| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*
First Department of Internal Medicine and
Department of Dermatology, Tohoku University School of Medicine, Sendai, Japan; and
Laboratory of Pathophysiological Biochemistry, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
DCs are known as initiators of immune responses that present Ag in a form recognizable by T cells (15). The key steps include Ag uptake at an immature stage in the peripheral tissues and pre- sentation of antigenic peptides along with the expression of costimulatory molecules after maturation in the lymphoid tissues (16, 17, 18, 19, 20, 21, 22, 23). Two different processes, namely, Ag processing and maturation/activation, must be combined for full competence of DCs. Confrontation with microorganisms additionally endows DCs with the ability to secrete IL-12 (24, 25, 26), which skews immune responses toward the Th1-dominant phenotype (27, 28). Among microbial structures, CpG are reported to contribute to expelling the microbes by preferentially mounting Th1 responses as the result of the DC activation and IL-12 secretion (9, 10, 11, 12, 13, 29, 30). As demonstrated by microbes, substances that possess both an antigenic component and a DC activation/maturation component are likely to propel DC-mediated Th1 cell stimulation.
Counterbalancing Th2-dominated allergic inflammation is one
possible target for the control of allergy. We have previously reported
that regulatory CD4+ T cells, such as
TGF-
-producing T cells induced by oral or tracheal tolerance and Th1
cells induced upon exposure to Mycobacterium tuberculosis,
inhibited Th2-mediated airway inflammation (31, 32, 33). More
recently, we have reported that intratracheal coadministration of CpG
and allergen inhibited airway eosinophilia and hyperresponsiveness in a
synergistic manner and reasoned that the APC phagocytosing both CpG and
Ag could target the CpG effects to Ag-specific T cells
(34). This view was supported by subsequent experiments in
which covalently linked conjugates of CpG with Ag inhibited airway
eosinophilia and Ag-specific Th2 cells more efficiently than the
unconjugated mixture (35). The efficacy of CpG-Ag
conjugates was also reported in the other experimental systems
(36, 37, 38, 39).
In this study, we explored the mechanisms underlying the synergism of the covalent conjugation. We found an unexpected role of CpG as a leader of Ag uptake by DCs. Thus, CpG conjugated to Ag exhibit novel joint properties as promoters of Ag uptake and DC activators, thereby potentiating the ability of DCs to develop Th1 cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice were bred in our animal facility and were used at 7–12 wk of age. BALB/c mice transgenic (tg) for TCR specific for OVA323–339 and I-Ad were established as described previously (40).
CpG and direct conjugation to Ags
The CpG ODNs (1826) used throughout this study consisted of 20 bases containing two CpG motifs (TCCATGACGTTCCTGACGTT) (34, 35). The control ODN (1745) was identical except that the CpG motifs were rearranged (TCCATGAGCTTCCTGAGTCT). Phosphorothioate ODNs were synthesized by Nihon Gene Research Laboratories (Sendai, Japan) or Takara Shuzo (Osaka, Japan). The method for conjugating ODN to proteins was described previously (35). The CpG-OVA conjugate was prepared by Peptide Institute (Osaka, Japan). The LPS content of ODN was <6 pg of LPS per mg of DNA as measured by a Limulus HS-J Single Test (Wako Pure Chemical, Osaka, Japan). Free ODNs were removed by extensive dialysis. The molar and weight ratio of ODN:OVA in the conjugate was calculated to be 8.3:1 and 1.1:1, respectively. CpG ODN or non-CpG ODN was also conjugated to R-PE (Molecular Probes, Eugene, OR) after R-PE was maleimide activated using sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carobylate according to the manufacturer’s instructions (Pierce, Rockford, IL). The molar and weight ratio of ODN:R-PE in the CpG-R-PE conjugate was calculated to be 3.7:1 and 0.092:1, respectively. The ratio of ODN:R-PE in the non-CpG-R-PE conjugate was equal to that in the CpG-R-PE conjugate.
In vitro stimulation of naive anti-OVA T cells with CpG and OVA
Spleen cells (5 x 106) from
unimmunized anti-OVA TCR tg mice were cultured in 12-well plates
with OVA (0.1 µg/ml) or CpG (0.11 µg/ml), either alone or in the
mixed or conjugated form. After 6 days, viable lymphocytes (1 x
105) recovered by Ficoll-Paque (Pharmacia
Biotech, Uppsala, Sweden) density-gradient centrifugation were
restimulated with 2 x 105 APCs in the
presence or absence of OVA (100 µg/ml) in quadruplicate in 96-well
plates. After 2 days of culture, the culture supernatants were assayed
for IFN-
and IL-4. APCs were prepared by treating spleen cells of
unimmunized BALB/c mice with mitomycin C (50 µg/ml; Wako Pure
Chemical) for 30 min at 37°C.
In vitro restimulation of anti-OVA Th1 or Th2 cells with CpG and OVA
Spleen cells (3 x 107) from
unimmunized anti-OVA TCR tg mice were cultured in 12 ml of RPMI
1640 medium with OVA (100 µg/ml) in the presence of IL-12 (1 ng/ml;
Genzyme, Cambridge, MA) for Th1 cells or IL-4 (10 ng/ml; Genzyme) plus
anti-IL-12 mAb (0.1 µg/ml; Genzyme) for Th2 cells for 3 days. The
cells were cultured in fresh medium for another 3 days. Viable
lymphocytes were enriched for CD4+ T cells by a
panning method as described previously (32, 41). After
coculture of 1 x 105
CD4+ T cells and 2 x
105 APCs in the presence of OVA or CpG, either
alone or in the mixed or conjugated form, for 2 days in quadruplicate
in 96-well plates, the culture supernatants were assayed for IFN-
and IL-4.
Fractionation of the CpG-OVA conjugate
Crude CpG-OVA conjugate was applied to a Sephacryl S-200 HR (Amersham Pharmacia Biotech, Piscataway, NJ) column, 1.8 x 73 cm, equilibrated in PBS (pH 7.4), and eluted with the same buffer. Aliquots of the fractions from the column were subjected to SDS-PAGE. Proteins and CpG were visualized with GelCode Blue Stain Reagent (Pierce) and SYBR Green II RNA Gel Stain (BioWhittaker, Rockland, ME), respectively. For in vitro experiments, each fraction was added to the in vitro cultures to induce or stimulate Th1 cells.
Fractionation of the CpG-R-PE conjugate
Crude CpG-R-PE was applied to a DE52 (Whatman, Tewksbury, MA) minicolumn, 5 x 5 mm, equilibrated in 5 mM potassium phosphate buffer (pH 7.0). Proteins were eluted with a stepwise gradient of 0.1–1.0 M NaCl in the same buffer (pH 7.0). Aliquots of fractions from the column were subjected to SDS-PAGE, and proteins and CpG were visualized as described above. For in vitro experiments, each fraction was incubated with splenic DCs as described below.
In vitro restimulation of R-PE-primed lymph node (LN) cells with CpG and R-PE
BALB/c mice were primed s.c. with 100 µg of R-PE emulsified in
CFA in the hind footpads. After 7 days, popliteal LN cells (3 x
105/well) were cultured with CpG (1 µg/ml) or
R-PE (11 µg/ml), either alone or in the mixed or conjugated form, in
quadruplicate in 96-well plates. After 2 days, the culture supernatants
were assayed for IFN- and IL-4.
Cytokine assay
Cytokine concentrations in the culture supernatants were
determined using ELISA according to the manufacturer’s
recommendations. Paired anti-IL-4, anti-IL-5, and
anti-IFN- mAbs were purchased from PharMingen (San Diego, CA).
Tetramethylbenzidine reagent (Kirkegaard & Perry Laboratories,
Gaithersburg, MD) was used for color development, and ODs determined at
450 nm were converted to concentrations (ng/ml) according to a standard
curve. Standard recombinant mouse IL-4, IL-5, and IFN- were
purchased from Genzyme.
Enrichment for DCs from spleen
BALB/c spleen cells were cut into small fragments and incubated
with RPMI 1640 supplemented with 1 mg/ml collagenase D (Boehringer
Mannheim, Indianapolis, IN) for 30 min at 37°C. After washing, they
were layered onto 50% Percoll and centrifuged for 20 min at 3000 rpm.
The interface was recovered and used as the DC-enriched fraction for
flow cytometry analysis. The average percentage of
CD11c+ cells was 
2% in the spleen before the
enrichment, which was consistently increased to 35–40% after the
enrichment.
Preparation of DCs from bone marrow
Bone marrow-derived DCs were prepared from BALB/c mice as described elsewhere (42). Briefly, bone marrow cells (2 x 106 cells) obtained from femurs were seeded into a 100-mm petri dish (Eiken Chemical, Tokyo, Japan) in 10 ml of RPMI 1640 supplemented with 10% FCS and GM-CSF (20 ng/ml; PeproTech, London, U.K.). At day 3, another 10 ml of medium containing 20 ng/ml GM-CSF was added to the plates. At days 6 and 8, half of the culture supernatants were replaced with the fresh medium containing 20 ng/ml GM-CSF. At day 10, the adherent cells were used as DCs. The cell numbers recovered from one plate were generally 3–5 x 106 cells.
Reagents used for flow cytometry
Purified anti-CD11c mAb (N418) specific for DCs (43) was purchased from Serotec (Oxford, U.K.) and conjugated to FITC (Sigma, St. Louis, MO) in our laboratory. Biotinylated anti-CD40 and anti-CD86 mAbs were purchased from Caltag (Burlingame, CA). Allophycocyanin-conjugated streptavidin (SA), propidium iodide, and unconjugated and FITC-conjugated anti-IL-12 mAbs were purchased from Biomeda (Foster City, CA), Sigma, PharMingen, and BioSource International (Camarillo, CA), respectively.
Staining of DC-enriched spleen cells and flow cytometry
The DC-enriched splenocytes were incubated with 1 µg/ml CpG or 11 µg/ml R-PE, either alone or mixed, or varying concentrations of CpG-conjugated R-PE for 3 h and then stained with FITC-conjugated anti-CD11c mAb. The R-PE staining of the gated CD11+ cells was analyzed using a FACSCaliber (BD Biosciences, Mountain View, CA). Propidium iodide-stained dead cells were excluded from analyses.
Analyses of bone marrow-derived DCs by flow cytometry
The DC-enriched population derived from bone marrow was cultured overnight with 1 µg/ml CpG either alone, mixed, or conjugated with 11 µg/ml R-PE. After extensive washing, the cells were stained with FITC-conjugated anti-CD11c mAb along with biotinylated anti-CD40 or anti-CD86 mAb. Binding of biotinylated mAbs was detected with allophycocyanin-conjugated SA. The correlations between R-PE staining and the CD40 or CD86 expression on the viable CD11c+ DCs were analyzed. For staining of intracytoplasmic IL-12, the DC population was cultured with R-PE and/or CpG for 6 h, with 10 µg/ml brefeldin A (Wako Pure Chemical) added for the final 2 h. After staining with biotinylated anti-CD11c mAb and allophycocyanin-conjugated SA, the cells were treated with cell permeabilization solution (Immunotech, Minneapolis, MN.) and then stained with FITC-conjugated anti-IL-12 mAb. Where indicated, a 20-fold excess of free anti-IL-12 mAb was also added. They were analyzed for intracytoplasmic IL-12 by flow cytometry.
Confocal microscopy
The DC-enriched cells derived from bone marrow were cultured overnight with CpG (0.1 µg/ml) conjugated to R-PE (1.1 µg/ml) and then stained with FITC-conjugated anti-CD11c mAbs. The stained cells were examined using a confocal laser scanning microscope, MR/AG-1 (Bio-Rad, Hercules, CA). FITC and R-PE were excited with 488-nm argon and 543-nm helium-neon lasers, and emission spectra were collected with 530-nm band pass and 570-nm long pass filters, respectively. The green and red images were merged with laser sharp software (Bio-Rad).
Statistics
Data of in vitro culture experiments were expressed as the mean ± SEM. Each experiment was repeated at least twice. Student’s t test was used in the analysis of the results.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CpG ODN is known to induce potent Th1 responses
(11, 12, 13). We first examined the efficacy of the
conjugation between Ag and CpG to potentiate the antigenicity and Th1
inducibility. Spleen cells from anti-OVA TCR tg mice were cultured
in the presence of OVA or CpG, either alone or in the mixed or
conjugated form, and the induced Th cells were restimulated with OVA
for IFN- and IL-4 production (Fig. 1
A). OVA (0.1 µg/ml) alone
or CpG (0.11 µg/ml) alone failed to manifest potent Th1-inducing
ability. The mixture of OVA and CpG did not induce Th cells, whereas
the conjugate between CpG and OVA induced T cells that secreted
predominantly IFN- rather than IL-4 upon restimulation with OVA. The
control non-CpG ODN conjugated with OVA did not induce Th1
development. These results indicate that low doses of Ag and CpG, which
were below the threshold for T cell activation, acquired the ability to
induce Th1 cells when covalently conjugated together.
|
from Th cells by CpG-conjugated
Ag
We next examined the stimulation of Th1 and Th2 cells by the
CpG-OVA conjugate. Th1- and Th2-enriched fractions were prepared by
culturing anti-OVA TCR tg T cells in vitro under Th1 and Th2
skewing conditions, respectively. Th1 or Th2 population produced
IFN- or IL-4 predominantly upon stimulation with 100 µg/ml OVA
(Fig. 1
B). One microgram of OVA/ml or 1.1 µg CpG/ml alone
had no stimulatory activity on the Th1 or Th2 populations. The mixture
of OVA and CpG still failed to stimulate Th cells, whereas the
conjugate of CpG with OVA showed stimulatory antigenicity; the Th1-rich
population produced higher amounts of IFN- by 1 µg OVA/ml
conjugated to CpG than by 100-fold higher doses of OVA alone. A
striking difference was noted in the activation of the Th2 population
by the conjugate; although the levels of IL-4 production were
comparable to those by 100 µg of OVA/ml alone, IFN- production was
dramatically enhanced by the CpG-OVA conjugate. Thus, the conjugation
of Ag to CpG enhanced the antigenicity, leading to the predominant
production of IFN- from the Th cells, regardless of the conditions
in which the Th cells had developed.
Monomeric CpG-OVA as active Th1 stimulator
The crude CpG-OVA conjugates we used in the above experiments
comprised various molecular species (Fig. 2A, right lane). In
light of the nature of OVA to aggregate with each other, CpG-OVA was
separated by gel filtration chromatography and used without
concentration to minimize aggregation. When an equal volume of each
fraction was examined for the ability to stimulate Th1 cells, the most
potent stimulatory activity was observed in fraction 24 (Fig. 2C), where lower molecular species were stained intensely
both for protein (Fig. 2A) and DNA (Fig. 2B), and
corresponded to the monomeric CpG-OVA conjugate. Proteins with higher
molecular mass in fraction 24 were stained faintly for DNA and might be
a spontaneous aggregate after gel filtration. Fractions with higher
molecular masses exhibited lower stimulatory activities (Fig. 2C). Fraction 28 was stained for protein but not DNA and
lacked the stimulatory activity. The molecular size of fraction 28 was
identical to that of OVA alone (data not shown). The monomeric CpG-OVA
(fraction 24) possessed potent Th1-inducing (Fig. 2D) and
-activating (Fig. 2E) ability, indicating that the activity
of CpG-OVA can be ascribed to the monomeric CpG-conjugated OVA, but not
to the aggregates.
|
To examine the mechanisms underlying the enhanced immunogenicity
of CpG-Ag conjugates, we first examined the binding/uptake of
CpG-tagged protein to DCs, known as potent APCs to T cells. DCs were
enriched from spleen cells as described in Materials and
Methods, and the purity was always found to be 3545%, as
determined by anti-CD11c (N418) staining. We used phycobiliprotein,
R-PE, to track the fate of the CpG-conjugated protein. DC-enriched
spleen cells were incubated with R-PE, a mixture of R-PE and CpG, or
R-PE-labeled CpG for 3 h, and R-PE staining in
CD11c+ cells gated as shown in Fig. 3A was analyzed by flow
cytometry. In Fig. 3C, the FL2 autofluorescence of the
untreated DCs is shown. When DCs were incubated with R-PE alone, only
minimal proportions of the CD11c+ DCs were
positive for R-PE, with varying staining intensity (Fig. 3D). The R-PE staining was not amplified by the copresence
of unconjugated CpG and R-PE (Fig. 3E), whereas when the
same doses of R-PE and CpG were covalently conjugated, 88% of DCs were
intensely stained with R-PE (Fig. 3F). The percentage of
R-PE-positive cells and mean fluorescence intensity (MFI) of R-PE
staining correlated with the doses of the CpG-R-PE conjugate added
(Fig. 3, F–I). At CpG doses ranging from 0.01 to 1 µg/ml,
the MFI of R-PE and CpG-R-PE concentration showed a nearly linear
relationship (Fig. 3B). The staining intensity of DCs with a
mixture of R-PE and CpG (Fig. 3E) was almost equivalent to
that with 100-fold less R-PE conjugated to CpG (Fig. 3H),
suggesting that CpG conjugation improved the protein binding/uptake to
DCs by nearly 100-fold. Thus, the protein Ag is promoted to bind to DCs
in a CpG-guided manner when the protein is conjugated to, but not when
mixed with, CpG.
|
A). After separation by
SDS-PAGE, all fractions emitted R-PE fluorescence (Fig. 4B),
whereas fluorescent emission from CpG was discernible only in fractions
eluted by 0.6 or 0.8 M NaCl (Fig. 4C), indicating that
CpG-conjugated R-PE is eluted at high buffer concentrations. The
fractions that were eluted only at high, but not low, buffer
concentrations bound to DCs (Fig. 4D), indicating that
facilitated binding to DCs is a feature unique for CpG-conjugated R-PE,
but cannot be ascribed to the contaminating free or aggregated PE.
Because of these observations and the paucity of the purified
materials, CpG-R-PE before fractionation was used in the following
experiments.
|
We examined whether the binding of CpG to DCs resulted in the
increased expression of costimulatory molecules. Bone marrow
cells were cultured in the presence of GM-CSF, and the DC
fraction was obtained by gating CD11c+ cells
(Fig. 5A). The levels of CD40
expression were low in the DCs (Fig. 5B). When the bone
marrow-derived DCs were incubated with 0.1 µg of R-PE-labeled CpG,
slight increases in Ag uptake were observed, yet an induction of
CD40+ DCs was not apparent (Fig. 5C).
Increases in the doses of CpG-R-PE paralleled the increases in the
proportion of CD40+ or
R-PE+ DCs (Fig. 5D). At 1
µg/ml CpG, more than one-half of the DCs were activated and Ag
bearing (Fig. 5E). The expression of CD86 (Fig. 5, F–I) or MHC class II molecules (data not shown) was
similarly affected by the incubation with CpG–R-PE. Thus, the increase
in the Ag-laden, activated DCs was proportional to the dose of the
CpG-R-PE added.
|
, A–F). When
the DCs were incubated with R-PE overnight, the R-PE-positive DCs
comprised only minimal proportions and were confined mainly to
CD40- DCs (Fig. 6A). Incubation of
the DCs with the mixture of CpG and R-PE promoted the activation of the
majority of the DCs, whereas the accelerated activation by CpG was not
associated with the increase in the R-PE uptake (Fig. 6B).
In sharp contrast, the DCs cultured with the CpG-R-PE conjugates
exhibited a dramatic increase in the population double positive for
R-PE and CD40 (Fig. 6C); the proportion of Ag-bearing cells
in CD40+ DCs increased by >10-fold. The DCs that
bound CpG-R-PE inevitably expressed CD40 molecules. The amounts of Ag
uptake by each DC also increased; MFI of FL2 was 516 for the CpG-R-PE
conjugate in comparison to 95 for the mixture of R-PE plus CpG.
Similarly, enhanced Ag uptake correlated with the increased expression
of CD86 (Fig. 6, D–F) and class II molecules (data not
shown).
|
, G–J, the
non-CpG-R-PE was phagocytosed by immature DCs to an extent similar to
the CpG-R-PE, but failed to activate DCs to express CD40 or
CD86.
The DCs incubated with CpG-R-PE overnight were examined by confocal
microscopy, and the experiments also verified that the majority of
CD11c+ DCs emitted R-PE-derived red fluorescence
from cytoplasmic portions (Fig. 7). These
results indicate that conjugation of Ag with CpG promoted the Ag
capture.
|
We examined whether CpG-conjugated R-PE allowed the preferential
expression of IL-12 in the DCs that phagocytosed the CpG-R-PE
conjugates. After incubation of bone marrow-derived DCs with R-PE-CpG
for 6 h, they were analyzed for IL-12 expression by flow
cytometry. When the DCs were cultured with R-PE alone, no induction of
IL-12 expression was observed (Fig. 8A). The copresence of CpG
with R-PE induced the expression of IL-12 in a significant proportion
of the DCs, which was not, however, correlated with the increase in the
R-PE uptake (Fig. 8B). In contrast, with the CpG-R-PE
conjugates the IL-12-producing DCs were mainly confined to cells that
were also strongly positive for R-PE (Fig. 8C). The IL-12
staining was specific, because the inclusion of free anti-IL-12 mAb
inhibited IL-12 staining to levels comparable to that of the control
that was not stained with FITC-conjugated anti-IL-12 mAb (Fig. 8, D and E). These results indicated the parallelism
between Ag uptake and IL-12 expression in DCs when the DCs encounter
CpG-linked Ag.
|
To verify that the CpG-conjugated R-PE processed in the manner
described above actually served as an Ag, we examined IFN-
production from R-PE/CFA-primed LN cells. R-PE-primed LN cells produced
minimal amounts of IFN- in response to R-PE or CpG alone (Fig. 9). The mixture of R-PE and CpG induced a
slight but significant increase in IFN- production, while the
conjugation between R-PE and CpG further enhanced IFN- production by
6.2 times. The observed increase in antigenicity and IFN- production
by the CpG-conjugated protein Ag was consistent with the results in
Figs. 1 and 2.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, 4, and 7). The DCs then induced
expression of costimulatory molecules and formation of IL-12 (Figs. 5, 6, and 8). Promotion of Ag uptake and DC activation by CpG enabled the
CpG-protein conjugates to potentiate the differentiation and activation
of IFN--producing T cells (Figs. 1, 2, and 9). The activation of T cells by DCs is the result of sequential multistep processes, such as Ag uptake, peptide presentation, the expression of costimulatory molecules, and IL-12 secretion. The latter two processes, due to the "DC-activating" condition, were enhanced by CpG (10, 11), while the former two processes, i.e., the "Ag-processing" condition, require the copresence of Ag. It has already been stressed that the coinjection of both CpG and Ag is necessary for the manifestation of CpG activities (13, 34, 44, 45, 46, 47). We reasoned that CpG and Ag were likely to be engulfed by the same APCs, which then secreted IL-12 and presented Ag, thereby fulfilling the requirements listed above (34). This notion was supported by the subsequent experiments with the CpG-OVA conjugates. The ability of the conjugates to induce Th1 cells was 100-fold higher than a mixture of equivalent amount of CpG and Ag (35). A similar efficacy of CpG-Ag conjugate was reported in the activation of CD8+ CTL, and it was reasoned that colocalization of CpG and Ag into the same APC could be achieved in a single step (36).
The present experiments were performed to provide further support for
the idea described above. Our results revealed an additional mechanism
underlying the synergism of CpG and Ag in the CpG-Ag conjugate. The
striking observation was a CpG-guided increase of Ag uptake in DCs
(Figs. 3 and 4). Although immature DCs are extremely well equipped to
capture Ags (48), quantitative analyses revealed that only
a minor fraction of the cells took up R-PE under the experimental
conditions used (Figs. 6 and 8). It was found that the majority of DCs
activated by CpG, as judged by the increased expression of
costimulatory molecules, did not show a high Ag uptake (Figs. 6 and 8).
In contrast, the CpG-conjugated R-PE bound to the majority of DCs with
>100-fold higher intensity than the mixture (Figs. 3 and 5). It has
been demonstrated that ODN bound to the cell surface is rapidly
endocytosed and moves to the endosomal compartment
(49, 50, 51). Experiments with confocal microscopy showed that
the R-PE fluorescence was emitted from cytoplasmic portions of
CD11c+ DCs 24 h after incubation (Fig. 7),
indicating that the CpG-R-PE conjugates were endocytosed by the DCs.
Thus, one of the features unique to the CpG-labeled Ag is the promotion
of Ag uptake.
Immature DCs play a sentinel role in the peripheral tissues by sampling
Ag (16, 17, 18, 19). After homing to lymphoid tissues, they
present the captured Ag and express high levels of MHC class II and
costimulatory molecules as mature DCs (20, 21, 22, 23). Mature DCs
have weak phagocytic ability, and are poor at sampling new Ag. However,
the experiments in Fig. 3 demonstrated that the CpG-R-PE conjugate
stained the majority of splenic DCs, which are likely to be mature on
the basis of the expression of MHC class II and costimulatory molecules
(data not shown). Uptake of CpG–R-PE into mature DCs is probably
guided by the CpG portion of the conjugate, and this process enabled
mature DCs to serve as APCs for the activation of R-PE-specific Th1
cells (Fig. 9).
Cellular internalization of phosphorothioate ODNs has been extensively studied from the standpoint of antisense treatment. ODNs first bind to the cell surface through adsorptive endocytosis and fluid-phase endocytosis (49, 50). Studies on the intracellular uptake of FITC-labeled ODNs indicated that cytoplasmic accumulation started within 2–4 h after the application of ODNs in vitro (51). The endocytosed ODNs localized in the endosomal-lysosomal compartment, with little staining in the cytosol or nucleus (52). To express the effects of CpG, including activation of the transcription factors and secretion of cytokines by DCs, internalization of CpG and endosomal maturation/acidification are required (52). Despite close examinations about how ODNs are handled by the cells, little attention has been paid to the uptake and intracellular localization of CpG in the context of Ag presentation and DC activation.
CpG in the conjugate do not merely play a role of a guide leading Ags
to DCs. Once the CpG is directly conjugated to Ag, the DC-activating
and Ag-processing conditions are not independent. After incubation of
DCs with the CpG-R-PE conjugate, high levels of IL-12 expression were
observed in the DCs expressing the high levels of R-PE (Fig. 8), and
these cells also expressed CD40 and CD86 (Figs. 5 and 6). This is in
sharp contrast to the cells incubated with a mixture of CpG and Ag. In
the DCs treated with the mixture, no relationship was observed between
R-PE staining and IL-12 expression (Fig. 6). The results indicate that
essentially all of the DCs, which incorporated the CpG-Ag conjugate,
were activated by CpG and strongly suggest that these cells would
present antigenic peptide for the preferential generation of Th1
cells.
The transduction of intracytoplasmic signals after CpG activation has been recently studied (53, 54, 55); however, it remains controversial whether CpG bind to a cell surface or intracytoplasmic receptor. Although a Toll-like receptor 9 (TLR9) is reported to mediate the cellular response to CpG, the expression of TLR9 on the cell surface has not been established (54). We demonstrated that CpG-tagged macromolecular R-PE, but not the mixture of CpG and R-PE, was endocytosed by and stimulated DCs, suggesting that CpG were endocytosed through some cell surface receptors (50). It would be intriguing to know whether binding/uptake of CpG-labeled R-PE is abolished in the absence of TLR9.
Then, what would be the physiological significance of the CpG-guided Ag uptake? When inflammation is evoked by an invasion of bacteria, DNA may be spilled from damaged microbes. Given that CpG-containing DNA works as a tag attached to the degraded microbes, DNA-mediated binding to phagocytic cells would promote the clearance of DNA-tagged bacteria, as in the case of Ig- or C-mediated opsonization. More importantly, efficient sampling by DCs of DNA-tagged bacterial Ags and subsequent Ag presentation to Th cells would facilitate the link between innate and acquired immunity against the microbes and promote the expulsion of the invading microbes.
In conclusion, we found that the increased activation of Th1 cells by CpG-Ag conjugates results from the enhanced Ag uptake and the coincorporation of both Ag and CpG by the same DCs. These novel features of CpG-conjugated Ag would be applicable to therapies for diseases in which Th1-dominant responses would be preferable, such as in allergies, infectious diseases, and malignant tumors.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kunio Sano, First Department of Internal Medicine, Tohoku University School of Medicine, Sendai 980-8574, Japan. E-mail address: sano{at}int1.med.tohoku.ac.jp
3 Abbreviations used in this paper: ODN, oligodeoxynucleotide; SA, streptavidin; DC, dendritic cell; MFI, mean fluorescence intensity; tg, transgenic; TLR9, Toll-like receptor 9; LN, lymph node.
Received for publication February 28, 2001. Accepted for publication April 30, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ and - with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer. Res. 79:866.[Medline]
production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
cken, H. Wagner, K. Heeg. 1998. Cutting edge: CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J. Immunol. 160:3627. induced by oral tolerance ameliorates experimental tracheal eosinophilia. J. Immunol. 159:4484.[Abstract]
secreted from CD4+ T cells ameliorates antigen-induced eosinophilic inflammation: novel high-dose tolerance in the trachea. Am. J. Respir. Cell Mol. Biol. 21:268.
cker, H., R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, H. Wagner. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF) 6. J. Exp. Med. 192:595.This article has been cited by other articles:
|
|
 |
|
  G. Kaiser-Schulz, A. Heit, L. Quintanilla-Martinez, F. Hammerschmidt, S. Hess, L. Jennen, H. Rezaei, H. Wagner, and H. M. Schatzl Polylactide-Coglycolide Microspheres CoEncapsulating Recombinant Tandem Prion Protein with CpG-Oligonucleotide Break Self-Tolerance to Prion Protein in Wild-Type Mice and Induce CD4 and CD8 T Cell Responses J. Immunol., September 1, 2007; 179(5): 2797 - 2807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Adotevi, B. Vingert, L. Freyburger, P. Shrikant, Y.-C. Lone, F. Quintin-Colonna, N. Haicheur, M. Amessou, A. Herbelin, P. Langlade-Demoyen, et al. B Subunit of Shiga Toxin-Based Vaccines Synergize with {alpha}-Galactosylceramide to Break Tolerance against Self Antigen and Elicit Antiviral Immunity J. Immunol., September 1, 2007; 179(5): 3371 - 3379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Khan, M. S. Bijker, J. J. Weterings, H. J. Tanke, G. J. Adema, T. van Hall, J. W. Drijfhout, C. J. M. Melief, H. S. Overkleeft, G. A. van der Marel, et al. Distinct Uptake Mechanisms but Similar Intracellular Processing of Two Different Toll-like Receptor Ligand-Peptide Conjugates in Dendritic Cells J. Biol. Chem., July 20, 2007; 282(29): 21145 - 21159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Adamsson, M. Lindblad, A. Lundqvist, D. Kelly, J. Holmgren, and A. M. Harandi Novel immunostimulatory agent based on CpG oligodeoxynucleotide linked to the nontoxic B subunit of cholera toxin. J. Immunol., April 15, 2006; 176(8): 4902 - 4913. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Wille-Reece, B. J. Flynn, K. Lore, R. A. Koup, R. M. Kedl, J. J. Mattapallil, W. R. Weiss, M. Roederer, and R. A. Seder HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates PNAS, October 18, 2005; 102(42): 15190 - 15194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Wille-Reece, C.-y. Wu, B. J. Flynn, R. M. Kedl, and R. A. Seder Immunization with HIV-1 Gag Protein Conjugated to a TLR7/8 Agonist Results in the Generation of HIV-1 Gag-Specific Th1 and CD8+ T Cell Responses J. Immunol., June 15, 2005; 174(12): 7676 - 7683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hon, A. Oran, T. Brocker, and J. Jacob B Lymphocytes Participate in Cross-Presentation of Antigen following Gene Gun Vaccination J. Immunol., May 1, 2005; 174(9): 5233 - 5242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Heit, F. Schmitz, M. O'Keeffe, C. Staib, D. H. Busch, H. Wagner, and K. M. Huster Protective CD8 T Cell Immunity Triggered by CpG-Protein Conjugates Competes with the Efficacy of Live Vaccines J. Immunol., April 1, 2005; 174(7): 4373 - 4380. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Visser, H. Jan de Heer, L. A. Boven, D. van Riel, M. van Meurs, M.-J. Melief, U. Zahringer, J. van Strijp, B. N. Lambrecht, E. E. Nieuwenhuis, et al. Proinflammatory Bacterial Peptidoglycan as a Cofactor for the Development of Central Nervous System Autoimmune Disease J. Immunol., January 15, 2005; 174(2): 808 - 816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, M. Gursel, and D. M. Klinman Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling J. Immunol., October 15, 2004; 173(8): 5002 - 5007. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Jiao, R. Y.-H. Wang, Q. Qiu, H. J. Alter, and J. W.-K. Shih Enhanced hepatitis C virus NS3 specific Th1 immune responses induced by co-delivery of protein antigen and CpG with cationic liposomes J. Gen. Virol., June 1, 2004; 85(6): 1545 - 1553. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-J. Anders, B. Banas, and D. Schlondorff Signaling Danger: Toll-Like Receptors and their Potential Roles in Kidney Disease J. Am. Soc. Nephrol., April 1, 2004; 15(4): 854 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wang, J. O. Sunyer, and L. J. Bello Fusion to C3d Enhances the Immunogenicity of the E2 Glycoprotein of Type 2 Bovine Viral Diarrhea Virus J. Virol., February 15, 2004; 78(4): 1616 - 1622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Heit, K. M. Huster, F. Schmitz, M. Schiemann, D. H. Busch, and H. Wagner CpG-DNA Aided Cross-Priming by Cross-Presenting B Cells J. Immunol., February 1, 2004; 172(3): 1501 - 1507. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. L. Hertoghs, J. H. Ellis, and I. R. Catchpole Use of locked nucleic acid oligonucleotides to add functionality to plasmid DNA Nucleic Acids Res., October 15, 2003; 31(20): 5817 - 5830. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-S. Mun, F. Aosai, K. Norose, M. Chen, L.-X. Piao, O. Takeuchi, S. Akira, H. Ishikura, and A. Yano TLR2 as an essential molecule for protective immunity against Toxoplasma gondii infection Int. Immunol., September 1, 2003; 15(9): 1081 - 1087. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Heit, T. Maurer, H. Hochrein, S. Bauer, K. M. Huster, D. H. Busch, and H. Wagner Cutting Edge: Toll-Like Receptor 9 Expression Is Not Required for CpG DNA-Aided Cross-Presentation of DNA-Conjugated Antigens but Essential for Cross-Priming of CD8 T Cells J. Immunol., March 15, 2003; 170(6): 2802 - 2805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sano, H. Shirota, T. Terui, T. Hattori, and G. Tamura Oligodeoxynucleotides Without CpG Motifs Work as Adjuvant for the Induction of Th2 Differentiation in a Sequence-Independent Manner J. Immunol., March 1, 2003; 170(5): 2367 - 2373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, and G. Tamura B Cells Capturing Antigen Conjugated with CpG Oligodeoxynucleotides Induce Th1 Cells by Elaborating IL-12 J. Immunol., July 15, 2002; 169(2): 787 - 794. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
