The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirota, H.
Right arrow Articles by Tamura, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirota, H.
Right arrow Articles by Tamura, G.
The Journal of Immunology, 2001, 167: 66-74.
Copyright © 2001 by The American Association of Immunologists

Novel Roles of CpG Oligodeoxynucleotides as a Leader for the Sampling and Presentation of CpG-Tagged Antigen by Dendritic Cells1

Hidekazu Shirota*, Kunio Sano2,*, Noriyasu Hirasawa{ddagger}, Tadashi Terui{dagger}, Kazuo Ohuchi{ddagger}, Toshio Hattori*, Kunio Shirato* and Gen Tamura*

* First Department of Internal Medicine and {dagger} Department of Dermatology, Tohoku University School of Medicine, Sendai, Japan; and {ddagger} Laboratory of Pathophysiological Biochemistry, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oligodeoxynucleotides containing CpG motifs have been highlighted as potent Th1 activators. We previously reported that Ag and CpG, when conjugated together, synergistically promoted the Ag-specific Th1 development and inhibited the Th2-mediated airway eosinophilia. In this study, we examined the mechanisms underlying the synergism of the covalent conjugation. The CpG-OVA conjugate enhanced the Th1 activation and development. These characteristic features of the conjugate could not be ascribed to the polymerization of OVA, but mirrored the augmented binding of the CpG-tagged Ag to dendritic cells (DCs) in a CpG-guided manner, because phycobiliprotein, R-PE, conjugated to CpG stained a higher proportion of DCs with higher intensity than the mixture. R-PE fluorescence was emitted from cytoplasmic portions of the DCs, which simultaneously expressed costimulatory molecules and IL-12. The CpG-conjugated R-PE trafficking described above actually served as a potent Ag. These results indicate that CpG conjugated to Ag exhibit novel joint properties as promoters of Ag uptake and DC activators, thereby potentiating the ability of DCs to generate Th1 cells. The DNA-mediated promotion of Ag uptake would be advantageous for evoking host immune responses against invading microorganisms.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nature of DNAs as immune stimulators has recently been attracting much interest. The initial finding was made by Tokunaga and his colleagues (1, 2), who reported that DNA extracted from Mycobacterium bovis activated NK cells for IFN production and antitumor activities. They additionally discovered that the ability to stimulate NK cells was limited to DNAs from invertebrates but not vertebrates, and that particular sequences with a G-C motif(s) were required for the activity (3, 4). Then, Krieg et al. (5) reported that oligodeoxynucleotides (ODNs)3 containing CpG motifs with two 5' purines and two 3' pyrimidines triggered B cells to proliferate and differentiate into Ig-secreting cells. CpG were also found to activate monocytes and macrophages, which produced IL-12 and stimulated NK cells (6, 7, 8, 9). Dendritic cells (DCs) were another target of CpG; CpG induced IL-12-secreting DCs, which in turn stimulated Th1 cells (10, 11, 12, 13, 14).

DCs are known as initiators of immune responses that present Ag in a form recognizable by T cells (15). The key steps include Ag uptake at an immature stage in the peripheral tissues and pre- sentation of antigenic peptides along with the expression of costimulatory molecules after maturation in the lymphoid tissues (16, 17, 18, 19, 20, 21, 22, 23). Two different processes, namely, Ag processing and maturation/activation, must be combined for full competence of DCs. Confrontation with microorganisms additionally endows DCs with the ability to secrete IL-12 (24, 25, 26), which skews immune responses toward the Th1-dominant phenotype (27, 28). Among microbial structures, CpG are reported to contribute to expelling the microbes by preferentially mounting Th1 responses as the result of the DC activation and IL-12 secretion (9, 10, 11, 12, 13, 29, 30). As demonstrated by microbes, substances that possess both an antigenic component and a DC activation/maturation component are likely to propel DC-mediated Th1 cell stimulation.

Counterbalancing Th2-dominated allergic inflammation is one possible target for the control of allergy. We have previously reported that regulatory CD4+ T cells, such as TGF-{beta}-producing T cells induced by oral or tracheal tolerance and Th1 cells induced upon exposure to Mycobacterium tuberculosis, inhibited Th2-mediated airway inflammation (31, 32, 33). More recently, we have reported that intratracheal coadministration of CpG and allergen inhibited airway eosinophilia and hyperresponsiveness in a synergistic manner and reasoned that the APC phagocytosing both CpG and Ag could target the CpG effects to Ag-specific T cells (34). This view was supported by subsequent experiments in which covalently linked conjugates of CpG with Ag inhibited airway eosinophilia and Ag-specific Th2 cells more efficiently than the unconjugated mixture (35). The efficacy of CpG-Ag conjugates was also reported in the other experimental systems (36, 37, 38, 39).

In this study, we explored the mechanisms underlying the synergism of the covalent conjugation. We found an unexpected role of CpG as a leader of Ag uptake by DCs. Thus, CpG conjugated to Ag exhibit novel joint properties as promoters of Ag uptake and DC activators, thereby potentiating the ability of DCs to develop Th1 cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

BALB/c mice were bred in our animal facility and were used at 7–12 wk of age. BALB/c mice transgenic (tg) for TCR specific for OVA323–339 and I-Ad were established as described previously (40).

CpG and direct conjugation to Ags

The CpG ODNs (1826) used throughout this study consisted of 20 bases containing two CpG motifs (TCCATGACGTTCCTGACGTT) (34, 35). The control ODN (1745) was identical except that the CpG motifs were rearranged (TCCATGAGCTTCCTGAGTCT). Phosphorothioate ODNs were synthesized by Nihon Gene Research Laboratories (Sendai, Japan) or Takara Shuzo (Osaka, Japan). The method for conjugating ODN to proteins was described previously (35). The CpG-OVA conjugate was prepared by Peptide Institute (Osaka, Japan). The LPS content of ODN was <6 pg of LPS per mg of DNA as measured by a Limulus HS-J Single Test (Wako Pure Chemical, Osaka, Japan). Free ODNs were removed by extensive dialysis. The molar and weight ratio of ODN:OVA in the conjugate was calculated to be 8.3:1 and 1.1:1, respectively. CpG ODN or non-CpG ODN was also conjugated to R-PE (Molecular Probes, Eugene, OR) after R-PE was maleimide activated using sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carobylate according to the manufacturer’s instructions (Pierce, Rockford, IL). The molar and weight ratio of ODN:R-PE in the CpG-R-PE conjugate was calculated to be 3.7:1 and 0.092:1, respectively. The ratio of ODN:R-PE in the non-CpG-R-PE conjugate was equal to that in the CpG-R-PE conjugate.

In vitro stimulation of naive anti-OVA T cells with CpG and OVA

Spleen cells (5 x 106) from unimmunized anti-OVA TCR tg mice were cultured in 12-well plates with OVA (0.1 µg/ml) or CpG (0.11 µg/ml), either alone or in the mixed or conjugated form. After 6 days, viable lymphocytes (1 x 105) recovered by Ficoll-Paque (Pharmacia Biotech, Uppsala, Sweden) density-gradient centrifugation were restimulated with 2 x 105 APCs in the presence or absence of OVA (100 µg/ml) in quadruplicate in 96-well plates. After 2 days of culture, the culture supernatants were assayed for IFN-{gamma} and IL-4. APCs were prepared by treating spleen cells of unimmunized BALB/c mice with mitomycin C (50 µg/ml; Wako Pure Chemical) for 30 min at 37°C.

In vitro restimulation of anti-OVA Th1 or Th2 cells with CpG and OVA

Spleen cells (3 x 107) from unimmunized anti-OVA TCR tg mice were cultured in 12 ml of RPMI 1640 medium with OVA (100 µg/ml) in the presence of IL-12 (1 ng/ml; Genzyme, Cambridge, MA) for Th1 cells or IL-4 (10 ng/ml; Genzyme) plus anti-IL-12 mAb (0.1 µg/ml; Genzyme) for Th2 cells for 3 days. The cells were cultured in fresh medium for another 3 days. Viable lymphocytes were enriched for CD4+ T cells by a panning method as described previously (32, 41). After coculture of 1 x 105 CD4+ T cells and 2 x 105 APCs in the presence of OVA or CpG, either alone or in the mixed or conjugated form, for 2 days in quadruplicate in 96-well plates, the culture supernatants were assayed for IFN-{gamma} and IL-4.

Fractionation of the CpG-OVA conjugate

Crude CpG-OVA conjugate was applied to a Sephacryl S-200 HR (Amersham Pharmacia Biotech, Piscataway, NJ) column, 1.8 x 73 cm, equilibrated in PBS (pH 7.4), and eluted with the same buffer. Aliquots of the fractions from the column were subjected to SDS-PAGE. Proteins and CpG were visualized with GelCode Blue Stain Reagent (Pierce) and SYBR Green II RNA Gel Stain (BioWhittaker, Rockland, ME), respectively. For in vitro experiments, each fraction was added to the in vitro cultures to induce or stimulate Th1 cells.

Fractionation of the CpG-R-PE conjugate

Crude CpG-R-PE was applied to a DE52 (Whatman, Tewksbury, MA) minicolumn, 5 x 5 mm, equilibrated in 5 mM potassium phosphate buffer (pH 7.0). Proteins were eluted with a stepwise gradient of 0.1–1.0 M NaCl in the same buffer (pH 7.0). Aliquots of fractions from the column were subjected to SDS-PAGE, and proteins and CpG were visualized as described above. For in vitro experiments, each fraction was incubated with splenic DCs as described below.

In vitro restimulation of R-PE-primed lymph node (LN) cells with CpG and R-PE

BALB/c mice were primed s.c. with 100 µg of R-PE emulsified in CFA in the hind footpads. After 7 days, popliteal LN cells (3 x 105/well) were cultured with CpG (1 µg/ml) or R-PE (11 µg/ml), either alone or in the mixed or conjugated form, in quadruplicate in 96-well plates. After 2 days, the culture supernatants were assayed for IFN-{gamma} and IL-4.

Cytokine assay

Cytokine concentrations in the culture supernatants were determined using ELISA according to the manufacturer’s recommendations. Paired anti-IL-4, anti-IL-5, and anti-IFN-{gamma} mAbs were purchased from PharMingen (San Diego, CA). Tetramethylbenzidine reagent (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was used for color development, and ODs determined at 450 nm were converted to concentrations (ng/ml) according to a standard curve. Standard recombinant mouse IL-4, IL-5, and IFN-{gamma} were purchased from Genzyme.

Enrichment for DCs from spleen

BALB/c spleen cells were cut into small fragments and incubated with RPMI 1640 supplemented with 1 mg/ml collagenase D (Boehringer Mannheim, Indianapolis, IN) for 30 min at 37°C. After washing, they were layered onto 50% Percoll and centrifuged for 20 min at 3000 rpm. The interface was recovered and used as the DC-enriched fraction for flow cytometry analysis. The average percentage of CD11c+ cells was ~2% in the spleen before the enrichment, which was consistently increased to 35–40% after the enrichment.

Preparation of DCs from bone marrow

Bone marrow-derived DCs were prepared from BALB/c mice as described elsewhere (42). Briefly, bone marrow cells (2 x 106 cells) obtained from femurs were seeded into a 100-mm petri dish (Eiken Chemical, Tokyo, Japan) in 10 ml of RPMI 1640 supplemented with 10% FCS and GM-CSF (20 ng/ml; PeproTech, London, U.K.). At day 3, another 10 ml of medium containing 20 ng/ml GM-CSF was added to the plates. At days 6 and 8, half of the culture supernatants were replaced with the fresh medium containing 20 ng/ml GM-CSF. At day 10, the adherent cells were used as DCs. The cell numbers recovered from one plate were generally 3–5 x 106 cells.

Reagents used for flow cytometry

Purified anti-CD11c mAb (N418) specific for DCs (43) was purchased from Serotec (Oxford, U.K.) and conjugated to FITC (Sigma, St. Louis, MO) in our laboratory. Biotinylated anti-CD40 and anti-CD86 mAbs were purchased from Caltag (Burlingame, CA). Allophycocyanin-conjugated streptavidin (SA), propidium iodide, and unconjugated and FITC-conjugated anti-IL-12 mAbs were purchased from Biomeda (Foster City, CA), Sigma, PharMingen, and BioSource International (Camarillo, CA), respectively.

Staining of DC-enriched spleen cells and flow cytometry

The DC-enriched splenocytes were incubated with 1 µg/ml CpG or 11 µg/ml R-PE, either alone or mixed, or varying concentrations of CpG-conjugated R-PE for 3 h and then stained with FITC-conjugated anti-CD11c mAb. The R-PE staining of the gated CD11+ cells was analyzed using a FACSCaliber (BD Biosciences, Mountain View, CA). Propidium iodide-stained dead cells were excluded from analyses.

Analyses of bone marrow-derived DCs by flow cytometry

The DC-enriched population derived from bone marrow was cultured overnight with 1 µg/ml CpG either alone, mixed, or conjugated with 11 µg/ml R-PE. After extensive washing, the cells were stained with FITC-conjugated anti-CD11c mAb along with biotinylated anti-CD40 or anti-CD86 mAb. Binding of biotinylated mAbs was detected with allophycocyanin-conjugated SA. The correlations between R-PE staining and the CD40 or CD86 expression on the viable CD11c+ DCs were analyzed. For staining of intracytoplasmic IL-12, the DC population was cultured with R-PE and/or CpG for 6 h, with 10 µg/ml brefeldin A (Wako Pure Chemical) added for the final 2 h. After staining with biotinylated anti-CD11c mAb and allophycocyanin-conjugated SA, the cells were treated with cell permeabilization solution (Immunotech, Minneapolis, MN.) and then stained with FITC-conjugated anti-IL-12 mAb. Where indicated, a 20-fold excess of free anti-IL-12 mAb was also added. They were analyzed for intracytoplasmic IL-12 by flow cytometry.

Confocal microscopy

The DC-enriched cells derived from bone marrow were cultured overnight with CpG (0.1 µg/ml) conjugated to R-PE (1.1 µg/ml) and then stained with FITC-conjugated anti-CD11c mAbs. The stained cells were examined using a confocal laser scanning microscope, MR/AG-1 (Bio-Rad, Hercules, CA). FITC and R-PE were excited with 488-nm argon and 543-nm helium-neon lasers, and emission spectra were collected with 530-nm band pass and 570-nm long pass filters, respectively. The green and red images were merged with laser sharp software (Bio-Rad).

Statistics

Data of in vitro culture experiments were expressed as the mean ± SEM. Each experiment was repeated at least twice. Student’s t test was used in the analysis of the results.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Efficient induction of Th1 development by CpG-conjugated Ag

CpG ODN is known to induce potent Th1 responses (11, 12, 13). We first examined the efficacy of the conjugation between Ag and CpG to potentiate the antigenicity and Th1 inducibility. Spleen cells from anti-OVA TCR tg mice were cultured in the presence of OVA or CpG, either alone or in the mixed or conjugated form, and the induced Th cells were restimulated with OVA for IFN-{gamma} and IL-4 production (Fig. 1GoA). OVA (0.1 µg/ml) alone or CpG (0.11 µg/ml) alone failed to manifest potent Th1-inducing ability. The mixture of OVA and CpG did not induce Th cells, whereas the conjugate between CpG and OVA induced T cells that secreted predominantly IFN-{gamma} rather than IL-4 upon restimulation with OVA. The control non-CpG ODN conjugated with OVA did not induce Th1 development. These results indicate that low doses of Ag and CpG, which were below the threshold for T cell activation, acquired the ability to induce Th1 cells when covalently conjugated together.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. Efficient induction and activation of Th1 cells by CpG-conjugated Ag. A, Spleen cells (5 x 106) from unimmunized anti-OVA TCR tg mice were cultured with OVA (0.1 µg/ml) or CpG (0.11 µg/ml), either alone or in the mixed or conjugated form, in 12-well plates. After 6 days, viable lymphocytes (1 x 105) were restimulated with 2 x 105 mitomycin C-treated spleen cells in the presence or absence of OVA (100 µg/ml) in quadruplicate in 96-well plates. Culture supernatants recovered after 2 days of culture were assayed for IFN-{gamma} and IL-4. The conjugate, but not the mixture, of CpG and OVA induced Th1 cells, indicating that the conjugation of CpG to Ag potentiates the antigenicity and Th1 cell inducibility. B, Spleen cells from unimmunized anti-OVA TCR tg mice were cultured with OVA (100 µg/ml) along with IL-12 (1 ng/ml) for Th1 cells or IL-4 (10 ng/ml) plus anti-IL-12 mAb (0.1 µg/ml) for Th2 cells. After 6 days, 1 x 105 CD4+ T cells and 2 x 105 APCs were cultured in the presence of OVA (1 µg/ml) or CpG (1.1 µg/ml) either alone or in the mixed or conjugated form. After 2 days, culture supernatants were assayed for IFN-{gamma} and IL-4. Production of IFN-{gamma} from the Th1 cells and IL-4 from the Th2 cells was verified by stimulating the Th cells with 100 µg/ml OVA. The conjugation, but not the mixture, of Ag and CpG enhanced the antigenicity, leading to the predominant production of IFN-{gamma} from the Th cells, regardless of the conditions in which the Th cells had developed. Cytokines in cultures without Ag were not detected. The experiments were repeated independently three times with similar results. *, p < 0.0001, in comparison with the CpG + OVA group.

 
Preferential secretion of IFN-{gamma} from Th cells by CpG-conjugated Ag

We next examined the stimulation of Th1 and Th2 cells by the CpG-OVA conjugate. Th1- and Th2-enriched fractions were prepared by culturing anti-OVA TCR tg T cells in vitro under Th1 and Th2 skewing conditions, respectively. Th1 or Th2 population produced IFN-{gamma} or IL-4 predominantly upon stimulation with 100 µg/ml OVA (Fig. 1GoB). One microgram of OVA/ml or 1.1 µg CpG/ml alone had no stimulatory activity on the Th1 or Th2 populations. The mixture of OVA and CpG still failed to stimulate Th cells, whereas the conjugate of CpG with OVA showed stimulatory antigenicity; the Th1-rich population produced higher amounts of IFN-{gamma} by 1 µg OVA/ml conjugated to CpG than by 100-fold higher doses of OVA alone. A striking difference was noted in the activation of the Th2 population by the conjugate; although the levels of IL-4 production were comparable to those by 100 µg of OVA/ml alone, IFN-{gamma} production was dramatically enhanced by the CpG-OVA conjugate. Thus, the conjugation of Ag to CpG enhanced the antigenicity, leading to the predominant production of IFN-{gamma} from the Th cells, regardless of the conditions in which the Th cells had developed.

Monomeric CpG-OVA as active Th1 stimulator

The crude CpG-OVA conjugates we used in the above experiments comprised various molecular species (Fig. 2GoA, right lane). In light of the nature of OVA to aggregate with each other, CpG-OVA was separated by gel filtration chromatography and used without concentration to minimize aggregation. When an equal volume of each fraction was examined for the ability to stimulate Th1 cells, the most potent stimulatory activity was observed in fraction 24 (Fig. 2GoC), where lower molecular species were stained intensely both for protein (Fig. 2GoA) and DNA (Fig. 2GoB), and corresponded to the monomeric CpG-OVA conjugate. Proteins with higher molecular mass in fraction 24 were stained faintly for DNA and might be a spontaneous aggregate after gel filtration. Fractions with higher molecular masses exhibited lower stimulatory activities (Fig. 2GoC). Fraction 28 was stained for protein but not DNA and lacked the stimulatory activity. The molecular size of fraction 28 was identical to that of OVA alone (data not shown). The monomeric CpG-OVA (fraction 24) possessed potent Th1-inducing (Fig. 2GoD) and -activating (Fig. 2GoE) ability, indicating that the activity of CpG-OVA can be ascribed to the monomeric CpG-conjugated OVA, but not to the aggregates.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 2. Monomeric CpG-OVA as active Th1 stimulator. The CpG-OVA conjugate used in Fig. 1Go (herein referred to as crude CpG-OVA) was analyzed using a Sephacryl S-200 HR. Aliquots of fractions were separated by SDS-PAGE and stained for protein (A) or CpG (B). Three microliters of each fraction was added to 200-µl cultures containing Th1 cell, APCs, and OVA, and the levels of IFN-{gamma} were determined after 2 days (C). Fraction 24 was added to cultures as purified monomeric CpG-OVA to induce (D) and stimulate (E) Th1 cells, as described for Fig. 1Go. The experiments were repeated twice with similar results.

 
CpG-guided augmentation of Ag binding to DCs

To examine the mechanisms underlying the enhanced immunogenicity of CpG-Ag conjugates, we first examined the binding/uptake of CpG-tagged protein to DCs, known as potent APCs to T cells. DCs were enriched from spleen cells as described in Materials and Methods, and the purity was always found to be 35~45%, as determined by anti-CD11c (N418) staining. We used phycobiliprotein, R-PE, to track the fate of the CpG-conjugated protein. DC-enriched spleen cells were incubated with R-PE, a mixture of R-PE and CpG, or R-PE-labeled CpG for 3 h, and R-PE staining in CD11c+ cells gated as shown in Fig. 3GoA was analyzed by flow cytometry. In Fig. 3GoC, the FL2 autofluorescence of the untreated DCs is shown. When DCs were incubated with R-PE alone, only minimal proportions of the CD11c+ DCs were positive for R-PE, with varying staining intensity (Fig. 3GoD). The R-PE staining was not amplified by the copresence of unconjugated CpG and R-PE (Fig. 3GoE), whereas when the same doses of R-PE and CpG were covalently conjugated, 88% of DCs were intensely stained with R-PE (Fig. 3GoF). The percentage of R-PE-positive cells and mean fluorescence intensity (MFI) of R-PE staining correlated with the doses of the CpG-R-PE conjugate added (Fig. 3Go, F–I). At CpG doses ranging from 0.01 to 1 µg/ml, the MFI of R-PE and CpG-R-PE concentration showed a nearly linear relationship (Fig. 3GoB). The staining intensity of DCs with a mixture of R-PE and CpG (Fig. 3GoE) was almost equivalent to that with 100-fold less R-PE conjugated to CpG (Fig. 3GoH), suggesting that CpG conjugation improved the protein binding/uptake to DCs by nearly 100-fold. Thus, the protein Ag is promoted to bind to DCs in a CpG-guided manner when the protein is conjugated to, but not when mixed with, CpG.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 3. CpG-guided augmentation of Ag binding to DCs. Spleen cells enriched for DCs were incubated with the indicated reagents for 3 h and then stained with FITC-conjugated anti-CD11c mAb. CD11c+ cells were gated as shown in A and were analyzed for the R-PE staining using flow cytometry. At CpG doses ranging from 0.01 to 1 µg/ml, the staining of R-PE, a marker of Ag binding, showed a nearly linear relationship with CpG-R-PE concentrations (B). It should be noted that the conjugate of R-PE and CpG (H) stained DCs ~100-fold more intensely than the mixture (E), indicating that the CpG-tagged R-PE facilitated binding of R-PE to DCs in a CpG-guided manner. Each experiment was repeated five times independently with similar results.

 
To ascertain that the phenomena observed above actually reflect the nature of CpG-conjugated R-PE, we purified the CpG-R-PE conjugate. When the crude CpG-R-PE was fractionated by ion exchange chromatography, the majority of CpG-R-PE was eluted at concentrations ranging from 0.3 to 1.0 M, whereas the purified R-PE was eluted at lower concentrations (Fig. 4GoA). After separation by SDS-PAGE, all fractions emitted R-PE fluorescence (Fig. 4GoB), whereas fluorescent emission from CpG was discernible only in fractions eluted by 0.6 or 0.8 M NaCl (Fig. 4GoC), indicating that CpG-conjugated R-PE is eluted at high buffer concentrations. The fractions that were eluted only at high, but not low, buffer concentrations bound to DCs (Fig. 4GoD), indicating that facilitated binding to DCs is a feature unique for CpG-conjugated R-PE, but cannot be ascribed to the contaminating free or aggregated PE. Because of these observations and the paucity of the purified materials, CpG-R-PE before fractionation was used in the following experiments.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 4. Binding of purified CpG-R-PE to DC. Crude CpG-R-PE conjugate and R-PE were separated by graded concentrations of NaCl using ion exchange chromatography (A). Fractions were subjected to SDS-PAGE and exposed to UV to visualize the fluorescence emitted from R-PE (B) or that from CpG after staining with Cyber Green (C). Binding of fractionated CpG-R-PE to splenic DCs was examined as described in Fig. 3Go (D). Note that facilitated binding to DCs is a feature unique to CpG-conjugated R-PE, which cannot be ascribed to the contaminating free or aggregated R-PE.

 
Dose-dependent and coordinated increases in the Ag uptake and costimulatory molecule expression in DCs by CpG-conjugated Ag

We examined whether the binding of CpG to DCs resulted in the increased expression of costimulatory molecules. Bone marrow cells were cultured in the presence of GM-CSF, and the DC fraction was obtained by gating CD11c+ cells (Fig. 5GoA). The levels of CD40 expression were low in the DCs (Fig. 5GoB). When the bone marrow-derived DCs were incubated with 0.1 µg of R-PE-labeled CpG, slight increases in Ag uptake were observed, yet an induction of CD40+ DCs was not apparent (Fig. 5GoC). Increases in the doses of CpG-R-PE paralleled the increases in the proportion of CD40+ or R-PE+ DCs (Fig. 5GoD). At 1 µg/ml CpG, more than one-half of the DCs were activated and Ag bearing (Fig. 5GoE). The expression of CD86 (Fig. 5Go, F–I) or MHC class II molecules (data not shown) was similarly affected by the incubation with CpG–R-PE. Thus, the increase in the Ag-laden, activated DCs was proportional to the dose of the CpG-R-PE added.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 5. Dose-dependent increase in the Ag uptake and costimulatory molecule expression in DCs by CpG-conjugated Ag. Immature DCs were obtained from bone marrow cells after culture with GM-CSF for 10 days. After additional culture in the presence of graded doses of CpG-R-PE overnight, they were stained with FITC-conjugated anti-CD11c mAb in combination with biotinylated anti-CD40 (B–E) or anti-CD86 (F–I) mAb, followed by allophycocyanin-conjugated SA. CD11c+ cells, which generally comprised 60–70% of viable cells, were acquired (A), and the correlations between R-PE staining and the CD40 or CD86 expression are shown. Note that the percentages of activated DCs bearing Ag increased in proportion to the doses of CpG-R-PE. One representative of four independently performed experiments is shown.

 
Next, we compared the effects of the conjugate with those of the mixture (Fig. 6Go, A–F). When the DCs were incubated with R-PE overnight, the R-PE-positive DCs comprised only minimal proportions and were confined mainly to CD40- DCs (Fig. 6GoA). Incubation of the DCs with the mixture of CpG and R-PE promoted the activation of the majority of the DCs, whereas the accelerated activation by CpG was not associated with the increase in the R-PE uptake (Fig. 6GoB). In sharp contrast, the DCs cultured with the CpG-R-PE conjugates exhibited a dramatic increase in the population double positive for R-PE and CD40 (Fig. 6GoC); the proportion of Ag-bearing cells in CD40+ DCs increased by >10-fold. The DCs that bound CpG-R-PE inevitably expressed CD40 molecules. The amounts of Ag uptake by each DC also increased; MFI of FL2 was 516 for the CpG-R-PE conjugate in comparison to 95 for the mixture of R-PE plus CpG. Similarly, enhanced Ag uptake correlated with the increased expression of CD86 (Fig. 6Go, D–F) and class II molecules (data not shown).



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 6. Coordinated increase in the Ag uptake and costimulatory molecule expression in DCs by CpG-conjugated Ag. Experimental conditions are the same as those described in the legend of Fig. 5Go. The immature DCs were incubated with R-PE alone (11 µg/ml; A and D), the mixture of R-PE (11 µg/ml) with CpG (1 µg/ml; B and E), or CpG-conjugated R-PE (C and F) overnight, and then subjected to flow cytometry analysis. The correlations between the CD40 or CD86 expression and R-PE staining are shown. Note that the conjugation, but not the mixture, of CpG and R-PE increased the activated DCs that were also stained with Ag. In another experiment, the non-CpG was compared with CpG. The non-CpG-R-PE (H and J), which was phagocytosed by the immature DCs to a similar extent as the CpG-R-PE (G and I), failed to activate DCs for the expression of CD40 or CD86. Experiments were repeated at least twice independently with similar results.

 
As controls, aliquots of the bone marrow-derived DCs were incubated with non-CpG coupled to R-PE. As shown in Fig. 6Go, G–J, the non-CpG-R-PE was phagocytosed by immature DCs to an extent similar to the CpG-R-PE, but failed to activate DCs to express CD40 or CD86.

The DCs incubated with CpG-R-PE overnight were examined by confocal microscopy, and the experiments also verified that the majority of CD11c+ DCs emitted R-PE-derived red fluorescence from cytoplasmic portions (Fig. 7Go). These results indicate that conjugation of Ag with CpG promoted the Ag capture.



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 7. Cytoplasmic R-PE staining in the CD11c+ cells after the incubation with CpG-R-PE. Bone marrow-derived immature DCs were cultured with CpG-R-PE overnight and stained with FITC-conjugated anti-CD11c mAb. The cells were examined with confocal microscopy, and CD11c staining image only (A and D), R-PE staining image only (B and E), and merged photographs (C and F) of low (A–C) or high (D–F) magnifications are shown. Note that the majority of CD11c+ DCs are also harboring R-PE in the cytoplasmic portions.

 
IL-12 expression in DCs that phagocytosed CpG-conjugated R-PE

We examined whether CpG-conjugated R-PE allowed the preferential expression of IL-12 in the DCs that phagocytosed the CpG-R-PE conjugates. After incubation of bone marrow-derived DCs with R-PE-CpG for 6 h, they were analyzed for IL-12 expression by flow cytometry. When the DCs were cultured with R-PE alone, no induction of IL-12 expression was observed (Fig. 8GoA). The copresence of CpG with R-PE induced the expression of IL-12 in a significant proportion of the DCs, which was not, however, correlated with the increase in the R-PE uptake (Fig. 8GoB). In contrast, with the CpG-R-PE conjugates the IL-12-producing DCs were mainly confined to cells that were also strongly positive for R-PE (Fig. 8GoC). The IL-12 staining was specific, because the inclusion of free anti-IL-12 mAb inhibited IL-12 staining to levels comparable to that of the control that was not stained with FITC-conjugated anti-IL-12 mAb (Fig. 8Go, D and E). These results indicated the parallelism between Ag uptake and IL-12 expression in DCs when the DCs encounter CpG-linked Ag.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 8. IL-12 expression in DCs that phagocytosed CpG-conjugated R-PE. Bone marrow-derived immature DCs were incubated with R-PE alone (11 µg/ml) (A), the mixture of R-PE (11 µg/ml) with CpG (1 µg/ml) (B), or CpG-conjugated R-PE (C–E) for 6 h. After staining with biotinylated anti-CD11c mAb and allophycocyanin-conjugated SA, the cells were treated with cell permeabilization solution and then either stained with FITC-conjugated anti-IL-12 mAb (A–D) or unstained (E). A 20-fold excess of free anti-IL-12 mAb was also added (D). They were analyzed for the correlation between intracytoplasmic IL-12 and R-PE staining by flow cytometry. Note that, with the CpG-R-PE conjugates, the IL-12-producing DCs were mainly confined to cells which were also strongly positive for R-PE.

 
Enhanced antigenicity of CpG-R-PE to R-PE-primed LN cells

To verify that the CpG-conjugated R-PE processed in the manner described above actually served as an Ag, we examined IFN-{gamma} production from R-PE/CFA-primed LN cells. R-PE-primed LN cells produced minimal amounts of IFN-{gamma} in response to R-PE or CpG alone (Fig. 9Go). The mixture of R-PE and CpG induced a slight but significant increase in IFN-{gamma} production, while the conjugation between R-PE and CpG further enhanced IFN-{gamma} production by 6.2 times. The observed increase in antigenicity and IFN-{gamma} production by the CpG-conjugated protein Ag was consistent with the results in Figs. 1Go and 2Go.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 9. Enhanced antigenicity of CpG-R-PE to R-PE-primed LN cells. BALB/c mice were primed s.c. with 100 µg of R-PE emulsified in CFA in the hind footpads. After 7 days, popliteal LN cells (3 x 105/well) were cultured with CpG (1 µg/ml) or R-PE (11 µg/ml), either alone or in the mixed or conjugated form, in quadruplicate in 96-well plates. After 2 days, culture supernatants were assayed for IFN-{gamma} and IL-4. The experiments were repeated independently twice with similar results. Cytokines in cultures without Ag were below detectable levels. *, p < 0.002 in comparison with the no stimulant group; **, p < 0.0001 in comparison with the R-PE + CpG group..

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The main purpose of the present study was to elucidate the mechanisms underlying the synergism of covalently conjugated CpG and protein Ag. We found that CpG-tagged Ag bound to and is phagocytosed by DCs in a CpG-guided manner (Figs. 3Go, 4Go, and 7Go). The DCs then induced expression of costimulatory molecules and formation of IL-12 (Figs. 5Go, 6Go, and 8Go). Promotion of Ag uptake and DC activation by CpG enabled the CpG-protein conjugates to potentiate the differentiation and activation of IFN-{gamma}-producing T cells (Figs. 1Go, 2Go, and 9Go).

The activation of T cells by DCs is the result of sequential multistep processes, such as Ag uptake, peptide presentation, the expression of costimulatory molecules, and IL-12 secretion. The latter two processes, due to the "DC-activating" condition, were enhanced by CpG (10, 11), while the former two processes, i.e., the "Ag-processing" condition, require the copresence of Ag. It has already been stressed that the coinjection of both CpG and Ag is necessary for the manifestation of CpG activities (13, 34, 44, 45, 46, 47). We reasoned that CpG and Ag were likely to be engulfed by the same APCs, which then secreted IL-12 and presented Ag, thereby fulfilling the requirements listed above (34). This notion was supported by the subsequent experiments with the CpG-OVA conjugates. The ability of the conjugates to induce Th1 cells was 100-fold higher than a mixture of equivalent amount of CpG and Ag (35). A similar efficacy of CpG-Ag conjugate was reported in the activation of CD8+ CTL, and it was reasoned that colocalization of CpG and Ag into the same APC could be achieved in a single step (36).

The present experiments were performed to provide further support for the idea described above. Our results revealed an additional mechanism underlying the synergism of CpG and Ag in the CpG-Ag conjugate. The striking observation was a CpG-guided increase of Ag uptake in DCs (Figs. 3Go and 4Go). Although immature DCs are extremely well equipped to capture Ags (48), quantitative analyses revealed that only a minor fraction of the cells took up R-PE under the experimental conditions used (Figs. 6Go and 8Go). It was found that the majority of DCs activated by CpG, as judged by the increased expression of costimulatory molecules, did not show a high Ag uptake (Figs. 6Go and 8Go). In contrast, the CpG-conjugated R-PE bound to the majority of DCs with >100-fold higher intensity than the mixture (Figs. 3Go and 5Go). It has been demonstrated that ODN bound to the cell surface is rapidly endocytosed and moves to the endosomal compartment (49, 50, 51). Experiments with confocal microscopy showed that the R-PE fluorescence was emitted from cytoplasmic portions of CD11c+ DCs 24 h after incubation (Fig. 7Go), indicating that the CpG-R-PE conjugates were endocytosed by the DCs. Thus, one of the features unique to the CpG-labeled Ag is the promotion of Ag uptake.

Immature DCs play a sentinel role in the peripheral tissues by sampling Ag (16, 17, 18, 19). After homing to lymphoid tissues, they present the captured Ag and express high levels of MHC class II and costimulatory molecules as mature DCs (20, 21, 22, 23). Mature DCs have weak phagocytic ability, and are poor at sampling new Ag. However, the experiments in Fig. 3Go demonstrated that the CpG-R-PE conjugate stained the majority of splenic DCs, which are likely to be mature on the basis of the expression of MHC class II and costimulatory molecules (data not shown). Uptake of CpG–R-PE into mature DCs is probably guided by the CpG portion of the conjugate, and this process enabled mature DCs to serve as APCs for the activation of R-PE-specific Th1 cells (Fig. 9Go).

Cellular internalization of phosphorothioate ODNs has been extensively studied from the standpoint of antisense treatment. ODNs first bind to the cell surface through adsorptive endocytosis and fluid-phase endocytosis (49, 50). Studies on the intracellular uptake of FITC-labeled ODNs indicated that cytoplasmic accumulation started within 2–4 h after the application of ODNs in vitro (51). The endocytosed ODNs localized in the endosomal-lysosomal compartment, with little staining in the cytosol or nucleus (52). To express the effects of CpG, including activation of the transcription factors and secretion of cytokines by DCs, internalization of CpG and endosomal maturation/acidification are required (52). Despite close examinations about how ODNs are handled by the cells, little attention has been paid to the uptake and intracellular localization of CpG in the context of Ag presentation and DC activation.

CpG in the conjugate do not merely play a role of a guide leading Ags to DCs. Once the CpG is directly conjugated to Ag, the DC-activating and Ag-processing conditions are not independent. After incubation of DCs with the CpG-R-PE conjugate, high levels of IL-12 expression were observed in the DCs expressing the high levels of R-PE (Fig. 8Go), and these cells also expressed CD40 and CD86 (Figs. 5Go and 6Go). This is in sharp contrast to the cells incubated with a mixture of CpG and Ag. In the DCs treated with the mixture, no relationship was observed between R-PE staining and IL-12 expression (Fig. 6Go). The results indicate that essentially all of the DCs, which incorporated the CpG-Ag conjugate, were activated by CpG and strongly suggest that these cells would present antigenic peptide for the preferential generation of Th1 cells.

The transduction of intracytoplasmic signals after CpG activation has been recently studied (53, 54, 55); however, it remains controversial whether CpG bind to a cell surface or intracytoplasmic receptor. Although a Toll-like receptor 9 (TLR9) is reported to mediate the cellular response to CpG, the expression of TLR9 on the cell surface has not been established (54). We demonstrated that CpG-tagged macromolecular R-PE, but not the mixture of CpG and R-PE, was endocytosed by and stimulated DCs, suggesting that CpG were endocytosed through some cell surface receptors (50). It would be intriguing to know whether binding/uptake of CpG-labeled R-PE is abolished in the absence of TLR9.

Then, what would be the physiological significance of the CpG-guided Ag uptake? When inflammation is evoked by an invasion of bacteria, DNA may be spilled from damaged microbes. Given that CpG-containing DNA works as a tag attached to the degraded microbes, DNA-mediated binding to phagocytic cells would promote the clearance of DNA-tagged bacteria, as in the case of Ig- or C-mediated opsonization. More importantly, efficient sampling by DCs of DNA-tagged bacterial Ags and subsequent Ag presentation to Th cells would facilitate the link between innate and acquired immunity against the microbes and promote the expulsion of the invading microbes.

In conclusion, we found that the increased activation of Th1 cells by CpG-Ag conjugates results from the enhanced Ag uptake and the coincorporation of both Ag and CpG by the same DCs. These novel features of CpG-conjugated Ag would be applicable to therapies for diseases in which Th1-dominant responses would be preferable, such as in allergies, infectious diseases, and malignant tumors.


    Acknowledgments
 
We are grateful to Dr. Kimishige Ishizaka for helpful advice and critical review of this manuscript. We acknowledge Brent K. Bell for editing the English manuscript.


    Footnotes
 
1 This work was supported in part by a grant-in-aid for Scientific Research from The Ministry of Education, Science, Sports and Culture, Japan. Back

2 Address correspondence and reprint requests to Dr. Kunio Sano, First Department of Internal Medicine, Tohoku University School of Medicine, Sendai 980-8574, Japan. E-mail address: sano{at}int1.med.tohoku.ac.jp Back

3 Abbreviations used in this paper: ODN, oligodeoxynucleotide; SA, streptavidin; DC, dendritic cell; MFI, mean fluorescence intensity; tg, transgenic; TLR9, Toll-like receptor 9; LN, lymph node. Back

Received for publication February 28, 2001. Accepted for publication April 30, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tokunaga, T., H. Yamamoto, S. Shimada, H. Abe, T. Fukuda, Y. Fujisawa, Y. Furutani, O. Yano, T. Kataoka, T. Sudo, et al 1984. Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I. Isolation, physicochemical characterization, and antitumor activity. J. Natl. Cancer. Inst. 72:955.
  2. Yamamoto, S., E. Kuramoto, S. Shimada, T. Tokunaga. 1988. In vitro augmentation of natural killer cell activity and production of interferon-{alpha}/{beta} and -{gamma} with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer. Res. 79:866.[Medline]
  3. Yamamoto, S., T. Yamamoto, S. Shimada, E. Kuramoto, O. Yano, T. Kataoka, T. Tokunaga. 1992. DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol. Immunol. 36:983.[Medline]
  4. Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, T. Tokunaga. 1992. Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN and augment IFN-mediated natural killer activity. J. Immunol. 148:4072.[Abstract]
  5. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  6. Sato, Y., M. Roman, H. Tighe, D. Lee, M. Corr, M. D. Nguyen, G. J. Silverman, M. Lotz, D. A. Carson, E. Raz. 1996. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273:352.[Abstract]
  7. Stacey, K. J., M. J. Sweet, D. A. Hume. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116.[Abstract]
  8. Ballas, Z. K., W. L. Rasmussen, A. M. Krieg. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
  9. Chace, J. H., N. A. Hooker, K. L. Mildenstein, A. M. Krieg, J. S. Cowdery. 1997. Bacterial DNA-induced NK cell IFN-{gamma} production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
  10. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Medline]
  11. Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, J. C. Vogel. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161:3042.[Abstract/Free Full Text]
  12. Weiner, G. J., H. M. Liu, J. E. Wooldridge, C. E. Dahle, A. M. Krieg. 1997. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. USA 94:10833.[Abstract/Free Full Text]
  13. Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
  14. Hartmann, G. G. J. Weiner, A. M. Krieg. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA 96:9305.[Abstract/Free Full Text]
  15. Steinman, R. M., S. Turley, I. Mellman, K. Inaba. 2000. The induction of tolerance by dendritic cells that have captured apoptotic cells. J. Exp. Med. 191:411.[Free Full Text]
  16. Romani, N., S. Koide, M. Crowley, M. Witmer-Pack, A. M. Livingstone, C. G. Fathman, K. Inaba, R. M. Steinman. 1989. Presentation of exogenous protein antigens by dendritic cells to T cell clones: intact protein is presented best by immature, epidermal Langerhans cells. J. Exp. Med. 169:1169.[Abstract/Free Full Text]
  17. Pure, E., K. Inaba, M. T. Crowley, L. Tardelli, M. D. Witmer-Pack, G. Ruberti, G. Fathman, R. M. Steinman. 1990. Antigen processing by epidermal Langerhans cells correlates with the level of biosynthesis of major histocompatibility complex class II molecules and expression of invariant chain. J. Exp. Med. 172:1459.[Abstract/Free Full Text]
  18. Inaba, K., M. Inaba, M. Naito, R. M. Steinman. 1993. Dendritic cell progenitors phagocytose particulates, including bacillus Calmette-Guerin organisms, and sensitize mice to mycobacterial antigens in vivo. J. Exp. Med. 178:479.[Abstract/Free Full Text]
  19. Reis e Sousa, C., P. D. Stahl, J. M. Austyn. 1993. Phagocytosis of antigens by Langerhans cells in vitro. J. Exp. Med. 178:509.[Abstract/Free Full Text]
  20. De Smedt, T., B. Pajak, E. Muraille, L. Lespagnard, E. Heinen, P. De Baetselier, J. Urbain, O. Leo, M. Moser. 1996. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo. J. Exp. Med. 184:1413.[Abstract/Free Full Text]
  21. Cella, M., F. Sallusto, A. Lanzavecchia. 1997. Origin, maturation and antigen presenting function of dendritic cells. Curr. Opin. Immunol. 9:10.[Medline]
  22. Caux, C., C. Massacrier, B. Vanbervliet, B. Dubois, C. Van Kooten, I. Durand, J. Banchereau. 1994. Activation of human dendritic cells through CD40 cross-linking. J. Exp. Med. 180:1263.[Abstract/Free Full Text]
  23. Winzler, C., P. Rovere, M. Rescigno, F. Granucci, G. Penna, L. Adorini, V. S. Zimmermann, J. Davoust, P. Ricciardi-Castagnoli. 1997. Maturation stages of mouse dendritic cells in growth factor-dependent long-term cultures. J. Exp. Med. 185:317.[Abstract/Free Full Text]
  24. Henderson, R. A., S. C. Watkins, J. L. Flynn. 1997. Activation of human dendritic cells following infection with Mycobacterium tuberculosis. J. Immunol. 159:635.[Abstract]
  25. Sousa, C. R., S. Hieny, T. Scharton-Kersten, D. Jankovic, H. Charest, R. N. Germain, A. Sher. 1997. In vivo microbial stimulation induces rapid CD40 ligand-independent production of IL-12 by dendritic cells and their redistribution to T cell areas. J. Exp. Med. 186:1819.[Abstract/Free Full Text]
  26. Gorak, P. M., C. R. Engwerda, P. M. Kaye. 1998. Dendritic cells, but not macrophages, produce IL-12 immediately following Leishmania donovani infection. Eur. J. Immunol. 28:687.[Medline]
  27. Macatonia, S. E. N. A., M. Hosken, P. Litton, C. S. Vieira, J. A. Hsieh, M. Culpepper, G. Wysocka, K. M. Murphy Trinchieri, A. O’Garra. 1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J. Immunol. 154:5071.[Abstract]
  28. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747.[Abstract/Free Full Text]
  29. Zimmermann, S., O. Egeter, S. Hausmann, G. B. Lipford, M. R{varphi}cken, H. Wagner, K. Heeg. 1998. Cutting edge: CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J. Immunol. 160:3627.[Abstract/Free Full Text]
  30. Krieg, A. M., L. Love-Homan, A. Yi, J. T. Harty. 1998. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 161:2428.[Abstract/Free Full Text]
  31. Haneda, K., K. Sano, G. Tamura, T. Sato, S. Habu, K. Shirato. 1997. TGF-{beta} induced by oral tolerance ameliorates experimental tracheal eosinophilia. J. Immunol. 159:4484.[Abstract]
  32. Sano, K., K. Haneda, G. Tamura, K. Shirato. 1999. Ovalbumin (OVA) and Mycobacterium tuberculosis bacilli cooperatively polarize anti-OVA T-helper (Th) cells toward a Th1-dominant phenotype and ameliorate murine tracheal eosinophilia. Am. J. Respir. Mol. Cell Biol. 20:1260.[Abstract/Free Full Text]
  33. Haneda, K., K. Sano, G. Tamura, H. Shirota, Y. Ohkawara, T. Sato, S. Habu, K. Shirato. 1999. Transforming growth factor-{beta} secreted from CD4+ T cells ameliorates antigen-induced eosinophilic inflammation: novel high-dose tolerance in the trachea. Am. J. Respir. Cell Mol. Biol. 21:268.[Abstract/Free Full Text]
  34. Shirota, H., K. Sano, T. Kikuchi, G. Tamura, K. Shirato. 2000. Regulation of T-helper cell type 2 and airway eosinophilia by transmucosal coadministration of antigen and oligodeoxynucleotides containing CpG motifs. Am. J. Respir. Cell Mol. Biol. 22:176.[Abstract/Free Full Text]
  35. Shirota, H., K. Sano, T. Kikuchi, G. Tamura, K. Shirato. 2000. Regulation of murine airway eosinophilia and Th2 cells by antigen-conjugated CpG oligodeoxynucleotides as a novel antigen-specific immunomodulator. J. Immunol. 164:5575.[Abstract/Free Full Text]
  36. Cho, H. J., K. Takabayashi, P. M. Cheng, M. D. Nguyen, M. Corr, S. Tuck, E. Raz. 2000. Immunostimulatory DNA-based vaccines induce cytotoxic lymphocyte activity by a T-helper cell-independent mechanism. Nat. Biotechnol. 18:509.[Medline]
  37. Tighe, H., K. Takabayashi, D. Schwartz, G. V. Nest, S. Tuck, J. J. Eiden, A. Kagey-Sobotka, P. S. Creticos, L. M. Lichtenstein, H. L. Spiegelberg, E. Raz. 2000. Conjugation of immunostimulatory DNA to the short ragweed allergen Amb a 1 enhances its immunogenicity and reduces its allergenicity. J. Allergy Clin. Immunol. 106:124.[Medline]
  38. Tighe, H., K. Takabayashi, D. Schwartz, R. Marsden, L. Beck, J. Corbeil, D. D. Richman, J. J. Eiden, H. L. Spiegelberg, E. Raz. 2000. Conjugation of protein to immunostimulatory DNA results in a rapid, long-lasting and potent induction of cell-mediated and humoral immunity. Eur. J. Immunol. 30:1939.[Medline]
  39. Horner, A. A., J. H. Uden, J. M. Zubeldia, D. Broide, E. Raz. 2001. DNA-based immunotherapeutics for the treatment of allergic disease. Immunol. Rev. 179:102.[Medline]
  40. Sato, T., T. Sasahara, Y. Nakamura, T. Osaki, T. Hasegawa, T. Tadakuma, Y. Arata, Y. Kumagai, M. Katsuki, S. Habu. 1994. Naive T cells can mediate delayed-type hypersensitivity response in T cell receptor transgenic mice. Eur. J. Immunol. 24:1512.[Medline]
  41. Sano, K., I. Fujisawa, R. Abe, Y. Asano, T. Tada. 1987. MHC-restricted minimal regulatory circuit initiated by a class II-autoreactive T cell clone. J. Exp. Med. 165:1284.[Abstract/Free Full Text]
  42. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods. 223:77.[Medline]
  43. Crowley, M., K. Inaba, R. M. Steinman. 1990. Dendritic cells are the principal cells in mouse spleen bearing immunogenic fragments of foreign proteins. J. Exp. Med. 172:383.[Abstract/Free Full Text]
  44. Sun, S., H. Kishimoto, J. Sprent. 1998. DNA as an adjuvant: capacity of insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen. J. Exp. Med. 187:1145.[Abstract/Free Full Text]
  45. Roman, M. E., J. S. Martin-Orozco, M. D. Goodman, Y. Nguyen, A. Sato, R. S. Ronaghy, D. D. Kornbluth, D. A. Carson Richman, E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:829.[Medline]
  46. McCluskie, M. J., H. L. Davis. 1998. CpG DNA is a potent enhancer of systemic and mucosal immune responses against hepatitis B surface antigen with intranasal administration to mice. J. Immunol. 161:4463.[Abstract/Free Full Text]
  47. Horner, A. A., A. Ronaghy. P. M. Cheng, M. D. Nguyen, H. J. Cho, D. Broide, E. Raz. 1998. Immunostimulatory DNA is a potent mucosal adjuvant. Cell. Immunol. 190:77.[Medline]
  48. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  49. Loke, S. L., C. A. Stein, X. H. Zhang, K. Mori, M. Nakanishi, C. Subasinghe, J. S. Cohen, L. M. Neckers. 1989. Characterization of oligonucleotide transport into living cells. Proc. Natl. Acad. Sci. USA 86:3474.[Abstract/Free Full Text]
  50. Yakubov, L. A., E. A. Deeva, V. F. Zarytova, E. M. Ivanova, A. S. Ryte, L. V. Yurchenko, V. V. Vlassov. 1989. Mechanism of oligonucleotide uptake by cells: involvement of specific receptors?. Proc. Natl. Acad. Sci. USA 86:6454.[Abstract/Free Full Text]
  51. Skutella, T., J. C. Probst, U. Renner, F. Holsboer, C. Behl. 1998. Corticotropin-releasing hormone receptor (type I) antisense targeting reduces anxiety. Neuroscience 85:795.[Medline]
  52. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, H. Wagner. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17:6230.[Medline]
  53. H{delta}cker, H., R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, H. Wagner. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF) 6. J. Exp. Med. 192:595.[Abstract/Free Full Text]
  54. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  55. Chu, W. X., Z. Gong, K. Li, H. Takabayashi, Y. Ouyang, A. Chen, D. J. Lois, G. C. Chen, M. Karin Li, E. Raz. 2000. DNA-PKCs is required for activation of innate immunity by immunostimulatory DNA. Cell 103:909.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
G. Kaiser-Schulz, A. Heit, L. Quintanilla-Martinez, F. Hammerschmidt, S. Hess, L. Jennen, H. Rezaei, H. Wagner, and H. M. Schatzl
Polylactide-Coglycolide Microspheres CoEncapsulating Recombinant Tandem Prion Protein with CpG-Oligonucleotide Break Self-Tolerance to Prion Protein in Wild-Type Mice and Induce CD4 and CD8 T Cell Responses
J. Immunol., September 1, 2007; 179(5): 2797 - 2807.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Adotevi, B. Vingert, L. Freyburger, P. Shrikant, Y.-C. Lone, F. Quintin-Colonna, N. Haicheur, M. Amessou, A. Herbelin, P. Langlade-Demoyen, et al.
B Subunit of Shiga Toxin-Based Vaccines Synergize with {alpha}-Galactosylceramide to Break Tolerance against Self Antigen and Elicit Antiviral Immunity
J. Immunol., September 1, 2007; 179(5): 3371 - 3379.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Khan, M. S. Bijker, J. J. Weterings, H. J. Tanke, G. J. Adema, T. van Hall, J. W. Drijfhout, C. J. M. Melief, H. S. Overkleeft, G. A. van der Marel, et al.
Distinct Uptake Mechanisms but Similar Intracellular Processing of Two Different Toll-like Receptor Ligand-Peptide Conjugates in Dendritic Cells
J. Biol. Chem., July 20, 2007; 282(29): 21145 - 21159.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Adamsson, M. Lindblad, A. Lundqvist, D. Kelly, J. Holmgren, and A. M. Harandi
Novel immunostimulatory agent based on CpG oligodeoxynucleotide linked to the nontoxic B subunit of cholera toxin.
J. Immunol., April 15, 2006; 176(8): 4902 - 4913.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
U. Wille-Reece, B. J. Flynn, K. Lore, R. A. Koup, R. M. Kedl, J. J. Mattapallil, W. R. Weiss, M. Roederer, and R. A. Seder
HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates
PNAS, October 18, 2005; 102(42): 15190 - 15194.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. Wille-Reece, C.-y. Wu, B. J. Flynn, R. M. Kedl, and R. A. Seder
Immunization with HIV-1 Gag Protein Conjugated to a TLR7/8 Agonist Results in the Generation of HIV-1 Gag-Specific Th1 and CD8+ T Cell Responses
J. Immunol., June 15, 2005; 174(12): 7676 - 7683.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Hon, A. Oran, T. Brocker, and J. Jacob
B Lymphocytes Participate in Cross-Presentation of Antigen following Gene Gun Vaccination
J. Immunol., May 1, 2005; 174(9): 5233 - 5242.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Heit, F. Schmitz, M. O'Keeffe, C. Staib, D. H. Busch, H. Wagner, and K. M. Huster
Protective CD8 T Cell Immunity Triggered by CpG-Protein Conjugates Competes with the Efficacy of Live Vaccines
J. Immunol., April 1, 2005; 174(7): 4373 - 4380.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Visser, H. Jan de Heer, L. A. Boven, D. van Riel, M. van Meurs, M.-J. Melief, U. Zahringer, J. van Strijp, B. N. Lambrecht, E. E. Nieuwenhuis, et al.
Proinflammatory Bacterial Peptidoglycan as a Cofactor for the Development of Central Nervous System Autoimmune Disease
J. Immunol., January 15, 2005; 174(2): 808 - 816.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shirota, M. Gursel, and D. M. Klinman
Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling
J. Immunol., October 15, 2004; 173(8): 5002 - 5007.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
X. Jiao, R. Y.-H. Wang, Q. Qiu, H. J. Alter, and J. W.-K. Shih
Enhanced hepatitis C virus NS3 specific Th1 immune responses induced by co-delivery of protein antigen and CpG with cationic liposomes
J. Gen. Virol., June 1, 2004; 85(6): 1545 - 1553.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H.-J. Anders, B. Banas, and D. Schlondorff
Signaling Danger: Toll-Like Receptors and their Potential Roles in Kidney Disease
J. Am. Soc. Nephrol., April 1, 2004; 15(4): 854 - 867.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Wang, J. O. Sunyer, and L. J. Bello
Fusion to C3d Enhances the Immunogenicity of the E2 Glycoprotein of Type 2 Bovine Viral Diarrhea Virus
J. Virol., February 15, 2004; 78(4): 1616 - 1622.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Heit, K. M. Huster, F. Schmitz, M. Schiemann, D. H. Busch, and H. Wagner
CpG-DNA Aided Cross-Priming by Cross-Presenting B Cells
J. Immunol., February 1, 2004; 172(3): 1501 - 1507.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. M. L. Hertoghs, J. H. Ellis, and I. R. Catchpole
Use of locked nucleic acid oligonucleotides to add functionality to plasmid DNA
Nucleic Acids Res., October 15, 2003; 31(20): 5817 - 5830.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
H.-S. Mun, F. Aosai, K. Norose, M. Chen, L.-X. Piao, O. Takeuchi, S. Akira, H. Ishikura, and A. Yano
TLR2 as an essential molecule for protective immunity against Toxoplasma gondii infection
Int. Immunol., September 1, 2003; 15(9): 1081 - 1087.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Heit, T. Maurer, H. Hochrein, S. Bauer, K. M. Huster, D. H. Busch, and H. Wagner
Cutting Edge: Toll-Like Receptor 9 Expression Is Not Required for CpG DNA-Aided Cross-Presentation of DNA-Conjugated Antigens but Essential for Cross-Priming of CD8 T Cells
J. Immunol., March 15, 2003; 170(6): 2802 - 2805.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Sano, H. Shirota, T. Terui, T. Hattori, and G. Tamura
Oligodeoxynucleotides Without CpG Motifs Work as Adjuvant for the Induction of Th2 Differentiation in a Sequence-Independent Manner
J. Immunol., March 1, 2003; 170(5): 2367 - 2373.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shirota, K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, and G. Tamura
B Cells Capturing Antigen Conjugated with CpG Oligodeoxynucleotides Induce Th1 Cells by Elaborating IL-12
J. Immunol., July 15, 2002; 169(2): 787 - 794.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirota, H.
Right arrow Articles by Tamura, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirota, H.
Right arrow Articles by Tamura, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS