January 1, 2006; 74(1): 625 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-H. Kwan, A.-M. Helt, C. Maranon, J.-B. Barbaroux, A. Hosmalin, E. Harris, W. H. Fridman, and C. G. F. Mueller Dendritic Cell Precursors Are Permissive to Dengue Virus and Human Immunodeficiency Virus Infection J. Virol., June 15, 2005; 79(12): 7291 - 7299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. van Vliet, E. van Liempt, E. Saeland, C. A. Aarnoudse, B. Appelmelk, T. Irimura, T. B. H. Geijtenbeek, O. Blixt, R. Alvarez, I. van Die, et al. Carbohydrate profiling reveals a distinctive role for the C-type lectin MGL in the recognition of helminth parasites and tumor antigens by dendritic cells Int. Immunol., May 1, 2005; 17(5): 661 - 669. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Decot, G. Woerly, M. Loyens, S. Loiseau, B. Quatannens, M. Capron, and D. Dombrowicz Heterogeneity of Expression of IgA Receptors by Human, Mouse, and Rat Eosinophils J. Immunol., January 15, 2005; 174(2): 628 - 635. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Pasquier, Y. Lepelletier, C. Baude, O. Hermine, and R. C. Monteiro Differential expression and function of IgA receptors (CD89 and CD71) during maturation of dendritic cells J. Leukoc. Biol., December |
). No decrease of cell-surface fluorescence was detected in
paraformaldehyde-fixed cells (
). Results are expressed as the
percentage decrease of MFI, as compared with control samples kept at
4°C (
).