| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B and Induces Proinflammatory Cytokine and Chemokine Production Via a C-Terminal Signaling Determinant
Laboratory of Host Defenses, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B. This
was associated with constitutive induction of the proinflammatory
NF-B-dependent cytokines IL-1
, IL-6, and TNF-
, and chemokines
monocyte chemoattractant protein-1 and IL-8, as well as the
AP-1-dependent basic fibroblast growth factor. In addition, IL-2 and
IL-4 production was induced in transfected Jurkat T cells. Truncation
of the final five amino acids in the cytoplasmic tail of KSHV-GPCR
caused complete loss of its transforming and NF-B-inducing
activities, without affecting receptor expression or ligand binding.
These data suggest that KS results in part from KSHV-GPCR induction of
proinflammatory cytokine and growth factor gene expression, mediated by
a signaling determinant within the last five amino acids of the C
terminus, a domain that is also critical for direct cell
transformation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Unlike cancer, KS does not appear to be due to clonal expansion of a
transformed cell. Instead, it appears to be a hyperplastic disorder
caused in part by local production of inflammatory cytokines such as
IL-1, and growth factors such as basic fibroblast growth factor (bFGF)
(1, 2). Based on strong epidemiologic and histopathologic
associations, the primary cause of KS is thought to be infection with
human herpesvirus 8. This virus was originally identified in KS lesions
from AIDS patients (3) and is therefore also commonly
referred to as KS-associated herpesvirus (KSHV). KSHV is a member of
the 
Herpesviridae, which include EBV Herpesvirus
saimiri (HVS), and herpesvirus 68. These viruses naturally
infect humans, nonhuman primates, and mice, respectively. KSHV has also
been associated epidemiologically in AIDS patients with B cell primary
effusion lymphoma (PEL) and multicentric Castleman’s disease
(4). The KSHV genome has been localized to spindle cells
of KS, but only a small subpopulation of these cells actually expresses
viral transcripts (5).
How KSHV induces KS is not known; however, the viral genome sequence
has provided important clues that together strengthen the prevailing
cytokine/growth factor theory of pathogenesis. In particular, KSHV
encodes functional homologs of cell cycle control proteins and
immunoregulatory cytokines (reviewed in Ref. 6). The
latter include an IL-6 homolog, three CC chemokine homologs, two of
which have been shown to have angiogenic activity, and an unusual
constitutively active chemokine receptor named KSHV G protein-coupled
receptor (GPCR), which has both angiogenic and oncogenic activity
(7, 8). KSHV-GPCR is the product of open reading frame 74,
which is conserved in HVS (9, 10) and herpesvirus 68
(11), but not in EBV, and has highest homology with human
CXC chemokine receptor (CXCR) 2 (7, 12). Both KSHV-GPCR
and the HVS receptor, which is named ECRF3, bind the CXCR2 ligands
IL-8, growth-related oncogene- (GRO-), and neutrophil-activating
peptide-2 (7, 9). However, KSHV-GPCR also binds additional
CXC chemokines and multiple CC chemokines, giving it the broadest
chemokine specificity of any known chemokine receptor (7).
KSHV-GPCR ligands are classified as agonists (e.g., GRO-) or inverse
agonists (e.g., IFN--induced protein-10 (IP-10)) depending on
whether they increase or decrease the constitutive activity of the
receptor (13).
KSHV-GPCR-transfected NIH 3T3 cells form highly vascularized tumors when injected into nude mice, suggesting that the receptor is a viral oncogene and a key determinant of KS (7, 8). Consistent with this, mice bearing a KSHV-GPCR transgene under the control of the CD2 promoter develop multicentric, angioproliferative lesions histologically similar to KS (14). However, in this model an indirect mechanism of tumorigenesis rather than direct cell transformation is more likely because KSHV-GPCR-positive cells are rare in KS-like lesions. Similarly, spindle cells in primary KS tumors positive for KSHV-GPCR transcripts are also uncommon and coexpress lytic transcripts (5). KSHV-GPCR is also expressed as an early lytic gene in the latently infected PEL cell line BCBL-1 (5). Together these observations have been used to argue against a direct tumorigenic role of KSHV-GPCR in KS.
Constitutive signaling by KSHV-GPCR in NIH 3T3 cells has been shown previously to induce expression of vascular endothelial growth factor (VEGF) and to activate a protein kinase C-responsive promoter containing an AP-1-binding motif to drive reporter gene expression (7, 8). VEGF and its receptors are expressed in primary KS tumors (15). This suggested that KSHV-GPCR could induce KS by regulating expression of AP-1-dependent growth factors that could act in an autocrine or paracrine manner. However, VEGF cannot by itself account for the complex cellular composition of this tumor. Here we examine in a model system whether KSHV-GPCR can directly activate immunoregulatory transcription factors and induce production of proinflammatory cytokines and chemokines and angiogenic growth factors.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
KSHV-GPCR DNA was generated by PCR from BCBL-1 lymphoma cell
genomic DNA (obtained from Jeffrey Cohen, Laboratory of Clinical
Investigation/National Institute of Allergy and Infectious
Diseases/National Institutes of Health, Bethesda, MD) using the sense
oligo 5'-GCGCATATAAGCTTGCCACCATGGCGGCCGAGGATTTCCTAACCATC and the
anti-sense oligo
5'-CGCGATATGTCGACCTCGAGTCACGAGCTACGTGGTGGCGCCGGACATGAAAGA. The
resulting product was cloned between the HindIII and
XhoI sites of the plasmid pcDNA3.1/Hygro (Invitrogen, San
Diego, CA) to create the plasmid pcKSHV-GPCR. enhanced green
fluorescent protein (EGFP) fusion constructs were created using
the pEGFP-N1 vector (Clontech Laboratories, Palo Alto, CA) with the
sense oligo 5'-CGCGATATGTCGACCTCGAGCCACCATGGCGGCCGAGGATTTCCTAACCATC
and the anti-sense oligo
5'-GCGCATATAAGCTTCGTGGTGGCGCCGGACATGAAAGACTG for
pKSHV-GPCR-EGFP and the anti-sense oligo
5'-GCGCATATAAGCTTCATGAAAGACTGCCTGAGGCTTTGGAA
for pKSHV-GPCR
5-EGFP. The mutant construct pKSHV-GPCR-V142D-EGFP
contains a point mutation leading to the replacement of
Val142 by Asp. This construct was generated using
the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA)
with the primer set
5'-TGTGTGCGTCAGTCTAGA(T/C)AGGTACCTCCTGGTGGC
(sense) and 5'-GCCACCAGGAGGTACCT(A/G)TCTAGACTGACGCACACA
(anti-sense). EGFP-tagged expression plasmids for CXCR2 and CCR2 were
created by PCR from untagged templates using the primer pairs
5'-CGCGATATGTCGACCTCGAGGCCACCATGGAAGATTTTAACATGGAGAGTGAC (sense)
and 5'-GCGCATATAAGCTTGAGAGTAGTGGAAGTGTGCCCTGAAGA (anti-sense)
for pCXCR2-EGFP, and
5'-CGCGATATGTCGACCTCGAGGCCACCATGCTGTCCACATCTCGTTCTCGGTTT
(sense) and 5'-GCGCATATAAGCTTTAAACCAGCCGAGACTTCCTGCTCCCC
(anti-sense) for pCCR2-EGFP. All cDNAs generated for fusion to EGFP
lacked a STOP codon, and were cloned between XhoI and
HindIII sites, upstream of the EGFP open reading frame of
pEGFP-N1. All DNA constructs were sequenced in both directions using an
ABI 377 automated sequencer and the ABI Prism Dye Terminator cycle
sequencing system (Applied Biosytems, Foster City, CA) following
the manufacturer’s recommended procedure. Sequences were analyzed with
Sequencher 3.1.1 software (Gene Codes, Ann Arbor, MI). To test whether
EGFP fusion to truncated KSHV-GPCR constructs induced artifactual
phenotypes, control experiments were conducted with truncated
constructs lacking EGFP.
Cell culture and transfections
Human embryonic kidney (HEK) 293 cells, NIH 3T3 mouse embryonic fibroblasts, and COS-1 monkey kidney cells were grown in DMEM containing 10% FBS and transfected with 0.5 µg DNA/50,000 cells using Lipofectamine (Life Technologies, Gaithersburg, MD), according to the manufacturer’s protocol, except where noted. HEK 293 and NIH 3T3 cell lines were selected with 1 mg/ml G418. COS-1 cells were analyzed only after transient transfection; NIH 3T3 cells were analyzed only after stable transfection. The human monocytic cell line THP-1 as well as Jurkat T cells were cultured in RPMI 1640, supplemented with 10% FBS, 4.5 g/L glucose, 10 mM HEPES, and 1 mM sodium pyruvate. THP-1 and Jurkat cells were transiently transfected using Effectene transfection reagent (Qiagen, Valencia, CA) plus 0.6 µg DNA/106 cells, following the manufacturer’s guidelines.
Cell proliferation assay
Stably transfected NIH 3T3 cells were seeded at a density of
3000 cells/ml of top agar (0.35% melted soft agar (BD Biosciences, San
Jose, CA) in DMEM supplemented with 10% FBS) at 40°C. Top agar (1.5
ml) was then added to each well of a six-well plate prepared with 1.5
ml of bottom agar (0.5% soft agar in DMEM plus 10% FBS). Plates were
cultured at 37°C in 10% CO2 and 100%
humidity, and 
0.2 ml fresh medium (DMEM plus 10% FBS) was layered
over the top of each well every 3 days. After 2 wk of culture, colonies
were counted and photographed using an inverse microscope at x40
magnification.
Luciferase assays
HEK 293 or COS-1 cells were seeded in 24-well plates at a
density of 50,000 cells/well 1 day before transfection. Equal amounts
of luciferase reporter plasmid pNF-B-Luc or pAP1-Luc (PathDetect
cis-Reporting System; Stratagene) plus positive control
(pFC-MEKK) or receptor test plasmid DNA (total = 0.5 µg
DNA/50,000 cells) were transfected as described above. THP-1 and Jurkat
cells were transfected in 12-well plates at densities of 1 x
106 (THP-1) or 0.5 x
106 (Jurkat) cells/well with pNF-B-Luc
reporter plasmid plus receptor or control plasmid DNA (total = 0.6
µg DNA/106 cells). Forty-eight hours after
transfection, cells were lysed and assayed for luciferase activity
using reagents supplied in the Luciferase Assay System (Promega,
Madison, WI). Reporter systems to measure specifically the
bioactivities of both NF-B and AP-1 have been validated previously
(16, 17, 18, 19, 20).
Confocal microscopy
HEK 293 and COS-1 cells were grown and transfected in two-well Lab-Tek Chamber Slides (Nalge Nunc, Naperville, IL). Transfections were performed as described above. Forty-eight hours after transfection, the cells were fixed using 3.7% formaldehyde in PBS, and mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, CA). Images were collected on a Leica TCS-NT/SP confocal microscope (Leica Microsystems, Exton, PA) using a x63 oil immersion objective. Fluorescence of EGFP was excited using an argon laser at 488 nm. Images were processed using Leica TCS-NT/SP software (version 1.6.551).
Radioligand binding experiments
Cells (1 x 106 per data point) were
incubated in triplicate with 0.2 nM 125I-labeled
GRO- (sp. act. 2200 Ci/mmol; NEN Life Science Products, Boston, MA)
with or without unlabeled human IP-10 in binding buffer (HBSS, 1% BSA,
0.1% sodium azide) in a total volume of 100 µl. After incubation for
1 h at room temperature, cells were pelleted and washed once with
binding buffer adjusted to 0.5 M NaCl. Cell-associated radioactivity
was determined using a Cobra II Auto gamma counter (Packard, Downers
Grove, IL).
Cytokine, chemokine, and growth factor assays
THP-1, Jurkat, or HEK 293 cells were seeded at densities of 1 x 106 (THP-1), 0.5 x 106 (Jurkat), or 1 x 105 (HEK 293) cells per well in 12-well plates, respectively, with 1 ml of the respective medium. Transfections were performed as described above. Forty-eight hours after transfection, supernatants were collected and assayed for the respective cytokine, chemokine, or growth factor using Quantikine Immunoassay systems (R&D Systems, Minneapolis, MN).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To test whether KSHV-GPCR could induce tumorigenesis via
proinflammatory gene expression, we created the KSHV-GPCR-encoding
expression plasmid pcKSHV-GPCR and measured its ability to activate the
immunoregulatory transcription factors NF-B and AP-1, which are
known to regulate this class of genes. First, we established that the
plasmid encoded active receptor by confirming that NIH 3T3 cells stably
transfected with the plasmid, but not with vector alone, formed large,
multicellular foci when cultured in soft agar, as reported previously
(Fig. 1
A). Quantitatively,
KSHV-GPCR-expressing cells formed 150–200 colonies with diameters
>200 µm/4500 seeded cells after 3 wk of culture, whereas control
cells did not proliferate under equal conditions.
|
B (21, 22). Moreover, it does
not express CXCR2 and normally does not respond to known ligands for
KSHV-GPCR. When pcKSHV-GPCR was transiently cotransfected with
luciferase reporter genes for NF-B and AP-1 into COS-1 cells, high
luciferase activity was observed for both reporter plasmids in the
absence of added chemokine (Fig. 1
, B and C). The
activity was specific, because there was little to no increase in
luciferase activity when cells were cotransfected with reporter
plasmids plus the parental vector pcDNA3, and was dependent on the
amount of pcKSHV-GPCR plasmid DNA transfected, reaching saturation at
3 µg DNA/100,000 cells (Fig. 1D). Transfection of
higher amounts of pcKSHV-GPCR led to lower activity, possibly due to
cell toxicity (data not shown). These results are consistent with
activation of NF-B and AP-1 in this system due to constitutive
signaling by KSHV-GPCR.
To verify that KSHV-GPCR was actually expressed in COS-1 cells, we
fluorescently labeled the receptor with EGFP by creating the hybrid
construct pKSHV-GPCR-EGFP, in which EGFP coding sequence is placed in
frame at the 3' end of the KSHV-GPCR open reading frame. COS-1 cells
transiently transfected with this plasmid exhibited fluorescence in a
plasma membrane distribution identical with the pattern observed with
the most closely related mammalian receptor, CXCR2, which was tested as
an EGFP fusion protein constructed the same way. In contrast, cells
transiently transfected with the control EGFP-encoding plasmid pEGFP-N
exhibited cytoplasmic distribution of the protein. A subcellular
distribution identical with COS-1 cells was observed for these three
proteins when the corresponding plasmids were transiently transfected
into HEK 293 cells (Fig. 2A).
|
B), with similar quantities of large foci as observed
with cells expressing the untagged receptor. Also, EGFP-fused KSHV-GPCR
induced high luciferase activity in COS-1 cells cotransfected with
either the NF-B or AP-1 reporter plasmids (Fig. 2, C and
D). Because an increase in reporter activity was observed
with both KSHV-GPCR and KSHV-GPCR-EGFP constructs, these findings
suggest that EGFP fusion at the C terminus does not affect KSHV-GPCR
function. The specificity of the activity for KSHV-GPCR was further
demonstrated in studies of COS-1 and HEK 293 cells transiently
cotransfected with the NF-B reporter plasmid plus plasmids encoding
CCR2 or CXCR2 similarly modified by EGFP fusion at the C terminus,
which were transfected with equal efficiency as pKSHV-GPCR-EGFP but did
not induce reporter activity (Fig. 2E). Addition of the CXC
chemokine GRO-, a known agonist of KSHV-GPCR (23, 24),
increased the NF-B reporter gene activity in COS-1 cells transiently
transfected with pcKSHV-GPCR above constitutively induced levels in a
dose-dependent manner (Fig. 3).
|
THP-1 cells transiently cotransfected with pcKSHV-GPCR and NF-B
reporter plasmid exhibited increased luciferase activity compared with
cells cotransfected with reporter plasmid plus control vector pcDNA3
(Fig. 4A). As another
immunocompetent cell type, Jurkat T cells showed enhanced NF-B
activity when transiently transfected with pKSHV-GPCR-EGFP (Fig. 4B). Transfection efficiencies were similar under all
conditions tested as assessed by activation of transfected cells with
LPS, which is known to activate NF-B.
|
, IL-6, and
TNF-, all of which contain NF-B binding sites in their promoters
(27). IL-1 and IL-6 were not detectable in supernatants
of control plasmid-transfected THP-1 cells but were both induced in
cells transiently transfected with pcKSHV-GPCR (Fig. 5A). TNF was detectable at
low levels in supernatants of control cells; however, the amount was
markedly increased in pcKSHV-GPCR-transfected cells (Fig. 5A).
|
, TNF-, and IL-6, baseline production of these chemokines was
very high and did not increase significantly in cells transiently
transfected with pcKSHV-GPCR (data not shown). Also, the transfection
efficiency in THP-1 cells was relatively low, so that any effect may
have been masked; therefore, we switched to HEK 293 cells, which
normally allow high transfection efficiency and at baseline produce
levels of IL-8 and MCP-1 that are at the threshold of detection.
Moreover, HEK 293 cells have been reported to express cytokines,
chemokines, and growth factors upon stimulation with inflammatory
cytokines (28). As shown in Fig. 5B, transient
transfection of pKSHV-GPCR-EGFP in HEK 293 cells induced a 15- and
13-fold increase in MCP-1 and IL-8 production, respectively. HEK 293
cells transiently transfected with pKSHV-GPCR-EGFP also secreted higher
levels of the angiogenic growth factor bFGF into the supernatant than
cells transfected with the control vector pCXCR2-EGFP (Fig. 5B).
To test for the induction of T cell cytokines, supernatants of
transiently transfected Jurkat cells were assayed for IL-2 and IL-4,
both of which were released at elevated levels from cells transfected
with pKSHV-GPCR-EGFP compared with EGFP alone (Fig. 5C).
Together these results support the conclusion that constitutive
signaling by KSHV-GPCR can activate immunoregulatory transcription
factors, and induce production of proinflammatory cytokines,
chemokines, and growth factors.
The C terminus of KSHV-GPCR is critical for its constitutive activity
Studies of human chemokine receptors have identified
several domains important for cell signaling, including the third
intracellular loop, the C-terminal cytoplasmic domain, and the DRY
motif (aspartic acid-arginine-tyrosine) located in the second
intracellular loop (29, 30, 31). The DRY motif is highly
conserved among not just chemokine receptors but also other GPCRs
(32). However, in KSHV-GPCR aa 142, which corresponds to
the position of aspartic acid in this motif, is valine, a major
structural difference. To test whether this difference can account for
the ability of the receptor to constitutively activate transcription
factors and induce cytokine production, we created
pKSHV-GPCR-V142D-EGFP, which has valine at position 142 changed to
aspartic acid by site-directed mutagenesis (Fig. 6A). We also tested the role
of the C terminus in constitutive signaling by creating a series of
C-terminal truncation mutants, removing 5, 8, 12, and 24 aa from the
cytoplasmic tail. The truncated receptors were then fused to EGFP.
These mutants are named pKSHV-GPCR#-EGFP, where # indicates the
number of amino acids removed (Fig. 6A). Because the longest
of these mutants, pKSHV-GPCR5-EGFP, exhibited loss of function,
experiments with the shorter mutants will not be described
here.
|
5-EGFP and
pKSHV-GPCR-V142D-EGFP were expressed preferentially on the
plasma membrane and at similar levels (Fig. 6B). The ligand
binding function of these mutants was intact, indicating that EGFP
fusion did not prevent exposure of the receptor to the
extracellular environment. Thus, HEK 293 cells stably transfected
with pKSHV-GPCR-EGFP, pKSHV-GPCR5-EGFP, or
pKSHV-GPCR-V142D-EGFP all exhibited high levels of total
125I-GRO- binding compared with untransfected
HEK 293 cells. Total binding was similar for all three plasmids (Fig. 6C). Binding of IP-10, another KSHV-GPCR ligand, to the
mutants was intact as revealed by competition for the
125I-GRO--labeled site. As a control, HEK 293
cells stably transfected with the CXCR2-encoding plasmid pCXCR2-EGFP
could bind 125I-GRO- but, as expected, binding
was unaffected by the presence of IP-10.
In functional assays, HEK 293 cells transiently transfected with
pKSHV-GPCR-EGFP or pKSHV-GPCR-V142D-EGFP had equivalent levels of
NF-B and AP-1 reporter gene activity, whereas cells transfected with
pKSHV-GPCR5-EGFP exhibited only background activity (Fig. 6, D and E). Loss of signaling by
pKSHV-GPCR5-EGFP was further manifested by the lack of
surface-independent growth in soft agar of stably transfected NIH 3T3
cells (Fig. 7A), and by marked
reduction of IL-8 (Fig. 7C) and MCP-1 (Fig. 7D)
chemokine production from transiently transfected HEK 293 cells
relative to control cells transiently transfected with pKSHV-GPCR-EGFP.
It is important to note that IL-8 and MCP-1 induction, unlike NF-B
activation, was not totally abolished by the truncation. Moreover, VEGF
production was only 20% lower in cells expressing the truncated
mutant compared with cells expressing full-length receptor (Fig. 7B), suggesting that signaling pathways independent of
NF-B are involved in activation of these genes. In addition, the
effects of the KSHV-GPCR agonist GRO- and the inverse agonist IP-10
on cytokine release were analyzed. GRO- induced small but
consistent increases in protein release (p 
0.06), whereas addition of IP-10 resulted in reduced protein amounts in
cell supernatants (p 0.005) (Fig. 7, B–D).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and AP-1, and induce expression of endogenous NF-B-
and AP-1-dependent cytokines (IL-1, TNF-, IL-6), chemokines (IL-8
and MCP-1), and growth factors (bFGF), all of which are known to be
expressed in KS. Moreover, it induces release of the T lymphokines IL-2
and IL-4. Our results in human cell lines significantly extend previous
reports that KSHV-GPCR could induce VEGF production in mouse NIH 3T3
cells (8) and activate a reporter gene regulated by a
PKC-responsive promoter containing an AP-1-binding motif in the monkey
kidney cell line COS-1 (7). Together the data provide
strong evidence that this receptor is capable of broad but selective
induction of this important class of signaling molecules. Our findings suggest a specific molecular mechanism for KS tumorigenesis in which KSHV-infected cells expressing KSHV-GPCR produce cytokines and growth factors that act in an autocrine and/or paracrine manner to recruit leukocytes, and stimulate spindle cell proliferation and angiogenesis. This is consistent with the widely held view that KS is an infectious disease caused by KSHV in which hyperplastic rather than autonomous cell growth results from paracrine and autocrine action of locally produced cytokines and growth factors (1, 2). It is also consistent with the fact that KS-like lesions develop in KSHV-GPCR-transgenic mice, implicating this receptor as a key viral determinant of KS (14). Finally, it is consistent with the paucity of receptor-positive cells in these mouse tumors and in primary human KS tissue (5, 14).
In addition to the cytokine-inducing activity we describe, KSHV-GPCR is also oncogenic when expressed in NIH 3T3 cells; however, the biologic significance of this is questionable given the weak evidence for clonality in KS and the rarity of positive cells in tumors from KSHV-GPCR-transgenic mice. Moreover, KSHV-GPCR is expressed during the lytic phase of infection of KSHV-infected PEL cell lines in vitro, and is coexpressed with early lytic transcripts in spindle cells in vivo (5).
In addition to direct induction of cytokines and growth factors by
KSHV-GPCR, indirect induction may also occur because many of the
cytokines shown to be directly induced have profound autocrine and
paracrine effects on proinflammatory gene expression. For example, bFGF
may be induced both directly by KSHV-GPCR, as we have shown, and
indirectly by induction of AP-1 binding to the bFGF promoter in
response to IL-1 or TNF- (33, 34), which are
themselves induced directly by KSHV-GPCR.
KSHV-GPCR did not induce expression of all cytokines that we tested. In
particular, we found no evidence for induction of the TH1 cytokines
IFN- and IL-12 or the TH2 cytokine IL-10 in KSHV-GPCR-expressing
THP-1 and Jurkat cells (data not shown). Although KS tumors are
infiltrated by diverse types of inflammatory cells including plasma
cells, T lymphocytes, and monocytes/macrophages (35), to
date there are no reports identifying TH1- or TH2-polarized T
cells.
Conversely, we did not test all proinflammatory molecules known to be
expressed on KS cells. For example, the adhesion molecule ICAM-1 is
also induced by NF-B (36), expressed on KS cells
(37), and could also be regulated by KSHV-GPCR.
Comprehensive profiling of gene expression in KSHV-GPCR-transfected
cell lines may provide important new clues into the mechanism of KS
pathogenesis.
Although our results suggest that KSHV-GPCR induces cytokine and growth
factor production in part by activating NF-B and AP-1, how the
receptor activates these transcription factors is unknown. To date G
proteins activated by KSHV-GPCR have not been identified; however, the
receptor has been shown to activate the mitogen-activated protein
kinase pathway, which is known to be upstream of NF-B activation
(8, 38). Additional work will be needed to establish the
exact signaling pathway from KSHV-GPCR to transcription factor
activation. In vivo the constitutive activity of this receptor is
likely to be modulated by endogenous chemokine ligands acting as
agonists or inverse agonists. In this regard we found, consistent with
previous reports of KSHV-GPCR pharmacology, that GRO- acted as an
agonist and IP-10 as an inverse agonist at the receptor in cytokine
induction assays.
We have also demonstrated that the structural basis of KSHV-GPCR
cytokine induction and transforming activity includes determinants
localized to the final five amino acids of the C terminus but not to
the anomalous valine at aa 142. Both of these results are surprising
for the following reasons. First, receptor activity was insensitive to
replacement of the anomalous valine at position 142 by aspartic acid,
the amino acid found at this position in other chemokine receptors. Yet
the reciprocal substitution D
V has been reported to cause
constitutive activation of CXCR2, the presumed cellular ancestor of
KSHV-GPCR and normally a ligand-regulated receptor (39).
This implies that the context of aa 142 is critical for determining its
functionality. Second, although the C-terminal domain has been shown in
studies of other chemokine receptors, including CXCR2, to contain
signaling determinants, they typically map to the juxtamembranous part
of this domain and require much larger truncations to demonstrate than
was needed for KSHV-GPCR. The final five amino acids of the cytoplasmic
tail of KSHV-GPCR, SGATT, include one serine and two threonines,
which are candidate phosphorylation sites. Such sites are
characteristic of the cytoplasmic domains of human chemokine receptors
and other GPCRs (29, 30), and are important for receptor
desensitization processes controlled by specific GPCR kinases (GRKs).
Constitutive accumulation of inositol trisphosphate in response to
KSHV-GPCR signaling has been shown to be inhibited by some of the GRK
family, most effectively by GRK 5 and 6, but phosphorylation of the
receptor by these enzymes has not been documented (40).
Because the final five amino acid domain is a determinant of
constitutive signaling, it will be important in future studies to test
the effect of GRK overexpression and inverse agonist action on
phosphorylation of this domain.
It is important to note that the C-terminal truncated mutant
KSHV-GPCR5-EGFP was not completely inactive because it was able to
induce chemokine and growth factor production, albeit at lower levels.
VEGF production in particular was only weakly affected by this
truncation. This suggests that other domains can activate
NF-B-independent signaling pathways and that chemokine and VEGF
induction is not totally dependent on NF-B in these systems.
Rosenkilde et al. have identified two other determinants of constitutive signaling in KSHV-GPCR at positions 91 and 94 in the second transmembrane domain. Nevertheless, these mutants were still able to respond to agonists (41). Other receptor domains were identified that selectively regulated responsiveness to agonists or ligand binding without affecting constitutive signaling (41, 42).
In conclusion, our study has established that KSHV-GPCR is capable of inducing activation of immunoregulatory transcription factors and production of proinflammatory cytokines and chemokines as well as angiogenic growth factors. This activity suggests a molecular mechanism linking the infectious and growth factor theories of KS pathogenesis.
|
Footnotes |
|---|
2 Abbreviations used in this paper: KS, Kaposi’s sarcoma; KSHV, KS-associated herpesvirus; bFGF, basic fibroblast growth factor; GPCR, G protein-coupled receptor; GRO-, growth-related oncogene-; IP-10, IFN--induced protein-10; VEGF, vascular endothelial growth factor; MCP-1, monocyte chemoattractant protein-1; HVS, Herpesvirus saimiri; PEL, primary effusion lymphoma; CXCR2, CXC chemokine receptor 2; EGFP, enhanced green fluorescent protein; HEK, human embryonic kidney; GRK, GPCR kinase.
Received for publication November 1, 2000. Accepted for publication April 25, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
herpesvirus 68. J. Virol. 71:5894.[Abstract]
-inducible protein 10 (IP-10) inhibits constitutive signaling of Kaposi’s sarcoma-associated herpesvirus G protein-coupled receptor. J. Exp. Med. 188:405.B- ubiquitination. Science 289:1560.(1)-adrenergic receptor subtypes. J. Neurochem. 74:2392.[Medline]
B activity and enhancement of apoptosis by the neuropeptide calcitonin gene-related peptide. J. Biol. Chem. 275:15114.B. DNA Cell Biol. 19:113.[Medline]
B. Annu. Rev. Cell Biol. 10:405.
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
. Cancer Res. 60:4873.This article has been cited by other articles:
|
|
 |
|
  J.-P. Couty, M. Lupu-Meiri, Y. Oron, and M. C. Gershengorn Kaposi's Sarcoma-Associated Herpesvirus-G Protein-Coupled Receptor-Expressing Endothelial Cells Exhibit Reduced Migration and Stimulated Chemotaxis by Chemokine Inverse Agonists J. Pharmacol. Exp. Ther., June 1, 2009; 329(3): 1142 - 1147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. T. Krug, C. M. Collins, L. M. Gargano, and S. H. Speck NF-{kappa}B p50 Plays Distinct Roles in the Establishment and Control of Murine Gammaherpesvirus 68 Latency J. Virol., May 15, 2009; 83(10): 4732 - 4748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Konrad, E. Wies, M. Thurau, G. Marquardt, E. Naschberger, S. Hentschel, R. Jochmann, T. F. Schulz, H. Erfle, B. Brors, et al. A Systems Biology Approach To Identify the Combination Effects of Human Herpesvirus 8 Genes on NF-{kappa}B Activation J. Virol., March 15, 2009; 83(6): 2563 - 2574. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Efklidou, R. Bailey, N. Field, M. Noursadeghi, and M. K. Collins vFLIP from KSHV inhibits anoikis of primary endothelial cells J. Cell Sci., February 15, 2008; 121(4): 450 - 457. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Guruvayoorappan and G. Kuttan {beta}-Carotene Inhibits Tumor-Specific Angiogenesis by Altering the Cytokine Profile and Inhibits the Nuclear Translocation of Transcription Factors in B16F-10 Melanoma Cells Integr Cancer Ther, September 1, 2007; 6(3): 258 - 270. [Abstract] [PDF]
|
|
|
|
 |
|
 P. E. Pellett Totally tubular: virally induced endothelial tube formation Blood, April 1, 2007; 109(7): 2669 - 2670. [Full Text] [PDF]
|
|
|
|
 |
|
 D. Verzijl, L. Pardo, M. van Dijk, Y. K. Gruijthuijsen, A. Jongejan, H. Timmerman, J. Nicholas, M. Schwarz, P. M. Murphy, R. Leurs, et al. Helix 8 of the Viral Chemokine Receptor ORF74 Directs Chemokine Binding J. Biol. Chem., November 17, 2006; 281(46): 35327 - 35335. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Yarchoan Key role for a viral lytic gene in Kaposi's sarcoma. N. Engl. J. Med., September 28, 2006; 355(13): 1383 - 1385. [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. R. Rezaee, C. Cunningham, A. J. Davison, and D. J. Blackbourn Kaposi's sarcoma-associated herpesvirus immune modulation: an overview J. Gen. Virol., July 1, 2006; 87(7): 1781 - 1804. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. E. Brown, D. Fallin, I. Ruczinski, A. Hutchinson, B. Staats, F. Vitale, C. Lauria, D. Serraino, G. Rezza, G. Mbisa, et al. Associations of Classic Kaposi Sarcoma with Common Variants in Genes that Modulate Host Immunity. Cancer Epidemiol. Biomarkers Prev., May 1, 2006; 15(5): 926 - 934. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Cannon, E. Cesarman, and C. Boshoff KSHV G protein-coupled receptor inhibits lytic gene transcription in primary-effusion lymphoma cells via p21-mediated inhibition of Cdk2 Blood, January 1, 2006; 107(1): 277 - 284. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Rosenkilde, T. N. Kledal, and T. W. Schwartz High Constitutive Activity of a Virus-Encoded Seven Transmembrane Receptor in the Absence of the Conserved DRY Motif (Asp-Arg-Tyr) in Transmembrane Helix 3 Mol. Pharmacol., July 1, 2005; 68(1): 11 - 19. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. K. Jensen, D. J. Manfra, M. G. Grisotto, A. P. Martin, G. Vassileva, K. Kelley, T. W. Schwartz, and S. A. Lira The Human Herpes Virus 8-Encoded Chemokine Receptor Is Required for Angioproliferation in a Murine Model of Kaposi's Sarcoma J. Immunol., March 15, 2005; 174(6): 3686 - 3694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Paulsen, M. M. Rosenkilde, J. Eugen-Olsen, and T. N. Kledal Epstein-Barr Virus-Encoded BILF1 Is a Constitutively Active G Protein-Coupled Receptor J. Virol., January 1, 2005; 79(1): 536 - 546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Montaner, A. Sodhi, J.-M. Servitja, A. K. Ramsdell, A. Barac, E. T. Sawai, and J. S. Gutkind The small GTPase Rac1 links the Kaposi sarcoma-associated herpesvirus vGPCR to cytokine secretion and paracrine neoplasia Blood, November 1, 2004; 104(9): 2903 - 2911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. T. Venkatesha, J. Ahamed, C. Nuesch, A. K. Zaidi, and H. Ali Platelet-activating Factor-induced Chemokine Gene Expression Requires NF-{kappa}B Activation and Ca2+/Calcineurin Signaling Pathways: INHIBITION BY RECEPTOR PHOSPHORYLATION AND {beta}-ARRESTIN RECRUITMENT J. Biol. Chem., October 22, 2004; 279(43): 44606 - 44612. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-G. Guo, S. Pati, M. Sadowska, M. Charurat, and M. Reitz Tumorigenesis by Human Herpesvirus 8 vGPCR Is Accelerated by Human Immuodeficiency Virus Type 1 Tat J. Virol., September 1, 2004; 78(17): 9336 - 9342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Rosenkilde, K. A. McLean, P. J. Holst, and T. W. Schwartz The CXC Chemokine Receptor Encoded by Herpesvirus saimiri, ECRF3, Shows Ligand-regulated Signaling through Gi, Gq, and G12/13 Proteins but Constitutive Signaling Only through Gi and G12/13 Proteins J. Biol. Chem., July 30, 2004; 279(31): 32524 - 32533. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Liang and D. Ganem RBP-J (CSL) Is Essential for Activation of the K14/vGPCR Promoter of Kaposi's Sarcoma-Associated Herpesvirus by the Lytic Switch Protein RTA J. Virol., July 1, 2004; 78(13): 6818 - 6826. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ahamed, R. T. Venkatesha, E. B. Thangam, and H. Ali C3a Enhances Nerve Growth Factor-Induced NFAT Activation and Chemokine Production in a Human Mast Cell Line, HMC-1 J. Immunol., June 1, 2004; 172(11): 6961 - 6968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sodhi, S. Montaner, V. Patel, J. J. Gomez-Roman, Y. Li, E. A. Sausville, E. T. Sawai, and J. S. Gutkind Akt plays a central role in sarcomagenesis induced by Kaposi's sarcoma herpesvirus-encoded G protein-coupled receptor PNAS, April 6, 2004; 101(14): 4821 - 4826. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. K. Gruijthuijsen, E. V. H. Beuken, M. J. Smit, R. Leurs, C. A. Bruggeman, and C. Vink Mutational analysis of the R33-encoded G protein-coupled receptor of rat cytomegalovirus: identification of amino acid residues critical for cellular localization and ligand-independent signalling J. Gen. Virol., April 1, 2004; 85(4): 897 - 909. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Verzijl, C. P. Fitzsimons, M. van Dijk, J. P. Stewart, H. Timmerman, M. J. Smit, and R. Leurs Differential Activation of Murine Herpesvirus 68- and Kaposi's Sarcoma-Associated Herpesvirus-Encoded ORF74 G Protein-Coupled Receptors by Human and Murine Chemokines J. Virol., April 1, 2004; 78(7): 3343 - 3351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Liu, G. Sandford, G. Fei, and J. Nicholas G{alpha} Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor J. Virol., March 1, 2004; 78(5): 2460 - 2471. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. SODHI, S. MONTANER, and J. S. GUTKIND Does dysregulated expression of a deregulated viral GPCR trigger Kaposi's sarcomagenesis? FASEB J, March 1, 2004; 18(3): 422 - 427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, L. Xi, J. L. Hunt, W. Gooding, T. L. Whiteside, Z. Chen, T. E. Godfrey, and R. L. Ferris Expression Pattern of Chemokine Receptor 6 (CCR6) and CCR7 in Squamous Cell Carcinoma of the Head and Neck Identifies a Novel Metastatic Phenotype Cancer Res., March 1, 2004; 64(5): 1861 - 1866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Dadke, B. H. Fryer, E. A. Golemis, and J. Field Activation of p21-Activated Kinase 1-Nuclear Factor {kappa}B Signaling by Kaposi's Sarcoma-Associated Herpes Virus G Protein-Coupled Receptor during Cellular Transformation Cancer Res., December 15, 2003; 63(24): 8837 - 8847. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Field, W. Low, M. Daniels, S. Howell, L. Daviet, C. Boshoff, and M. Collins KSHV vFLIP binds to IKK-{gamma} to activate IKK J. Cell Sci., September 15, 2003; 116(18): 3721 - 3728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Melchjorsen, L. N. Sorensen, and S. R. Paludan Expression and function of chemokines during viral infections: from molecular mechanisms to in vivo function J. Leukoc. Biol., September 1, 2003; 74(3): 331 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Dourmishev, A. L. Dourmishev, D. Palmeri, R. A. Schwartz, and D. M. Lukac Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis Microbiol. Mol. Biol. Rev., June 1, 2003; 67(2): 175 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Waldhoer, P. Casarosa, M. M. Rosenkilde, M. J. Smit, R. Leurs, J. L. Whistler, and T. W. Schwartz The Carboxyl Terminus of Human Cytomegalovirus-encoded 7 Transmembrane Receptor US28 Camouflages Agonism by Mediating Constitutive Endocytosis J. Biol. Chem., May 23, 2003; 278(21): 19473 - 19482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Pati, J. S. Foulke Jr., O. Barabitskaya, J. Kim, B. C. Nair, D. Hone, J. Smart, R. A. Feldman, and M. Reitz Human Herpesvirus 8-Encoded vGPCR Activates Nuclear Factor of Activated T Cells and Collaborates with Human Immunodeficiency Virus Type 1 Tat J. Virol., May 15, 2003; 77(10): 5759 - 5773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Estep, M. K. Axthelm, and S. W. Wong A G Protein-Coupled Receptor Encoded by Rhesus Rhadinovirus Is Similar to ORF74 of Kaposi's Sarcoma-Associated Herpesvirus J. Virol., February 1, 2003; 77(3): 1738 - 1746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Cannon, N. J. Philpott, and E. Cesarman The Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Has Broad Signaling Effects in Primary Effusion Lymphoma Cells J. Virol., December 6, 2002; 77(1): 57 - 67. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. Polson, D. Wang, J. DeRisi, and D. Ganem Modulation of Host Gene Expression by the Constitutively Active G Protein-coupled Receptor of Kaposi's Sarcoma-associated Herpesvirus Cancer Res., August 1, 2002; 62(15): 4525 - 4530. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Prakash, Z.-Y. Tang, X. Peng, R. Coleman, J. Gill, G. Farr, and F. Samaniego Tumorigenesis and Aberrant Signaling in Transgenic Mice Expressing the Human Herpesvirus-8 K1 Gene J Natl Cancer Inst, June 19, 2002; 94(12): 926 - 935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ahamed and H. Ali Distinct Roles of Receptor Phosphorylation, G Protein Usage, and Mitogen-activated Protein Kinase Activation on Platelet Activating Factor-induced Leukotriene C4 Generation and Chemokine Production J. Biol. Chem., June 14, 2002; 277(25): 22685 - 22691. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, M. T. Eby, N. Rathore, S. K. Sinha, A. Kumar, and P. M. Chaudhary The Human Herpes Virus 8-encoded Viral FLICE Inhibitory Protein Physically Associates with and Persistently Activates the Ikappa B Kinase Complex J. Biol. Chem., April 12, 2002; 277(16): 13745 - 13751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Smit, D. Verzijl, P. Casarosa, M. Navis, H. Timmerman, and R. Leurs Kaposi's Sarcoma-Associated Herpesvirus-Encoded G Protein-Coupled Receptor ORF74 Constitutively Activates p44/p42 MAPK and Akt via Gi and Phospholipase C-Dependent Signaling Pathways J. Virol., February 15, 2002; 76(4): 1744 - 1752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. K. Gruijthuijsen, P. Casarosa, S. J. F. Kaptein, J. L. V. Broers, R. Leurs, C. A. Bruggeman, M. J. Smit, and C. Vink The Rat Cytomegalovirus R33-Encoded G Protein-Coupled Receptor Signals in a Constitutive Fashion J. Virol., February 1, 2002; 76(3): 1328 - 1338. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Ye Regulation of nuclear factor {kappa}B activation by G-protein-coupled receptors J. Leukoc. Biol., December 1, 2001; 70(6): 839 - 848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. W. Shepard, M. Yang, P. Xie, D. D. Browning, T. Voyno-Yasenetskaya, T. Kozasa, and R. D. Ye Constitutive Activation of NF-kappa B and Secretion of Interleukin-8 Induced by the G Protein-coupled Receptor of Kaposi's Sarcoma-associated Herpesvirus Involve Galpha 13 and RhoA J. Biol. Chem., November 30, 2001; 276(49): 45979 - 45987. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
