The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lou, Z.
Right arrow Articles by Leibson, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lou, Z.
Right arrow Articles by Leibson, P. J.
The Journal of Immunology, 2001, 167: 5749-5757.
Copyright © 2001 by The American Association of Immunologists

A Role for a RhoA/ROCK/LIM-Kinase Pathway in the Regulation of Cytotoxic Lymphocytes1

Zhenkun Lou2,*, Daniel D. Billadeau2,{dagger}, Doris N. Savoy{dagger}, Renee A. Schoon{dagger} and Paul J. Leibson3,{dagger}

Departments of * Pharmacology and {dagger} Immunology, Mayo Graduate and Medical Schools, Mayo Clinic, Rochester, MN 55905


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Polarization of lipid rafts and granules to the site of target contact is required for the development of cell-mediated killing by cytotoxic lymphocytes. We have previously shown that these events require the activation of proximal protein tyrosine kinases. However, the downstream intracellular signaling molecules involved in the development of cell-mediated cytotoxicity remain poorly defined. We report here that a RhoA/ROCK/LIM-kinase axis couples the receptor-initiated protein tyrosine kinase activation to the reorganization of the actin cytoskeleton required for the polarization of lipid rafts and the subsequent generation of cell-mediated cytotoxicity. Pharmacologic and genetic interruption of any element of this RhoA/ROCK/LIM-kinase pathway inhibits both the accumulation of F-actin and lipid raft polarization to the site of target contact and the subsequent delivery of the lethal hit. These data define a specialized role for a RhoA->ROCK->LIM-kinase pathway in cytotoxic lymphocyte activation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Engagement of activating receptors on lymphocytes initiates an orchestrated rearrangement of cell surface receptors and intracellular signaling molecules at the site of receptor engagement (1). Recently, membrane microdomains called lipid rafts have emerged as important players in the assembly of these signaling complexes (1, 2, 3). Lipid rafts are small dynamic membrane structures enriched in glycosphingolipids and cholesterol and are relatively insoluble in Triton X-100 (4). It has been suggested that lipid rafts function as platforms for the generation of signals downstream of activating receptors. In fact, proximal tyrosine phosphorylation events often preferentially occur in the lipid rafts, and disruption of lipid rafts by pharmacological methods inhibits immune receptor-triggered tyrosine phosphorylation and calcium mobilization (5, 6, 7, 8, 9, 10, 11). Taken together, these data suggest that lipid raft aggregation is a critical step in the activation of immune cells downstream of activating receptors.

The first detectable event in the generation of cellular cytotoxicity by NK cells is the activation of protein tyrosine kinases (PTK)4 (12, 13, 14, 15). The activation of PTKs leads to the phosphorylation of numerous intracellular signaling molecules and the subsequent development of cellular cytotoxicity (16). We have previously shown that lipid rafts polarize to the site of target recognition during the generation of NK cell-mediated cytotoxicity and that lipid raft polarization is requisite for effective killing (17). Interestingly, the redistribution of lipid rafts is a signal-driven process dependent upon the activation of proximal Src- and Syk-family PTKs (17). However, the intracellular signaling molecules involved in the regulation of lipid raft polarization downstream of these PTKs are unknown.

Studies over the past decade have implicated the Rac/Rho family of GTPases in the control of several cellular processes, including reorganization of the actin cytoskeleton, transcription factor regulation, and cellular transformation (18, 19). We have previously shown that the guanine nucleotide exchange factors for the Rac/Rho family of GTPases, Vav-1 and Vav-2, are involved in the regulation of cell-mediated killing by cytotoxic lymphocytes (20, 21). In addition, it has been shown that inactivation of the Rac/Rho family of GTPases by pharmacological or genetic approaches significantly impairs the development of cell-mediated killing by cytotoxic lymphocytes (20, 22). However, the identification of specific Rac/Rho family effector molecules or the mechanism by which these GTPases regulate cellular cytotoxicity is unknown.

Among the characterized Rho-effector molecules are the serine/threonine kinases p160ROCK and its homolog ROCK II (23, 24, 25, 26). They have been found to interact specifically with GTP-bound RhoA and to influence the formation of focal adhesions and stress fibers in nonhematopoietic cells (27). ROCK proteins elicit their activity downstream of Rho by phosphorylation of numerous downstream substrates (28, 29, 30, 31). Among these substrates, p160ROCK has been shown to directly phosphorylate and activate LIM-kinase 1 (LIMK1) (29, 30). LIMK1 is a serine/threonine kinase that phosphorylates and inactivates the actin-depolymerization factor cofilin, thereby regulating actin cytoskeletal reorganization (32, 33). The involvement of p160ROCK in the regulation of the actin cytoskeleton downstream of RhoA and the known role for RhoA in regulating the development of cellular cytotoxicity led us to investigate the role of the p160ROCK/LIMK1 pathway in the regulation of cell-mediated killing by cytotoxic lymphocytes. To this end, we have found that LIMK1 is activated in a p160ROCK-dependent manner after anti-FcR cross-linking of NK clones. In addition, using pharmacological inhibitors and dominant-negative versions of RhoA, p160ROCK and LIMK1, we found that a functional RhoA/ROCK/LIM-kinase pathway is required for actin polymerization and lipid raft polarization at the effector/target interface and the subsequent development of cell-mediated killing. These results provide a novel mechanism for the RhoA->p160ROCK->LIMK1 pathway in the activation of cytotoxic lymphocytes.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents, cells, and Abs

Unless otherwise stated, all chemicals were from Sigma (St. Louis, MO). The K562 erythroid leukemia cell line and murine mastocytoma cell line P815 were obtained from American Type Culture Collection (Manassas, VA). Human NK cells and CD8+ T cells were cloned and passaged as previously described (20). Yoshitomi Pharmaceutical Industries (Osaka, Japan) generously provided the Y-27632 p160ROCK inhibitor. NK clones or peripheral blood leukocytes were incubated with the indicated amount of Y-27632 for 1 h at 37°C unless otherwise indicated in the figure legend. C3 exoenzyme was obtained from Calbiochem (La Jolla, CA). Anti-Fc{gamma}RIIIA mAb, 3G8, and anti-CD3 mAb, OKT3, were purified from ascites by affinity chromatography over protein A-agarose. Rabbit polyclonal antiserum to p160ROCK and LIMK1 were obtained from Cocalico Biologicals, Inc. (Reamstown, PA) after immunization of rabbits with keyhole limpet hemocyanin-conjugated p160ROCK peptide 1–29 (MSTGDSFETRFEKMDNLLRDPKSEVNSDC) or keyhole limpet hemocyanin-conjugated LIMK1 peptide 279–304 (TPSGEAGSSARQKPVLRSCSIDRSPG).

DNA constructs and recombinant vaccinia generation

The recombinant FLAG-tagged RhoA.WT (F.RhoA.WT) and dominant-negative RhoA (F.N19RhoA) vaccinia have been previously described (20). To obtain a recombinant vaccinia virus expressing a dominant-negative version of p160ROCK (ROCK.1081), amino acids 1081–1354 were amplified by PCR from a p160ROCK cDNA generously provided by S. Narumiya (Kyoto University, Kyoto, Japan) (24) using the forward (5'-AATAAGCTTCAGATGCAGTTGGCC-3') and reverse (5'-GTCGCGGCCGCTTAACTAGTTTTTCCAGATGTATTTTTGACCAC-3') oligonucleotides. The LIMK1 cDNA was amplified by PCR from NK cDNA using the forward (5'-GTCAAGCTTATGAGGTTGACGCTACTTTGTTG-3') and reverse (5'-CTGAGCGGCCGCGGCTCAGTCGGGGACCTCAGGGTG-3') oligonucleotides. The PCR-amplified products were sequenced and subcloned into the pSHN11.FLAG vector, and recombinant vaccinia viruses were produced as previously described (20). The catalytically inactive version of LIMK1 (LIMK1-KD, D460A) was generated using the Clontech (Palo Alto, CA) site-directed mutagenesis kit and the oligonucleotide (ATGAACATCATCCACCGAGCCCTCAACTCCCACAACTGC) as previously described (20). The GST-cofilin fusion protein was generated by PCR amplification of NK cDNA using the cofilin-specific forward (5'-CCCAAGCTTGCCATGGCCTCCGGTGTGGCTGTC-3') and reverse (5'-CCCAAGCTTCACAAAGGCTTGCCCTCCAGGGAGA-3') oligonucleotides. The amplified product was subcloned into the pGEX-KG cloning vector to produce the GST-cofilin fusion protein. Nucleotides in bold represent restriction sites, or point mutations that were engineered into the oligonucleotide primer.

Cytotoxicity assays

In some cases, NK cells or PBLs were treated with the indicated concentration of C3 exoenzyme (overnight at 37°C) and the ROCK inhibitor (1 h at 37°C), or they were infected with the indicated recombinant vaccinia virus (6 h at 37°C). The cells were then assayed for their cytolytic activity toward K562 or anti-FcR-coated P815 cells using the 51Cr-release assay as previously described (20). In all cases, spontaneous release did not exceed 10% of maximum release. In redirected cytotoxicity assays, NK clones were only able to kill the P815 target cell in the presence of anti-FcR mAb. Lytic units were calculated based on 20% cytotoxicity (34).

In vivo labeling and in vitro kinase assay

NK clones were placed in phosphate-free media overnight in the absence of serum. They were subsequently labeled with [32P]orthophosphate (200 µCi/ml) for 2 h at 37°C. One hour before the end of the incubation, the cells were split in half and one half was treated with Y-27632 (50 µM). After the incubation, the cells were stimulated by cross-linking the FcR for the indicated time and lysed as previously described (20). LIMK1 was immunoprecipitated from the cell lysate, separated by SDS-PAGE, transferred to a nylon membrane, and analyzed using a STORM imaging system (Molecular Dynamics, Sunnyvale, CA). To determine the in vitro activity of LIMK1 during natural cytotoxicity, NK clones (1 x 107/sample) were serum-starved overnight and then incubated at 37°C with 1% paraformaldehyde-fixed K562 cells (5 x 106/sample). After the cell stimulation, LIMK1 was immunoprecipitated and assayed for kinase activity using 5 µg of GST-cofilin as previously described (30). Analysis of LIMK1 activity after FcR cross-linking was performed essentially as described above, except that one-half of the cells were treated for 1 h with Y-27632 (50 µM) or C3 exoenzyme (50 µg/ml) and then stimulated through the FcR as indicated. Where indicated, whole cell lysates were prepared from 1 x 106 NK clones and analyzed for extracellular signal-related kinase (ERK) activation using an anti-phosphoERK-specific Ab.

Conjugate analysis

Quantification of effector-target conjugates was performed as previously described (20). Briefly, NK cells were labeled intracellularly for 1 h at 37°C with 100 µM sulfofluorescein (Molecular Probes, Eugene, OR), and the K562 target cells were labeled intracellularly for 1 h at 37°C with 40 µg/ml hydroethidene (Polysciences Inc., Warrington, PA). In addition, the NK cells either were left untreated or were treated for 1 h at 37°C with 50 µM Y-27632 as indicated in the figure legends. The cells were then washed and resuspended at a concentration of 5 x 106 cells/ml. The effectors and targets (25 µl of each) were mixed together, pelleted, and allowed to incubate at 37°C for 10 min. The pellet was gently resuspended and transferred to 1 ml of ice-cold RPMI 1640 medium. Conjugate formation was assessed using a FACScan (BD Biosciences, San Jose, CA) and is revealed by the simultaneous emission of green and red fluorescence. Results are expressed as the percentage of total NK cells that formed conjugates.

Lipid raft polarization assay

In some instances NK cells were assayed for lipid raft polarization or F-actin content after infection for 5–6 h with the indicated recombinant vaccinia virus, a 1 h incubation with Y-26732 (50 µM), or an overnight treatment with C3 exoenzyme (50 µg/ml). The assessment of lipid raft polarization during the development of cell-mediated killing was done as previously described (17). In brief, NK cells were stained for 45 min on ice with FITC-cholera toxin B subunit (CTxB) (8 µg/ml). The labeled cells were washed twice in PBS containing 0.2% BSA and resuspended at a final concentration of 107 cells/ml for NK cells and 5 x 106 cells/ml for the target cells. Equal volume (50 µl) of NK cells and target cells were mixed, briefly pelleted, and then incubated for 5 min at 37°C. The cells were then fixed and transferred to glass slides by cytospin. For analysis of F-actin content, the slides were stained with a 0.02 µM concentration of rhodamine-conjugated phalloidin (Molecular Probes). NK cells that had formed conjugates were assessed for raft redistribution or F-actin content using a fluoromicroscope (Carl Zeiss, Jena, Germany). A total of 100 conjugates were evaluated per slide, and the individual performing the assay was blinded to the sample identities.

Immunofluorescence

NK cells (5 x 106) were labeled with FITC-CTxB and incubated with the K562 target cell as described above. The cells were then fixed and transferred to glass slides by cytospin. The cells were permeabilized in 0.2% Triton X-100 in PBS for 2 min, rinsed three times in PBS, and placed in blocking buffer (PBS containing 5% glycerol, 5% goat serum, and 0.04% sodium azide) for 1 h. The cells were stained using a 1/250 dilution of anti-p160ROCK, anti-LIMK1 polyclonal rabbit antisera, or 0.02 µM rhodamine-phalloidin in blocking buffer for 2 h. After this primary incubation, the cells were washed three times in PBS and then incubated with a 1/250 dilution of goat anti-rabbit, Texas Red-conjugated Ab (Molecular Probes) in blocking buffer. The cells were washed three times in PBS and mounted in Fluoroseal (Molecular Probes, Eugene, OR), and coverslips were applied. Individual NK cells, or those that had formed conjugates, were assessed for raft redistribution and p160ROCK, LIMK1, and F-actin using a fluoromicroscope (Carl Zeiss). Images were analyzed using the KS400 image analysis software (Carl Zeiss).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
A RhoA/ROCK/LIM-kinase pathway is involved in the regulation of cellular cytotoxicity

Inactivation of the RhoA GTPase signaling pathway in NK cells by either preincubation of the NK cells with C3-exoenzyme or overexpression of a dominant-negative form of the GTPase (N19RhoA) inhibits the development of natural cytotoxicity toward the NK-sensitive target cell line K562 (Fig. 1GoA). The critical role for RhoA in the regulation of cellular cytotoxicity led us to investigate downstream effectors of RhoA that might be involved in regulating cell-mediated killing. One such candidate effector molecule of RhoA is p160ROCK. p160ROCK is a multidomain protein containing a serine/threonine kinase domain, a Rho-binding domain, a pleckstrin homology domain, cysteine-rich regions, and an amphipathic {alpha}-helical region. It has been shown that the kinase activity of p160ROCK is required for its ability to regulate events downstream of RhoA (35), and most recently it has been shown to directly phosphorylate and activate the serine/threonine kinase LIMK1 (29, 30). Using rabbit polyclonal anti-p160ROCK and anti-LIMK1 antisera, we have found that both proteins are expressed in a variety of hematopoietic cell lines including cytotoxic lymphocytes (data not shown). Recently, a compound was identified, Y-27632, that inhibits p160ROCK kinase activity (29, 36). The specificity of Y-27632 has been shown and the IC50 is hundredsfold lower for p160ROCK than for other serine/threonine kinases, including protein kinase C, protein kinase A, and myosin L chain kinase (36). To determine whether LIMK1 undergoes FcR-initiated phosphorylation by p160ROCK, we immunoprecipitated LIMK1 from [32P]orthophosphate-labeled NK clones that had been left untreated or were pretreated with Y-27632. We observed a greater than 2.5-fold increase in the level of LIMK1 phosphorylation by 0.5 min of FcR cross-linking (Fig. 1GoB). FcR-initiated LIMK1 phosphorylation was absent in the NK clones that had been treated with Y-27632. Other FcR-initiated phosphorylation events, such as the formation of phospho-ERK (Fig. 1GoC), remained intact after treatment with Y-27632. Importantly, the increase in in vivo LIMK1 phosphorylation after FcR cross-linking correlated with a 2-fold increase in its kinase activity as measured by an in vitro kinase assay using GST-cofilin as a substrate (Fig. 1GoD). The activity of LIMK1 peaked around 10 min after FcR cross-linking and declined to basal levels between 15 and 30 min (Fig. 1GoD and data not shown). LIMK1 from Y-27632-treated NK clones contained little in vitro kinase activity (Fig. 1GoD). In addition, NK clones infected with the dominant-negative RhoA GTPase demonstrated little increase in LIMK1 activity after FcR cross-linking compared with the control virus (Fig. 1GoE). FcR-mediated LIMK1 activity was also diminished in NK clones that had been pretreated with C3-exoenzyme (data not shown). We also observed an increase in the activation of LIMK1 after the incubation of NK clones with the NK-sensitive K562 target cell line (Fig. 1GoF). In fact, there was more than a 2-fold increase in LIMK1 activity after 1 min of incubation with the K562 target cell line, with LIMK1 activity decreasing to basal levels by 5 min (Fig. 1GoF). Taken together, these data suggest that a RhoA/p160ROCK/LIMK1 pathway is activated in NK clones after triggering through the FcR and killer cell-activating receptors that regulate natural cytotoxicity toward the K562 target cell line.



View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 1. Activation of LIMK1 during NK cell activation. A, Cloned NK cells (2 x 106) were left untreated or incubated with 50 µg/ml C3-exoenzyme (left panel), or infected with the indicated recombinant vaccinia virus (right panel). The NK cells were then assayed for natural cytotoxicity by incubating them with 51Cr-labeled K562 target cells (NK + K562). Data are expressed in lytic units. This is a representative example of three separate experiments. B, Cloned NK cells (1 x 107) were left untreated or were treated for 1 h with 50 µM Y-27632 and were labeled internally with [32P]orthophosphate and treated as described in Materials and Methods. LIMK1 was immunoprecipitated at the indicated times after anti-FcR cross-linking, separated by SDS-PAGE, and transferred to a nylon membrane, and incorporated 32P phosphate was measured using a STORM imaging system. The levels of LIMK1 protein were assessed by Western blotting followed by densitometry and were used to calculate the fold increase in phosphorylation. C, NK cells (1 x 106) were left untreated or were treated for 1 h with 50 µM Y-27632. At the indicated times after anti-FcR cross-linking, whole cell lysates were prepared and analyzed for ERK activation using a phospho-specific anti-ERK antisera. The levels of ERK2 protein were assessed by reprobing the membrane with anti-ERK 2 antisera, and the protein levels were used to calculate the fold increase in FcR-initiated phosphorylation. The basal level of phosphorylation was set as one. This is a representative example of three separate experiments. D, Cloned NK cells (1 x 107/sample) were serum-starved overnight, and then one-half of the sample was treated with Y-27632 (50 µM). After the indicated times of anti-FcR cross-linking, LIMK1 was immunoprecipitated from cell lysates and subjected to an in vitro kinase assay using GST-cofilin as the substrate. The fold increase in GST phosphorylation is indicated below the upper autoradiogram. The levels of LIMK1 protein were assessed by Western blotting the same membrane. Comparable levels of GST-cofilin were assessed by staining the membrane with amido black. This is a representative example of four separate experiments. E, Cloned NK cells (1 x 107/sample) were serum-starved overnight and then infected with the indicated recombinant vaccinia virus for 6 h. After the indicated times of anti-FcR cross-linking, LIMK1 was immunoprecipitated from cell lysates and subjected to an in vitro kinase assay. The fold increase in GST phosphorylation is indicated below the upper autoradiogram. The levels of LIMK1 protein were assessed by Western blotting the same membrane, and GST-cofilin levels were determined by staining the membrane with amido black. F, Cloned NK cells (1 x 107/sample) were serum-starved overnight and incubated at 37°C with paraformaldehyde-fixed K562 cells (5 x 106/sample). After the indicated times of incubation, the cells were lysed and LIMK1 was specifically immunoprecipitated using anti-LIMK1 polyclonal rabbit antisera or normal rabbit serum as a control. LIMK1 activity was analyzed in an in vitro kinase assay as described above. The levels of LIMK1 protein and GST-cofilin were assessed by Western blotting the same membrane with anti-LIMK1 polyclonal rabbit antisera and amido black staining, respectively.

 
To determine whether p160ROCK was required for the development of cell-mediated killing by cloned human NK cells, NK clones were incubated with increasing concentrations of Y-27632 for 1 h at 37°C. Preincubation of NK clones with Y-27632 resulted in a dose-dependent inhibition of the development of natural cytotoxicity toward the NK-sensitive K562 target cell line, with an IC50 between 5 and 10 µM (Fig. 2GoA). Similarly, the development of Ab-dependent cellular cytotoxicity, as measured in a reverse-Ab-dependent cellular cytotoxicity using the FcR-bearing P815 cell and anti-FcR mAb, was also inhibited (Fig. 2GoA). Natural cytotoxicity of Y-27632-treated NK clones toward other targets such as the B lymphoblastoid cell lines 721 and C1R was similarly inhibited (data not shown). Moreover, Y-27632 treatment of a human CD8+ cytotoxic T cell line showed a similar dose-dependent inhibition of cell-mediated killing of anti-CD3-coated P815 (data not shown). Importantly, high concentrations of Y-27632 did not affect cell viability as assessed by trypan blue exclusion (data not shown), ERK phosphorylation (Fig. 1GoC), other cellular events such as conjugate formation (Fig. 3Go), or IFN-{gamma} secretion (data not shown). Taken together, these data suggest a role for p160ROCK in the specific regulation of cell-mediated killing by cytotoxic lymphocytes.



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 2. p160ROCK and LIMK1 regulate NK cell-mediated killing. A, Cloned NK cells (2 x 106) were left untreated or were incubated with the indicated concentration of the p160ROCK inhibitor Y-27632 for 1 h at 37°C. The NK cells were then assayed for both natural cytotoxicity as described above and FcR-mediated killing by incubating them with 51Cr-labeled P815 cells coated with 0.15 µg/ml anti-FcR mAb 3G8. Data are expressed in lytic units. This is a representative example of four separate experiments. B, Total mononuclear PBLs were left untreated or were treated with the indicated concentration of Y-27632 for 1 h at 37°C. The cytolytic function of the PBLs was assayed for both natural cytotoxicity and FcR-mediated killing as described above. This is a representative example of two separate experiments. C and D, Cloned NK cells (2 x 106) were infected with control recombinant vaccinia virus (WR) or a recombinant vaccinia virus encoding a dominant-negative version of p160ROCK (ROCK.1081), wild-type LIMK1, or a kinase-inactive version (LIMK1-KD). The infected NK clones were then assayed for both natural cytotoxicity and FcR-mediated killing as described above. The levels of recombinant LIMK1 and LIMK1-KD expressed by the individual NK clones were determined by Western blotting for the FLAG eptiope tag. This is a representative example of three separate experiments.

 


View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 3. Inhibition of p160ROCK does not affect the formation of NK cell target cell conjugates. Cloned NK cells (2 x 106) were incubated in the absence or presence of Y-27632 (50 µM) and stained intracellularly with sulfofluorescein (green fluorescence) for 1 h at 37°C. These NK cells were then either assayed for natural cytotoxicity (right panel) toward the K562 target cell line as described in Fig. 1Go or incubated for 10 min at 37°C with K562 target cells that had been stained intracellularly with hydroethidine (red fluorescence, left panel). Using flow cytometry, the percentage of NK cells forming conjugates were scored based on the simultaneous emission of both red and green fluorescence. A total of 104 events were analyzed per sample. This is a representative example of three separate experiments.

 
To determine whether the effect of Y-27632 on the inhibition of killing by cloned NK cells was specific to activated cytotoxic lymphocytes, we incubated freshly isolated PBLs with increasing doses of Y-27632 and assayed their cytolytic potential. Compared with untreated PBLs, those treated with increasing doses of Y-27632 show a dramatic inhibition of natural cytotoxicity toward the K562 target cell line and killing initiated by the NK FcR (Fig. 2GoB). Interestingly, cell-mediated killing by PBLs was significantly more sensitive to Y-27632 than the cloned NK cells, demonstrating an IC50 between 0.1 and 0.5 µM (Fig. 2GoB). This suggests that resting NK cells are more sensitive to inhibition of p160ROCK activity than are the activated NK clones (compare Fig. 2Go, A and B).

Although the above data using the Y-27632 inhibitor suggests that p160ROCK plays a fundamental role in the development of cellular cytotoxicity, we wanted to rule out any nonspecific inhibition of cytotoxicity by the drug. To do this, we generated a recombinant vaccinia virus expressing a truncated version of p160ROCK (ROCK.1081, amino acids 1081–1354) that has been previously shown to function as a dominant-negative mutant (35). We infected NK clones with either ROCK.1081-expressing vaccinia or the parental virus WR as a control. Significantly, overexpression of ROCK.1081 inhibits the development of both forms of cellular cytotoxicity compared with the WR control virus (Fig. 2GoC). The ability of ROCK.1081 to inhibit natural cytotoxicity toward K562 was not specific to this cell target becauseNK clones infected with ROCK.1081 were also inhibited in the killing of the NK-sensitive B-lymphoblastoid cell line 721 (data not shown). Moreover, overexpression of ROCK.1081 in CD8+ T cell lines inhibited killing initiated through the TCR (D. D. Billadeau and P. J. Leibson, unpublished observation). Taken together, the data based on pharmacological and genetic inhibition of p160ROCK identify p160ROCK as an effector molecule downstream of RhoA that is involved in the regulation of cell-mediated killing by cytotoxic lymphocytes.

To determine whether LIMK1 is involved in the regulation of cellular cytotoxicity, we generated recombinant vaccinia virus expressing FLAG epitope-tagged wild-type LIMK1 or a kinase-inactive version (LIMK1-KD). Significantly, when compared with control virus (WR) or overexpression of wild-type LIMK1, overexpression of LIMK1-KD inhibited the development of both natural cytotoxicity and killing initiated through the FcR (Fig. 2GoD). The expression of both LIMK1 and LIMK-KD were similar as determined by Western blotting. In addition, LIMK-KD was also found to inhibit TCR-mediated cellular cytotoxicity by cytotoxic T lymphocytes (D. D. Billadeau and P. J. Leibson, unpublished observation). Taken together, these data suggest that the RhoA-regulated p160ROCK/LIMK1 pathway is involved in the regulation of cell-mediated killing by cytotoxic lymphocytes.

Inhibition of p160ROCK does not affect conjugate formation

We have previously shown that one mechanism by which RhoA regulates the development of cell-mediated killing is partly through its influence on the formation of stable conjugates between the NK cell and the target cell (20). In an attempt to determine the mechanism by which p160ROCK influences the development of cellular cytotoxicity, we performed conjugate analyses using untreated NK clones or NK clones treated with 50 µM Y-27632. Treatment of NK clones with the p160ROCK inhibitor did not affect their ability to form conjugates (Fig. 3Go, left panel). However, the same Y-27632-treated NK clones were significantly inhibited in their ability to mediate natural cytotoxicity of the K562 target cell line (Fig. 3Go, right panel). These data suggest that the role of p160ROCK downstream of RhoA is at a site distal to the formation of stable effector-target conjugates.

p160ROCK localizes to the effector/target interface during the generation of cell-mediated killing

Initial experiments with cytocholasin D, a potent inhibitor of actin polymerization, indicated that rearrangement of the actin cytoskeleton was required for the polarization of lipid rafts to the site of target contact during the generation of cellular cytotoxicity (Z. Lou and P. J. Leibson, unpublished observation). To determine the intracellular distribution of p160ROCK and LIMK1 within isolated and target-engaged NK cells, we stained NK cells that had been incubated with the K562 target cell for p160ROCK or LIMK1 protein using specific polyclonal rabbit antisera. In addition, NK cells were stained with CTxB-FITC to stain lipid rafts at the cell surface. Analysis of individual NK clones revealed a mostly cytoplasmic staining of p160ROCK, with some accumulation in the plasma membrane (Fig. 4GoA). In stark contrast, the majority of LIMK1 is associated with the NK plasma membrane, with very little protein staining within the cytoplasm (Fig. 4GoE). As has been previously shown (17), lipid rafts stained with FITC-CTxB polarize to the site of target contact (Fig. 4Go, C and G). Although the initial reaction with CTxB-FITC is at the cell surface, it appears that some components of the polarized lipid rafts become cytoplasmic, which would be consistent with ongoing endocytosis at the site of target contact. Interestingly, upon engagement of a susceptible target, there is a redistribution of p160ROCK from the cytoplasm to the area of contact between the NK clone and the K562 target cell that correlates with the redistribution of lipid rafts (Fig. 4Go, B–D). The increase in p160ROCK localization to the effector/target interface was not observed in control cells stained with normal rabbit serum (data not shown). In contrast to the redistribution of p160ROCK, there appears to be very little change in the amount of LIMK1 associated at the site of target contact (Fig. 4GoF). Taken together, these data suggest that p160ROCK is redistributed to the effector/target interface during the generation of cellular cytotoxicity, where it can interact with and activate the primarily plasma membrane-localized LIMK1.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 4. Distribution of p160ROCK and LIMK1 in individual NK clones and conjugates. Cloned NK cells were labeled with FITC-CTxB (green fluorescence) and incubated for 5 min at 37°C with K562 target cells. The cells were treated and stained intracellularly for p160ROCK or LIMK1 as described in Materials and Methods. p160ROCK (A–D) and LIMK1 (E–H) staining were visualized using goat anti-rabbit conjugated to Texas red (red fluorescence). Images were recorded during confocal microscopy as follows: A and B, anti-p160ROCK; E and F, LIMK1; C and G, FITC-CTxB; and D and H, merged images. This is a representative example of NK:K562 conjugates from two separate experiments.

 
The RhoA-p160ROCK-LIMK1 pathway regulates lipid-raft polarization during the development of cell-mediated killing

Because p160ROCK and lipid rafts localize to the interface between the NK and target cell during the generation of cell-mediated killing, we next sought to determine whether an activated RhoA/p160ROCK/LIMK1 pathway is required for the polarization of NK cell lipid rafts to the site of target recognition. To do this, we used a previously described technique for the visualization and quantitation of polarized lipid rafts (17). When visualized by fluorescence microscopy, the NK cell lipid rafts (FITC-CTxB-labeled, green fluorescence) can be visualized as well as the intracellularly labeled K562 target cell (hydroethidine, red fluorescence). NK cells that are not interacting with a target cell show a diffuse staining of lipid rafts throughout the plasma membrane (Fig. 5GoA). In contrast, when an NK cell forms a conjugate with a K562 target cell, there is a reorganization of the lipid rafts into "macrorafts" at the interface between the NK cell and the K562 target cell (Fig. 5GoB). Again, there appear to be some lipid raft components endocytosed at the site of target contact.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 5. Visualization of lipid raft polarization during the development of natural cytotoxicity. Cloned NK cells were left untreated (A and B), were treated with 50 µg/ml C3-exoenzyme overnight (C) or 50 µM Y-27632 for 1 h at 37°C (E), or were infected with recombinant vaccinia virus encoding F.N19RhoA (D), ROCK.1081 (F), or LIMK1-KD (G) for 5 h. The variously treated NK cells were then labeled with FITC-CTx (green fluorescence) and incubated for 5 min at 37°C with hydroethidine-labeled K562 target cells (red fluorescence), fixed, and spun onto glass slides. Images were recorded during confocal microscopy. A represents an isolated FITC-CTx-labeled NK clone, whereas B–G are shown in contact with hydroethidine-labeled K562 target cells.

 
To determine whether RhoA is involved in the regulation of lipid raft polarization during the development of cell-mediated killing, we incubated NK clones with C3-exoenzyme. Incubation of three separate NK clones with C3-exoenzyme dramatically decreased the number of conjugates containing polarized lipid rafts (Figs. 5GoC and 6A, left panel). To demonstrate the involvement of RhoA directly in this process, we infected NK clones with recombinant vaccinia virus expressing dominant-negative RhoA (F.N19RhoA), wild-type RhoA, or the control parental virus and assayed lipid raft polarization. NK clones overexpressing F.N19RhoA demonstrated a significant decrease in the percentage of conjugates with polarized lipid rafts compared with those overexpressing wild-type RhoA or the control-infected population (Figs. 5GoD and 6A, right panel). Importantly, when compared with uninfected cells, control-infected NK clones (WR) and NK clones infected with wild-type RhoA (F.RhoA.WT) displayed comparable levels of conjugates with polarized lipid rafts (Fig. 6GoA, right panel, and data not shown).



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 6. Inhibition of the RhoA/p160ROCK/LIMK1 signaling pathway abrogates lipid raft polarization to the effector-target interface. Cloned NK cells were left untreated, were treated overnight with 50 µg/ml C3-exoenzyme (A, left panel) or for 1 h at 37°C with 50 µM Y-27632 (B, left panel), or were infected with the indicated recombinant vaccinia virus (A, right panel; B, right panel; and C). In each experiment, lipid raft polarization was analyzed using K562 as the target. Lipid raft polarization was measured by fluorescence microscopy as described in Materials and Methods. The assay was performed with the individual scoring the polarized lipid rafts blinded to the identities of the samples, and only NK cell-target cell conjugates were scored for lipid raft polarization. One hundred conjugates were scored per slide, and the data are presented as the percentage of conjugates with polarized lipid rafts. The data presented are representative examples of at least three experiments performed using three separate NK clones.

 
Because p160ROCK was also a key regulator of NK cellular cytotoxicity, we wondered whether the control of lipid raft polarization by RhoA was mediated by p160ROCK. To test this, we initially incubated NK clones with 50 µM Y-27632 and assayed lipid raft polarization (Fig. 5GoE). Treatment of NK clones with this concentration of Y-27632 severely diminishes the number of conjugates containing polarized lipid rafts (Fig. 6GoB, left panel). Importantly, the inhibition of lipid raft polarization observed using the pharmacological inhibitor of p160ROCK was also seen when NK clones infected with ROCK.1081 were assayed for lipid raft polarization (Figs. 5GoF and 6B, right panel). Lastly, we examined the role of LIMK1 in the regulation of lipid raft polarization during the generation of cell-mediated killing. Clearly, overexpression of LIMK1-KD led to a decrease in the number of conjugates with polarized lipid rafts, compared with the control-infected cells (Figs. 5GoG and 6C). Taken together, these data suggest a link between activation of the RhoA/p160ROCK/LIMK1 pathway and the regulation of lipid raft polarization during the development of cell-mediated killing.

Inhibition of the p160ROCK/LIMK1 pathway results in decreased actin polymerization at the effector/target interface

The observation that actin polymerization is required for lipid raft movement and the known role for the p160ROCK/LIMK1 pathway in the reorganization of the actin cytoskeleton led us to investigate the effect that inactivation of the p160ROCK/LIMK1 pathway would have on actin polymerization at the effector/target interface. First, we analyzed NK clones for F-actin content at the effector/target interface by staining them with rhodamine-conjugated phalloidin. Clearly, there is an increase in polymerized F-actin at the interface between the NK clone and the target cell (Fig. 7GoA). In addition to the polymerized F-actin, as shown in the merged image, there is a colocalization of lipid rafts to the effector/target interface (Fig. 7Go, B and C). To investigate whether the disruption of the p160ROCK/LIMK1 pathway would affect actin polymerization at the interface between the two cells, NK clones were infected with recombinant vaccinia virus, incubated with the K562 target cell, and stained with rhodamine-phallodin. The percentage of conjugates containing polarized F-actin at the cell-cell interface was evaluated using fluorescence microscopy. In each case, the conjugates formed by NK clones infected with ROCK.1081 or LIMK1-KD contained less polymerized F-actin at the effector/target interface than those infected with control virus (Fig. 7GoD). These data suggest that the p160ROCK/LIMK1 pathway is involved in regulating reorganization of the actin cytoskeleton at the zone of interaction between the NK cell and the target cell.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 7. Dominant-negative p160ROCK and LIMK1 affect F-actin polymerization at the effector/target interface. Cloned NK cells were analyzed for polymerized-actin content and lipid rafts as described in Materials and Methods. Images were recorded during confocal microscopy as follows: A, F-actin; B, lipid rafts; and C, merged images. D, NK clones were infected with the indicated recombinant vaccinia virus for 5 h at 37°C. In each experiment, F-actin polarization was analyzed using K562 as the target and was measured as described in Fig. 5Go. One hundred conjugates were scored per slide, and the data are presented as the percentage of conjugates with polarized F-actin. The data presented are representative examples of three experiments performed using three separate NK clones.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
There is increasing evidence that lipid rafts are involved in the initiation and organization of signaling cascades downstream of activating receptors on lymphocytes and are primary sites of tyrosine phosphorylation (1, 2). Consistent with this, disruption of lipid rafts by sequestration or removal of cholesterol severely compromises initial activation events such as tyrosine phosphorylation and calcium mobilization downstream of activating receptors on lymphocytes (6, 11, 37, 38). We have recently shown that inactivation of Src- or Syk-family PTKs by pharmacological inhibitors or inhibition of PTK-activated signaling cascades by activation of the killer Ig-related receptor-associated SH2-domain containing phosphatase-1 blocks lipid raft polarization to the site of target contact (17). Taken together, these data suggest that there is a positive feedback loop between raft aggregation and signal propagation, with the initial triggering of lymphocytes through their activating receptors inducing a small-scale raft aggregation and initiation of signal transduction pathways. This initial small-scale activation could then lead to the movement of more rafts to the site of target contact, resulting in the formation of "macrorafts" and full-scale activation. This hypothesis suggests that movement of lipid rafts to the area of contact between the lymphocyte and target cell is an active signal-driven process requiring the initial activation of lipid rafts in the vicinity that would then begin an amplification process leading to the subsequent recruitment of other lipid rafts and their associated molecules. Our data highlight a role for the RhoA->ROCK->LIMK1 pathway in the regulation of lipid raft movement.

Recent data have implicated Vav-1, an upstream activator of Rac/Rho-family GTPases, as a critical regulator of actin-induced TCR capping (39). In addition, using T cells from mice carrying homozygous or heterozygous deletions of Vav-1, it was found that the concentration of class II MHC/TCR clusters at the T cell/APC interface was significantly diminished after stimulation with either superantigen or specific peptide/MHC II complexes (40). Moreover, pretreatment of T cells with C3-exoenzyme blocks both LFA-1 activation and inhibits sustained levels of intracellular calcium and the production of IL-2 in response to TCR cross-linking (41, 42, 43). Taken together, these data suggest that repositioning of cell surface molecules at the T cell/APC interface and the polarization of lipid rafts to the site of contact between the NK and target cell involve the regulation of the actin cytoskeleton.

Our data suggest that the regulation of the actin cytoskeleton by RhoA/p160ROCK/LIMK1 in cytotoxic lymphocytes is an important event in the development of cell-mediated killing and the polarization of lipid rafts to the effector/target interface. We have shown that LIMK1 is activated during natural cytotoxicity and upon FcR engagement and that this activation can be blocked by pretreatment of the NK clone with the p160ROCK inhibitor Y-27632 (Fig. 1Go, B and D–F). In addition, we have shown in NK clones that, in contrast to the p160ROCK protein, which appears to primarily cytosolic, LIMK1 is localized to the plasma membrane (Fig. 4GoE). This is interesting because previous analysis of LIMK1 localization in neurons and epithelial cells has shown a primarily cytoplasmic distribution with some nuclear staining (44). Localization of LIMK1 to the plasma membrane was also observed in the myeloid cell line K562 (Fig. 4GoF), but whether or not this is a common feature of cells of the hematopoietic lineage remains to be determined. The localization of LIMK1 to the plasma membrane in lymphocytes could allow a local activation of LIMK1 after the recruitment of p160ROCK to the effector/target interface that would serve to phosphorylate and activate LIMK1 locally to provide a polarized polymerization of F-actin at the cell-cell contact site. Significantly, we have observed an increase in F-actin content at the cell-cell contact area that can be decreased by inhibition of the p160ROCK or LIMK1 pathways.

Although there are no data implicating myosin activity in the control of cellular cytotoxicity, it is clear that the transport of receptors to the T cell immunological synapse requires myosin activity (45). Interestingly, ROCK has recently been found to both directly and indirectly influence myosin activity through the phosphorylation of an inhibitory site on the myosin-binding subunit of myosin phosphatase and through the phosphorylation of the regulatory L chain of myosin (28, 46). Therefore, it will be of interest to determine whether another mechanism by which ROCK controls lipid raft polarization and the development of cell-mediated killing is through its regulation of myosin.

The data presented in this paper, as well as our previous data, identify the RhoA signaling pathway as a critical regulator of cell-mediated killing by cytotoxic lymphocytes (20, 22). However, it is clear that other low-m.w. GTPases, such as Rac1 and CDC42, also control the generation of cellular cytotoxicity (D. D. Billadeau and P. J. Leibson, unpublished observation) (20, 47). However, neither the mechanism nor the effector molecules downstream of these GTPases involved in the regulation of these specific lymphocyte processes have been identified. Intriguingly, p21-activated kinase, an effector molecule of both Rac1 and CDC42, has recently been shown to directly phosphorylate and activate LIMK1 (48). However, whether or not Rac1 and CDC42 control the development of cell-mediated killing by activating a p21-activated kinase-LIMK1 pathway remains to be tested. Furthermore, the partial inhibition of F-actin polymerization at the site of target engagement that we observe by overexpression of dominant-negative p160ROCK and LIMK1 might be explained by the activation of other RhoA, Rac, or CDC42 effector molecules involved in the reorganization of the actin cytoskeletal network. The identification of other Rho/Rac effector molecules in the regulation of cell-mediated killing remains to be determined.

Our data identify a previously undefined role for the RhoA->p160ROCK->LIMK1 pathway in the development of cell-mediated killing. Further characterization of other molecules downstream of RhoA and p160ROCK that are involved in the regulation of lipid raft polarization during the development of cellular cytotoxicity will be a key step in understanding how this pathway regulates such a critical lymphocyte function. Lastly, understanding how this pathway regulates not only the development of cellular cytotoxicity, but also the regulation of cytoskeleton-dependent activation of other cells within the immune system, may lead to the development of small molecule inhibitors that could be used for immunomodulation.


   Acknowledgments
 
We thank Dr. S. Narumiya for generously providing the p160ROCK cDNA and Yoshitomi Pharmaceutical Industries Ltd. for providing the ROCK inhibitor, Y-27632.


   Footnotes
 
1 This work was supported by the Mayo Foundation and by National Institutes of Health Grant CA-47752 (to P.J.L.). D.D.B. is a Special Fellow of the Leukemia and Lymphoma Society. Back

2 Z.L. and D.D.B. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Paul J. Leibson, Department of Immunology, Mayo Clinic, 200 First Street SW, Rochester, MN 55905. E-mail address: leibson.paul{at}mayo.edu Back

4 Abbreviations used in this paper: PTK, protein tyrosine kinase; LIMK1, LIM-kinase 1; ERK, extracellular signal-related kinase; CTxB, cholera toxin B subunit. Back

Received for publication May 29, 2001. Accepted for publication September 7, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Xavier, R., B. Seed. 1999. Membrane compartmentation and the response to antigen. Curr. Opin. Immunol. 11:265.[Medline]
  2. Horejsi, V., K. Drbal, M. Cebecauer, J. Cerny, T. Brdicka, P. Angelisova, H. Stockinger. 1999. GPI-microdomains: a role in signaling via immunoreceptors. Immunol. Today 20:356.[Medline]
  3. Viola, A., S. Schroeder, Y. Sakakibara, A. Lanzavecchi. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283:680.[Abstract/Free Full Text]
  4. Pralle, A., P. Keller, E. L. Fjorin, K. Simons, J. K. H. Horber. 2000. Sphingolipid-cholesterol rafts diffuse as small entities in the plasma membrane of mammalian cells. J. Cell Biol. 148:997.[Abstract/Free Full Text]
  5. Montixi, C., C. Langlet, A. M. Bernard, J. Thimonier, C. Dubois, M. A. Wurbel, J. P. Chauvin, M. Pierres, H.-T. He. 1998. Engagement of T cell receptor triggers its recruitment to low-density detergent-insoluble membrane domains. EMBO J. 17:5334.[Medline]
  6. Xavier, R., T. Brennan, Q. Li, C. McCormack, B. Seed. 1998. Membrane compartmentation is required for efficient T cell activation. Immunity 8:723.[Medline]
  7. Zhang, W., R. P. Trible, L. E. Samelson. 1998. LAT palmitoylation: its essential role in membrane microdomain targeting and tyrosine phosphorylation during T cell activation. Immunity 9:239.[Medline]
  8. Ilangumaran, S., S. Arni, G. van Echten-Deckert, B. Borisch, D. C. Hoessli. 1999. Microdomain-dependent regulation of Lck and Fyn protein-tyrosine kinases in T lymphocyte plasma membranes. Mol. Biol. Cell 10:891.[Abstract/Free Full Text]
  9. Janes, P. W., S. C. Ley, A. I. Magee. 1999. Aggregation of lipid rafts accompanies signaling via the T cell antigen receptor. J. Cell Biol. 147:447.[Abstract/Free Full Text]
  10. Janes, P. W., S. C. Ley, A. I. Magee, P. S. Kabouridis. 2000. The role of lipid rafts in T cell antigen receptor (TCR) signalling. Semin. Immunol. 12:s23.
  11. Sheets, E. D., D. Holowka, B. Baird. 1999. Critical role for cholesterol in Lyn mediated tyrosine phosphorylation of Fc epsilon RI and their association with detergent-resistant membranes. J. Cell Biol. 145:877.[Abstract/Free Full Text]
  12. Einspahr, K. J., R. T. Abraham, B. A. Binstadt, Y. Uehara, P. J. Leibson. 1991. Tyrosine phosphorylation provides an early and requisite step for the activation of natural killer cell cytolytic function. Proc. Natl. Acad. Sci. USA 88:6279.[Abstract/Free Full Text]
  13. Vivier, E., P. Morin, C. O’Brien, B. Druker, S. F. Schlossman, P. Anderson. 1991. Tyrosine phosphorylation of the Fc{gamma}RIII(CD16) {zeta} complex in human natural killer cells: induction by antibody-dependent cytotoxicity but not by natural killing. J. Immunol. 146:206.[Abstract]
  14. O’Shea, J. J., D. W. McVicar, D. B. Kuhns, J. R. Ortaldo. 1992. A role for protein tyrosine kinase activity in natural cytotoxicity as well as antibody-dependent cellular cyototoxicity. J. Immunol. 148:2497.[Abstract]
  15. Brumbaugh, K. M., B. A. Binstadt, D. D. Billadeau, R. A. Schoon, C. J. Dick, R. M. Ten, P. J. Leibson. 1997. Functional role for Syk tyrosine kinase in NK cell-mediated natural cytotoxicity. J. Exp. Med. 186:1965.[Abstract/Free Full Text]
  16. Leibson, P. J.. 1997. Signal transduction during natural killer cell activation: Inside the mind of a killer. Immunity 6:655.[Medline]
  17. Lou, Z., D. Jevremovic, D. D. Billadeau, P. J. Leibson. 2000. A balance between positive and negative signals in cytotoxic lymphocytes regulates the polarization of lipid rafts during the development of cell-mediated killing. J. Exp. Med. 191:347.[Abstract/Free Full Text]
  18. Altman, A., M. Deckert. 1999. The function of small GTPases in signaling by immune recognition and other leukocyte receptors. Adv. Immunol. 72:1.[Medline]
  19. Kaibuchi, K., S. Kuroda, M. Amano. 1999. Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 68:459.[Medline]
  20. Billadeau, D. D., K. M. Brumbaugh, C. J. Dick, R. A. Schoon, X. R. Bustelo, P. J. Leibson. 1998. The Vav-Rac1 pathway in cytotoxic lymphocytes regulates the generation of cell-mediated killing. J. Exp. Med. 188:549.[Abstract/Free Full Text]
  21. Billadeau, D. D., S. M. Mackie, R. A. Schoon, P. J. Leibson. 2000. The Rho family guanine nucleotide exchange factor Vav-2 regulates the development of cell-mediated cytotoxicity. J. Exp. Med. 192:381.[Abstract/Free Full Text]
  22. Lang, P., L. Guizani, I. Vitte-Mony, R. Stancou, O. Dorseuli, G. Gacon, J. Bertoglio. 1992. ADP-ribosylation of the ras-related GTP-binding protein RhoA inhibits lymphocyte-mediated cytotoxicity. J. Biol. Chem. 267:11677.[Abstract/Free Full Text]
  23. Leung, T., E. Manser, L. Tan, L. Lim. 1995. A novel serine/threonine kinase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes. J. Biol. Chem. 270:29051.[Abstract/Free Full Text]
  24. Ishizaki, T., M. Maekawa, K. Fujisawa, K. Okawa, A. Iwamatsu, A. Fujita, N. Watanabe, Y. Saito, A. Kakizuka., N. Morii, et al 1996. The small GTP-binding protein Rho binds to and activates a 160 kDa Ser.Thr protein kinase homologous to myotonic dystrophy kinase. EMBO J. 15:1885.[Medline]
  25. Matsui, T., M. Amano, T. Yamamoto, K. Chihara, M. Nakafuku, M. Ito, T. Nakano, K. Okawa, A. Iwamatsu, K. Kaibuchi. 1996. Rho-associated kinase, a novel serine/threonine kinase, as a putative target for the small GTP binding protein Rho. EMBO J. 15:2208.[Medline]
  26. Nakagawa, O., K. Fujisawa, T. Ishizaki, Y. Saito, K. Nakao, S. Narumiya. 1996. ROCK-I and ROCK-II, two isoforms of Rho-associated coiled-coil forming protein serine/threonine kinase in mice. FEBS Lett. 392:189.[Medline]
  27. Narumiya, S., T. Ishizaki, N. Watanabe. 1997. Rho effectors and reorganization of actin cytoskeleton. FEBS Lett. 410:68.[Medline]
  28. Kawano, Y., Y. Fukata, N. Oshiro, M. Amano, T. Nakamura, M. Ito, F. Matsumura, M. Inagaki, K. Kaibuchi. 1999. Phosphorylation of myosin-binding subunit (MBS) of myosin phosphatase by Rho-kinase in vivo. J. Cell Biol. 147:1023.[Abstract/Free Full Text]
  29. Maekawa, M., T. Ishizaki, S. Boku, N. Watanabe, A. Fujita, A. Iwamatsu, T. Obinata, K. Ohashi, K. Mizuno, S. Narumiya. 1999. Signaling from Rho to the actin cytoskeleton through protein kinases ROCK and LIM-kinase. Science 285:895.[Abstract/Free Full Text]
  30. Ohashi, K., K. Nagata, M. Maekawa, T. Ishizaki, S. Narumiya, K. Mizuno. 2000. Rho-associated kinase ROCK activates LIM-kinase 1 by phosphorylation at threonine 508 within the activation loop. J. Biol. Chem. 275:3577.[Abstract/Free Full Text]
  31. Weernink, P. A. O., P. Schulte, Y. Guo, J. Wetzel, M. Amano, K. Kaibuchi, S. Haverland, M. Vos, M. Schmidt, G. W. Mayr, et al 2000. Stimulation of phosphatidylinositol-4-phosphate 5-kinase by Rho-kinase. J. Biol. Chem. 275:10168.[Abstract/Free Full Text]
  32. Arber, S., F. A. Barbayannis, H. Hanser, C. Schneider, C. A. Stanyon, O. Bernard, P. Caroni. 1998. Regulation of actin dynamics through phosphorylation of cofilin by LIM-kinase. Nature 393:805.[Medline]
  33. Yang, N., O. Higuchi, K. Ohashi, K. Nagata, A. Wada, K. Kangawa, E. Nishida, K. Mizuno. 1998. Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated actin reorganization. Nature 393:809.[Medline]
  34. Pross, H. F., M. G. Baines, P. Rubin, P. Shragge, M. S. Patterson. 1981. Spontaneous human lymphocyte-mediated cytotoxicity against tumor cells: the quantitation of natural killer cell activity. J. Clin. Immunol. 1:51.[Medline]
  35. Ishizaki, T., M. Naito, K. Fujisawa, M. Maekawa, N. Watanabe, Y. Saito, S. Narumiya. 1997. p160ROCK, a Rho-associated coiled-coil forming protein kinase, works downstream of Rho and induces focal adhesions. FEBS Lett. 404:118.[Medline]
  36. Uehata, M., T. Ishizaki, H. Satoh, T. Ono, T. Kawahara, T. Morishita, H. Tamakawa, K. Yamagami, J. Inui, M. Maekawa, et al 1997. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389:990.[Medline]
  37. Field, K. A., D. Holowka, B. Baird. 1995. Fc{epsilon}RI-mediated recruitment of p53/56 lyn to detergent-resistant membrane domains accompanies cellular signaling. Proc. Natl. Acad. Sci. USA 92:9201.[Abstract/Free Full Text]
  38. Kabouridis, P. S., A. I. Magee, S. C. Ley. 1997. S-acylation of Lck protein tyrosine kinase is essential for its signalling function in T lymphocytes. EMBO J. 16:4983.[Medline]
  39. Fischer, K.-D., Y.-Y. Kong, H. Nishina, K. Tedford, L. E. M. Marengere, I. Kozieradzki, T. Sasaki, M. Starr, G. Chan, S. Gardener, et al 1998. Vav is a regulator of TCR-mediated cytoskeleton reorganization required for proliferation, interleukin 2 production, and T cell maturation. Curr. Biol. 8:554.[Medline]
  40. Wulfing, C., A. Bauch, G. R. Crabtree, M. M. Davis. 2000. The vav exchange factor is an essential regulator in actin-dependent receptor translocation to the lymphocyte-antigen-presenting cell interface. Proc. Natl. Acad. Sci. USA 97:10150.[Abstract/Free Full Text]
  41. Tominaga, T., K. Sugie, M. Hirata, N. Morii, J. Fukata, A. Uchida, H. Imura, S. Narumiya. 1993. Inhibition of PMA-induced, LFA-1-dependent lymphocyte aggregation by ADP ribosylation of the small molecular weight GTP binding protein, Rho. J. Cell Biol. 120:1529.[Abstract/Free Full Text]
  42. Laudanna, C., J. J. Campbell, E. C. Butcher. 1996. Role of Rho in chemoattractant-activated leukocyte adhesion through integrins. Science 271:981.[Abstract]
  43. Angkachatchai, V., T. H. Finkel. 1999. ADP-ribosylation of Rho by C3 ribosyltransferase inhibits IL-2 production and sustained calcium influx in activated T cells. J. Immunol. 163:3819.[Abstract/Free Full Text]
  44. Stanyon, C. A., A. Bernard. 1999. Molecules in focus: LIM-kinase1. Int. J. Biochem. Cell Biol. 31:389.[Medline]
  45. Wulfing, C., M. M. Davis. 1998. A receptor/cytoskeletal movement triggered by costimulation during T cell activation. Science 282:2266.[Abstract/Free Full Text]
  46. Kureishi, Y., S. Kobayashi, M. Amano, K. Kimura, H. Kanaide, T. Nakano, K. Kaibuchi, M. Ito. 1997. Rho-associated kinase directly induces smooth muscle contraction through myosin light chain phosphorylation. J. Biol. Chem. 272:12257.[Abstract/Free Full Text]
  47. Jiang, K., B. Zhong, D. L. Gilvary, B. C. Corliss, E. Hong-Geller, S. Wei, J. Y. Djeu. 2000. Pivotal role of phosphoinositide-3 kinase in regulation of cytotoxicity in natural killer cells. Nat. Immunol. 1:419.[Medline]
  48. Edwards, D. C., L. C. Sanders, G. M. Bokock, G. N. Gill. 1999. Activation of LIMK-kinase by Pak1 couples Rac/CDC42 GTPase signaling to actin cytoskeletal dynamics. Nat. Cell Biol. 1:253.[Medline]



This article has been cited by other articles:


Home page
 J. Cell Sci.Home page
Y. Huang and J. K. Burkhardt
T-cell-receptor-dependent actin regulatory mechanisms
J. Cell Sci., March 1, 2007; 120(5): 723 - 730.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
R. Galandrini, F. Micucci, I. Tassi, M. G. Cifone, B. Cinque, M. Piccoli, L. Frati, and A. Santoni
Arf6: a new player in Fc{gamma}RIIIA lymphocyte-mediated cytotoxicity
Blood, July 15, 2005; 106(2): 577 - 583.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
T. S. Soderstrom, S. D. Nyberg, and J. E. Eriksson
CD95 capping is ROCK-dependent and dispensable for apoptosis
J. Cell Sci., May 15, 2005; 118(10): 2211 - 2223.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. M. Vyas, H. Maniar, C. E. Lyddane, M. Sadelain, and B. Dupont
Ligand Binding to Inhibitory Killer Cell Ig-Like Receptors Induce Colocalization with Src Homology Domain 2-Containing Protein Tyrosine Phosphatase 1 and Interruption of Ongoing Activation Signals
J. Immunol., August 1, 2004; 173(3): 1571 - 1578.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
C. C. Stebbins, C. Watzl, D. D. Billadeau, P. J. Leibson, D. N. Burshtyn, and E. O. Long
Vav1 Dephosphorylation by the Tyrosine Phosphatase SHP-1 as a Mechanism for Inhibition of Cellular Cytotoxicity
Mol. Cell. Biol., September 1, 2003; 23(17): 6291 - 6299.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Silva, A. Beckedorf, and E. Bieberich
Osteoblast-derived Oxysterol Is a Migration-inducing Factor for Human Breast Cancer Cells
J. Biol. Chem., July 3, 2003; 278(28): 25376 - 25385.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P.-L. Tharaux, R. C. Bukoski, P. N. Rocha, S. D. Crowley, P. Ruiz, C. Nataraj, D. N. Howell, K. Kaibuchi, R. F. Spurney, and T. M. Coffman
Rho Kinase Promotes Alloimmune Responses by Regulating the Proliferation and Structure of T Cells
J. Immunol., July 1, 2003; 171(1): 96 - 105.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
D. Khurana and P. J. Leibson
Regulation of lymphocyte-mediated killing by GTP-binding proteins
J. Leukoc. Biol., March 1, 2003; 73(3): 333 - 338.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lou, Z.
Right arrow Articles by Leibson, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lou, Z.
Right arrow Articles by Leibson, P. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS