The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morita, C. T.
Right arrow Articles by Tanaka, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morita, C. T.
Right arrow Articles by Tanaka, Y.
The Journal of Immunology, 2001, 167: 36-41.
Copyright © 2001 by The American Association of Immunologists

Structural Features of Nonpeptide Prenyl Pyrophosphates That Determine Their Antigenicity for Human {gamma}{delta} T Cells1

Craig T. Morita2,*, Hoi K. Lee*, Hong Wang*, Hongmin Li{dagger}, Roy A. Mariuzza{ddagger} and Yoshimasa Tanaka§

* Division of Rheumatology, Department of Internal Medicine and the Interdisciplinary Group in Immunology, University of Iowa College of Medicine, Iowa City, IA 52242; {dagger} Structural and Cell Biology Program, Department of Biomedical Sciences, Wadsworth Center, New York State Department of Health, Albany, NY 12201; {ddagger} Center for Advanced Research in Biotechnology, University of Maryland Biotechnology Institute, Rockville, MD 20850; and § Department of Immunology and Cell Biology, Kyoto University Medical School, Kyoto, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Human V{gamma}2V{delta}2+ T cells proliferate in vivo during many microbial infections. We have found that V{gamma}2V{delta}2+ T cells recognize nonpeptide prenyl pyrophosphates and alkylamines. We now have defined structural features that determine the antigenicity of prenyl pyrophosphates by testing synthetic analogs for bioactivity. We find that the carbon chain closest to the pyrophosphate moiety plays the major role in determining bioactivity. Changes in this area, such as the loss of a double bond, abrogated bioactivity. The loss of a phosphate from the pyrophosphate moiety also decreased antigenicity 100- to 200-fold. However, nucleotide monophosphates could be added with minimal changes in bioactivity. Longer prenyl pyrophosphates also retained bioactivity. Despite differences in CDR3 sequence, V{gamma}2V{delta}2+ clones and a transfectant responded similarly. Ag docking into a V{gamma}2V{delta}2 TCR model reveals a potential binding site in germline regions of the V{gamma}2J{gamma}1.2 CDR3 and V{delta}2 CDR2 loops. Thus, V{gamma}2V{delta}2+ T cells recognize a core carbon chain and pyrophosphate moiety. This recognition is relatively unaffected by additions at distal positions to the core Ag unit.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Asecond subset of T cells, {gamma}{delta} T cells, exhibit specialized Ag recognition properties and functions (1). {gamma}{delta} T cells appear to function as a bridge between the innate and adaptive immune systems and play important roles in the control of infections and autoimmune responses. To perform these functions, {gamma}{delta} T cells recognize unique nonpeptide Ags distinct from those recognized by {alpha}{beta} T cells (2, 3, 4). The recognition of nonpeptide Ags correlates with the expression of V{gamma}2 and V{delta}2 gene segments and is characterized by a polyclonal T cell expansion that does not require prior antigenic exposure (2, 5, 6). Although this response resembles superantigen recognition of {alpha}{beta} and {gamma}{delta} T cells, there are fundamental differences between {gamma}{delta} T cell recognition of nonpeptide Ags and superantigens (7).

There are a variety of different prenyl pyrophosphate and alkylamine Ags (1). At least five different phosphoantigens are produced by mycobacteria in the form of unconjugated and nucleotide-conjugated pyrophosphomonoesters (3, 8, 9, 10). Pyrophosphate Ags also are produced by malaria parasites (11). These microbial Ags may be intermediates or side products in isoprenoid synthetic pathways. However, human B cell tumor cell lines, such as Daudi (12) and RPMI 8226 (13), also express uncharacterized Ags that precisely mimic the ability of bacterial phosphoantigens to stimulate V{gamma}2V{delta}2 T cell clones (14). This suggests that prenyl pyrophosphate Ags may also be important in the recognition of human B cell lymphomas.

In this study we have analyzed V{gamma}2V{delta}2+ T cell responses to different prenyl pyrophosphate Ags and analogs. The core five-carbon chain proximal to the pyrophosphate moiety and the pyrophosphate moiety itself play important roles in determining the antigenicity of phosphoantigens. Distal carbon residues or substitutions on the end of the pyrophosphate moiety play less important roles. Individual {gamma}{delta} T cells with distinct TCR sequences have similar responses to different pyrophosphate Ags, suggesting that variations in the junctional regions do not greatly affect recognition by the V{gamma}2V{delta}2 TCR. Docking of these compounds into a model of the V{gamma}2V{delta}2 TCR suggests that these more distal regions of phosphoantigens may position into open areas or large pockets on the TCR, whereas the more proximal carbon chain and the pyrophosphate moiety are in close contact to the TCR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Nonpeptide Ags

A series of alcohol compounds was condensed with ditriethylammonium phosphate in the presence of trichloroacetonitrile (2). The resulting reaction mixtures were bound to Q-Sepharose anion exchange resin, and the mono- and pyrophosphomonoesters eluted with a linear gradient of triethylammonium bicarbonate buffer, pH 7.5. The purified compounds were converted to sodium salts using Dowex 50W cation exchange column chromatography (Aldrich, Milwaukee, WI). Prenyl pyrophosphates were purchased from Sigma (St. Louis, MO). Nucleotide-conjugated compounds were synthesized (3) or purchased from Molecular Probes (Eugene, OR).

Maintenance of T cell lines and clones and proliferation assays

The 12G12 and CP.1.15 T cell clones were derived from peripheral blood from normal adults, and the DG.SF68 clone was derived from synovial fluid from a patient with rheumatoid arthritis (2, 15). The clones were maintained by periodic restimulation (15) and used 17–40 days after restimulation. For proliferation assays T cells were plated in triplicate in round-bottom 96-well plates at 5–10 x 104 T cells/well with 1 x 105 irradiated (7000 rad) allogeneic PBMC feeder cells and the various Ags. Ags in ammonium hydroxide and methanol were dried by N2 gas and dissolved in medium by sonication in an ultrasonic water bath for 5 min. The cultures were pulsed with 1 µCi [3H]thymidine (2 Ci/mmol) on day 1 and were harvested 16–18 h later.

IL-2 release and assay

The DBS43 transfectant was derived by transfecting TCR- Jurkat T cells with cDNAs encoding V{gamma}2 and V{delta}2 chains from the DG.SF13 T cell clone as previously described (16). For IL-2 release, the DBS43 transfectant or the CP.1.15 T cell clone was cultured with prenyl pyrophosphate analogs in the presence of mitomycin C-treated DG.EBV B cells. After 24 h the supernatants were harvested, frozen, thawed, and used at a 1/8 dilution to stimulate the proliferation of the IL-2-dependent cell line, CTLL-20 (17).

Sequencing of V{gamma}2V{delta}2 TCR

RNA was isolated from T cells (Micro RNA isolation kit, Stratagene, La Jolla, CA) followed by cDNA synthesis using SuperScript II RNase H reverse transcriptase (Life Technologies, Gaithersburg, MD). PCR was performed with Platinum Taq High Fidelity DNA polymerase (Life Technologies). Primers used for full-length V{gamma}2C{gamma} and V{delta}2C{delta} chains were described previously (18), except for V{delta}2, where the following primer was used: 5'-gggctcgagCAGGCAGAAGGTTGTTGAGAG-3' (5' untranslated region). The V{gamma}2C{gamma} and V{delta}2C{delta} PCR products were cloned into pREP7 and pREP9 vectors (Invitrogen, Carlsbad, CA), respectively. Sequencing was performed with an automated sequencer using the pREP forward and reverse primers along with the following reverse primers: C{gamma} 3'-untranslated region, ATGGCCTCCTTGTGCCACCG; C{gamma} internal, TGTGTCGTTAGTCTTCATGG; C{delta} 3'-untranslated region, GGAGTGTAGCTTCCTCATGC; and C{delta} internal, GACAATAGCAGGATCAAACT. Junctional sequences are shown in Table IGo.


View this table:
[in this window]
[in a new window]
 
Table I. V{gamma}2V{delta}2 TCR sequences of T cells used in this reporta

 
Modeling of V{gamma}2V{delta}2 TCR

A model of the DG.SF13 TCR V{gamma}2V{delta}2 domain was built using homology modeling as described for the V{gamma}2 domain (7). The variable domains of the light chains, 2FB4 (19) and 2MCP (20), and the Bence Jones protein fragment, 2RHE (21), were selected for homology modeling of the V{delta}2 domain in a similar fashion as the V{gamma}2 domain. The DG.SF13 TCR is expressed by a synovial V{gamma}2V{delta}2+ T cell clone isolated from a patient with rheumatoid arthritis. This receptor was used for our previous transfection and mutagenesis experiments on the V{gamma}2V{delta}2 TCR (16, 22), and its sequence has been published (22). Docking was performed with the Sybyl program (Tripos, St. Louis, MO) at the University of Iowa Image Analysis Facility using the model of the V{gamma}2V{delta}2 TCR and models of prenyl pyrophosphate compounds made with Chem3-D 2000 (CambridgeSoft, Cambridge, MA).


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Effect of changes in carbon alkyl chain or pyrophosphate moiety on the bioactivity of alkyl pyrophosphate compounds

The carbon chain closest to the pyrophosphate moiety (designated X) was of paramount importance in determining bioactivity. Changes as simple as the addition of one carbon could abrogate bioactivity. For example, n-butyl pyrophosphate (four carbons) retained bioactivity, whereas n-amyl pyrophosphate (five carbons) did not (Fig. 1GoA). For alkyl chains, the two-carbon chain, ethyl pyrophosphate, had the highest specific activity, although one- to four-carbon chain compounds were active for both the 12G12 and DG.SF68 T cell clones. Although the two clones varied in their sensitivity to the different analogs, the relative activities of the analogs were identical.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 1. Structural features of prenyl pyrophosphates that determine antigenicity for {gamma}{delta} T cells. Phosphorylated compounds were incubated with the 12G12 or DG.SF68 V{gamma}2V{delta}2+ T cell clone and irradiated PBMC for 2 days. Alkyl (A), alkenyl/branched/aromatic (B), ATP conjugates (C), and prenyl (D) compounds were tested. Structures of the compounds are shown on the right. X, The carbon chain closest to the pyrophosphate moiety; N, groups bonded to the pyrophosphate moiety; Y, regions distal to the immediate isoprenoid unit bonded to the pyrophosphate; {dagger}OPP, pyrophosphate moiety. A, Identical carbon chains for alkyl phosphates and pyrophosphates use the same symbols. D, Similar prenyl response data for 12G12 have been published (3 ) and are included for comparison.

 
Loss of one phosphate from the pyrophosphate moiety decreased antigenicity between 40- and 240-fold (Table IIGo and Fig. 1GoA) (3). The methyl carbon chain was especially sensitive to phosphate loss, probably due to its small size. The dimethylallyl chain was relatively unaffected by loss of the phosphate.


View this table:
[in this window]
[in a new window]
 
Table II. Effect of phosphate number on antigenicity of phosphoantigensa

 
With the addition of a double bond, antigenicity was relatively independent of alkenyl carbon chain length between three and five carbons (Fig. 1GoB). Unsubstituted (not containing carbon double bonds) branched alkyl chains of five carbons and aromatic chains were not active (Fig. 1GoB). For example, isopentenyl pyrophosphate, that contains a carbon double bond at the C3-C4 position, was active, whereas isoamyl pyrophosphate, which lacks this double bond, was inactive. Other phosphorylated sugars, nucleotides, and phosphorylated metabolites were either inactive or required 1–10 mM concentrations (ribose 1-phosphate and xylose 1-phosphate) for reactivity (data not shown) (23).

Effect of substitutions on the pyrophosphate moiety

Large chemical groups could be added to the pyrophosphate moiety opposite the alkyl chain (the N position). Thus, the addition of AMP to the pyrophosphate moiety of ethyl pyrophosphate had no effect on bioactivity (Fig. 1GoC). However, as noted for phosphomonoesters, the addition of large groups aromatic chains to the alkyl chain (X) position of nucleotide compounds resulted in the loss of bioactivity (Fig. 1GoC). Although pyrophosphates with adjacent large chemical groups were inactive, longer prenyl pyrophosphate, such as geranylgeranyl pyrophosphate, retained bioactivity despite having four isoprenoid unit carbon chains (20 carbons; Fig. 1GoD). This suggested that large groups spaced away from the pyrophosphates by an isoprenoid unit (containing a carbon double bond at the C2-C3 position) would be active. This prediction was confirmed by the bioactivity of a compound with aromatic groups spaced one isoprenoid unit away from the pyrophosphate moiety (C. T. Morita et al., manuscript in preparation). Thus, V{gamma}2V{delta}2+ T cells specifically recognize a core Ag unit of X-pyrophosphate (X-OPP)3 (Fig. 2Go). Recognition is not greatly affected by the addition of chemical groups at distal positions, allowing the addition of alkenyl or aromatic substitutions in the position adjacent to the proximal alkyl chain.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 2. Core Ag unit recognized by V{gamma}2V{delta}2 TCR. X, The carbon chain closest to the pyrophosphate moiety that is critical for prenyl pyrophosphate recognition; N, groups bonded to the pyrophosphate moiety; Y, regions distal to the immediate isoprenoid unit bonded to the pyrophosphate. Arrow indicates position of double bond in longer chain prenyl pyrophosphates.

 
The highly specific recognition of the proximal carbon chain noted in this study is consistent with the findings of the study by Belmant et al. (24). Belmant et al. noted increased specific activity for {gamma}{delta} T cells with the addition of a halohydrin to the C3 position (24). Moreover, TUBag1, the natural Ag that has an aldehyde group at the C4 position and lacks the C3-C4 double bond (10), has a 1000-fold higher specific activity than isopentenyl pyrophosphate.

Consistent with our finding that monophosphate compounds had reduced specific activity compared with pyrophosphate compounds (Table IIGo), Belmant et al. also noted that alteration in the pyrophosphate moiety abolished recognition; the activity of monophosphate compounds suggests that the hydrolysis of the pyrophosphate moiety is not an absolute requirement for V{gamma}2V{delta}2 TCR recognition. Instead, the differences in activity may reflect the ability of the V{gamma}2V{delta}2 TCR to distinguish between pyrophosphate and pyrophosphonate moieties. Nonhydrolyzable analogs of prenyl pyrophosphates may inhibit recognition by binding to a presenting element for these compounds, preventing the recognition of the presenting element-nonpeptide Ag complex by the V{gamma}2V{delta}2 TCR.

Ag specificity of the DBS43 V{gamma}2V{delta}2 TCR transfectant is similar to that of V{gamma}2V{delta}2+ T cell clones

To determine whether factors other than the expression of the V{gamma}2V{delta}2 TCR affect fine Ag specificity, the V{gamma}2V{delta}2 TCR transfectant, DBS43, and the V{gamma}2V{delta}2 T cell clone, CP.1.15, were stimulated with various prenyl pyrophosphate analogs. Although the DBS43 transfectant was less sensitive than the CP.1.15 T cell clone, there were minimal differences in the relative potencies of different analogs such that the hierarchy of phosphoantigen bioactivity did not change. For example, isopentenyl pyrophosphate (IPP) was 11-fold more potent than dimethylallyl pyrophosphate (DMAPP) at stimulating half-maximal IL-2 release by the DBS43 transfectant (130 µM for IPP vs 1400 µM for DMAPP; Fig. 3Go). For the CP.1.15 T cell clone, IPP was 33-fold more stimulatory than DMAPP (half-maximal IL-2 release at 3 µM for IPP vs 100 µM for DMAPP). Similar differences were noted in the half-maximal proliferative responses of the T cell clones, 12G12 (38-fold) and DG.SF68 (19-fold), when IPP and DMAPP were compared (Fig. 1GoD). Thus, the relative potencies of different compounds are determined primarily by the V{gamma}2V{delta}2 TCR, although the Ag concentration required for half-maximal stimulation can vary between different V{gamma}2V{delta}2 T cells.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. IL-2 release by a V{gamma}2V{delta}2 TCR transfectant and a T cell clone in response to prenyl pyrophosphate analogs. The V{gamma}2V{delta}2 TCR transfectant, DBS43, and the V{gamma}2V{delta}2+ T cell clone, CP.1.15, were cultured with the indicated Ags in the presence of DG.EBV B cells. The supernatants were harvested at 24 h and used to stimulate the proliferation of the IL-2-dependent cell line, CTLL-20. IL-2 release data for DBS43 in response to IPP and phenethyl pyrophosphate were previously reported (3 ) and are included for comparison.

 
Proposed prenyl pyrophosphate binding site within the V{gamma}2V{delta}2 TCR

The recognition of nonpeptide Ags strictly correlates with the expression of V{gamma}2 and V{delta}2 gene segments (14, 22) and is characterized by a polyclonal T cell expansion that does not require prior antigenic exposure (5). Almost all adult V{gamma}2V{delta}2 TCR use the J{gamma}1.2 junctional region, whereas many fetal V{gamma}2V{delta}2 T cells use other J{gamma} segments, suggesting that selection for this J segment occurs during the expansion of the V{gamma}2V{delta}2 T cell subset during youth (25, 26). Moreover, the V{gamma}2V{delta}2 TCR shows conservation in the V{gamma}2 CDR3 length (98% of adult V{gamma}2V{delta}2 TCR have V{gamma}2 CDR3 lengths of ±1 of a modal value (27)), conservation of the lysine residues in the J{gamma}1.2 junctional region, and conservation of a hydrophobic residue in the V{delta}2 CDR3 region (14, 28). These findings suggested that the recognition of prenyl pyrophosphates is mediated by germline-encoded elements of the classical Ag binding region of the V{gamma}2V{delta}2 TCR.

Further supporting this hypothesis, when TCR- Jurkat cells were transfected with cDNAs encoding wild-type or mutant V{gamma}2J{gamma}1.2C{gamma} chains and a V{delta}2C{delta} chain, we found that mutation of the N-encoded region of the V{gamma}2J{gamma}1.2 CDR3 abolished reactivity to both monoethyl phosphate and mycobacterial Ags (16, 22). Moreover, a V{gamma}2J{gamma}1.3V{delta}2 TCR transfectant was unable to respond to the prenyl pyrophosphate analog, monoethyl phosphate, although it did respond to the pyrophosphomonoester from mycobacteria. These two V{gamma}2 chains vary only in the CDR3 region, primarily in the J{gamma} region, with the substitution of a lysine at position 110 for the lysine residues at positions 108 and 109 (22). Furthermore, many V{gamma}2V{delta}2+ T cells expressing the rare V{gamma}2J{gamma}1.3/2.3 rearrangement and a few V{gamma}2V{delta}2+ T cells expressing V{gamma}2J{gamma}1.2V{delta}2 TCRs are unable to respond to nonpeptide Ags (14, 29). These nonreactive {gamma}{delta} T cells differ primarily in the V{gamma}2 CDR3 region, again suggesting that this region is involved in Ag recognition.

Based on the TCR mutagenesis studies and the results reported here, we propose the following model for the binding of prenyl pyrophosphates to the V{gamma}2V{delta}2 TCR. Homology modeling of the DBS43 V{gamma}2V{delta}2 TCR reveals that the amino groups of the positively charged lysine residues at positions 108 and 109 are predicted to be solvent exposed and near the amino group of a lysine at position 51 (or potentially the amino group of an arginine at position 49) in the germline-encoded CDR2 region of the V{delta}2 chain (Fig. 4GoA). Positively charged amino acids are commonly found in the binding site of proteins that bind phosphate-containing compounds because they neutralize the negative charges carried by phosphate moieties. When IPP or IPP-UMP is docked into the V{gamma}2V{delta}2 receptor, the Ags can be oriented at low energy, such that the pyrophosphate moiety makes hydrogen bonds to the amino groups of the lysines (Fig. 4Go, B–D). For nucleotide conjugates, the nucleotide may project over the V{delta}2 CDR2 region (Fig. 4GoD). Longer carbon chain compounds, such as geranylgeranyl pyrophosphate (four isoprenoid units), can fit into a hydrophobic pocket formed between the V{gamma}2 CDR2 region and the V{delta}2 CDR3 region (Fig. 4GoC). Alternatively, the carbon chain may bind to a pocket in a putative Ag-presenting molecule for prenyl pyrophosphates.



View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 4. Docking of prenyl pyrophosphate Ags into a V{gamma}2V{delta}2 TCR model. A model of the V{gamma}2V{delta}2 TCR from DBS43 (A) was constructed based on homology with Ig V regions. Surface charge was calculated using the Sybyl program. Basic (positively charged) areas are blue-purple, whereas acidic (negatively charged) areas are orange-red. Docking of different classes of prenyl pyrophosphates was performed using the Sybyl program for IPP (B), geranylgeranyl pyrophosphate (GGPP) (C), and the isopentenyl conjugate of UTP (IPPPU) (D). The negatively charged phosphate moieties of the Ags orient over the basic region encoded by primary amino groups from lysine residues 108 and 109 from the J{gamma}1.2 region of the CDR3 region of the V{gamma}2 domain and lysine residue 51 from the CDR2 region of the V{delta}2 domain.

 
Although this model is consistent with the data for prenyl pyrophosphate Ags, positively charged alkylamine Ags may bind to the proposed binding site in a different orientation or to another site, perhaps explaining why, in contrast to alkyl pyrophosphates (Fig. 1Go), longer chain alkylamines, such as sec-butyl and iso-butyl amine, are more active than shorter chain alkylamines (4). Alternatively, a divalent anion could serve as a bridge between the positive charges of the amino groups of the lysines and the positive charge of the amino groups of the alkylamines. Although there is no direct experimental evidence for a divalent cation requirement, such a requirement could also result in a different orientation of the alkyl chain.

While prenyl pyrophosphates and analogs are expected to interact with the CDR regions of V{gamma}2 and V{delta}2, such interaction would probably not be sufficient to activate {gamma}{delta} T cells, much as free haptens do not activate anti-hapten-specific B cells even with high affinity Ab receptors. Instead, cross-linking and clustering of T cell and B cell Ag receptors is required to reach critical signaling thresholds. With such small molecules such as prenyl pyrophosphates, a protein or other structure might be expected to play a presenting function similar to that played by MHC or CD1 molecules (17). Such a presenting molecule would allow multivalent interaction with the V{gamma}2V{delta}2 TCR that are required for T cell activation.

A better understanding of the structural features of prenyl pyrophosphates that determine their antigenicity may aid in the design of nonpeptide vaccines. Already, high potency synthetic Ags have been designed as well as blocking analogs (24). As substitutions are permitted in the distal portions of a triphosphate moiety, it may be possible to design phosphoantigens that are capped on the terminal triphosphate moiety, such as nucleotide-conjugated prenyl pyrophosphates, to prevent degradation by alkaline phosphatases. The development of nonpeptide phosphoantigen vaccines may allow us to vaccinate individuals to enhance their immunity to a number of different pathogens.

The recognition of nonpeptide Ags by the V{gamma}2V{delta}2 TCR probably plays important roles in human immunity to infection and to tumors by controlling the early phases of the diseases. V{gamma}2V{delta}2+ T cells expand in response to many different bacterial and protozoal pathogens to very high levels in the peripheral blood (reviewed in Ref. 1). V{gamma}2V{delta}2+ T cells also recognize non-Hodgkin’s B cell lymphomas (12). In monkeys, we have found that V{gamma}2V{delta}2+ T cells can expand up to 25–30% of peripheral blood T cells following Mycobacterium bovis Calmette-Guérin bacillus infection, and these expansions correlated with the resolution of active infection (Y. Shen et al., manuscript in preparation). Reinfection resulted in greater and earlier expansions of V{gamma}2V{delta}2+ T cells, providing evidence for the adaptive nature of the response. Similar evidence for enhancement of human V{gamma}2V{delta}2+ T cell responses has been obtained after immunization with M. bovis Calmette-Guérin bacillus, suggesting that humans also mount adaptive V{gamma}2V{delta}2+ T cell responses (30). Since 20% of normal adults do not mount responses to prenyl pyrophosphate Ags in M. tuberculosis extracts (5), prenyl pyrophosphate vaccines could lead to more effective early human immunity to mycobacterial, bacterial, and protozoal infections.

In conclusion, we find that T cells expressing the V{gamma}2V{delta}2 TCR recognize prenyl pyrophosphate compounds and their analogs. Recognition is critically dependent on the structure of the proximal carbon chain and the pyrophosphate moiety. Based on a model of the V{gamma}2V{delta}2 TCR and our data, we speculate that the CDR3 region of V{gamma}2 and the CDR2 regions of V{delta}2 may contribute to part of the binding site for prenyl pyrophosphate Ags.


    Acknowledgments
 
We thank Drs. Jack Bukowski, Kia-Joo Puan, and Ki-Hoan Nam for critical reading of this manuscript; Barry R. Bloom and the Howard Hughes Medical Institute for providing reagents; and Dr. Boyd Knosp of the Image Analysis Facility for assistance with the use of the Sybyl program.


    Footnotes
 
1 This work was supported by grants from the National Institute of Arthritis and Musculoskeletal Diseases, National Institutes of Health (to C.T.M.); the National Institute of Allergy and Infectious Disease, National Institutes of Health (to R.A.M.); the Arthritis Foundation (to C.T.M.); American College of Rheumatology (to C.T.M.); the Howard Hughes Medical Institute (Research Resources Award to C.T.M.); The Richard Lounsbery Foundation (to R.A.M.); and National Multiple Sclerosis Society (to R.A.M.). H.K.L. received support from the American College of Rheumatology and the University of Iowa College of Medicine. Back

2 Address correspondence and reprint requests to Dr. Craig T. Morita, Division of Rheumatology, Department of Internal Medicine and the Interdisciplinary Group in Immunology, University of Iowa College of Medicine, EMRB 340F, Iowa City, IA 52242. E-mail address: craig-morita{at}uiowa.edu Back

3 Abbreviations used in this paper: OPP, pyrophosphate moiety; IPP, isopentenyl pyrophosphate; DMAPP, dimethylallyl pyrophosphate; NPE, 1-(2-nitrophenyl)ethyl; DMNPE, 1-(4,5-dimethoxy-2-nitrophenyl)ethyl; desyl, (1,2-diphenyl-2-oxo)ethyl. Back

Received for publication February 14, 2001. Accepted for publication April 24, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Morita, C. T., R. A. Mariuzza, M. B. Brenner. 2000. Antigen recognition by human {gamma}{delta} T cells: pattern recognition by the adaptive immune system. Springer Semin. Immunopathol. 22:191.[Medline]
  2. Tanaka, Y., S. Sano, E. Nieves, G. De Libero, D. Roca, R. L. Modlin, M. B. Brenner, B. R. Bloom, C. T. Morita. 1994. Nonpeptide ligands for human {gamma}{delta} T cells. Proc. Natl. Acad. Sci. USA 91:8175.[Abstract/Free Full Text]
  3. Tanaka, Y., C. T. Morita, Y. Tanaka, E. Nieves, M. B. Brenner, B. R. Bloom. 1995. Natural and synthetic non-peptide antigens recognized by human {gamma}{delta} T cells. Nature 375:155.[Medline]
  4. Bukowski, J. F., C. T. Morita, M. B. Brenner. 1999. Human {gamma}{delta} T cells recognize alkylamines derived from microbes, edible plants, and tea: implications for innate immunity. Immunity 11:57.[Medline]
  5. Panchamoorthy, G., J. McLean, R. L. Modlin, C. T. Morita, S. Ishikawa, M. B. Brenner, H. Band. 1991. A predominance of the T cell receptor V{gamma}2/V{delta}2 subset in human mycobacteria-responsive T cells suggests germline gene encoded recognition. J. Immunol. 147:3360.[Abstract]
  6. Ohmen, J. D., P. F. Barnes, K. Uyemura, S. Z. Lu, C. L. Grisso, R. L. Modlin. 1991. The T cell receptors of human {gamma}{delta} T cells reactive to Mycobacterium tuberculosis are encoded by specific V genes but diverse V-J junctions. J. Immunol. 147:3353.[Abstract]
  7. Morita, C. T., H. Li, J. G. Lamphear, R. R. Rich, J. D. Fraser, R. A. Mariuzza, H. K. Lee. 2001. Superantigen recognition by {gamma}{delta} T cells: SEA recognition site for human V{gamma}2 T cell receptors. Immunity 14:331.[Medline]
  8. Constant, P., F. Davodeau, M.-A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, J.-J. Fournié. 1994. Stimulation of human {gamma}{delta} T cells by nonpeptidic mycobacterial ligands. Science 264:267.[Abstract/Free Full Text]
  9. Poquet, Y., P. Constant, F. Halary, M.-A. Peyrat, M. Gilleron, F. Davodeau, M. Bonneville, J.-J. Fournié. 1996. A novel nucleotide-containing antigen for human blood {gamma}{delta} T lymphocytes. Eur. J. Immunol. 26:2344.[Medline]
  10. Belmant, C., E. Espinosa, R. Poupot, M.-A. Peyrat, M. Guiraud, Y. Poquet, M. Bonneville, J.-J. Fournié. 1999. 3-Formyl-1-butyl pyrophosphate a novel mycobacterial metabolite-activating human {gamma}{delta} T cells. J. Biol. Chem. 274:32079.[Abstract/Free Full Text]
  11. Behr, C., R. Poupot, M.-A. Peyrat, Y. Poquet, P. Constant, P. Dubois, M. Bonneville, J.-J. Fournie. 1996. Plasmodium falciparum stimuli for human {gamma}{delta} T cells are related to phosphorylated antigens of mycobacteria. Infect. Immun. 64:2892.[Abstract]
  12. Fisch, P., M. Malkovsky, S. Kovats, E. Sturm, E. Braakman, B. S. Klein, S. D. Voss, L. W. Morrissey, R. DeMars, W. J. Welch, et al 1990. Recognition by human V{gamma}9/V{delta}2 T cells of a GroEL homolog on Daudi Burkitt’s lymphoma cells. Science 250:1269.[Abstract/Free Full Text]
  13. Selin, L. K., S. Stewart, C. Shen, H. Q. Mao, J. A. Wilkins. 1992. Reactivity of {gamma}{delta} T cells induced by the tumour cell line RPMI 8226: functional heterogeneity of clonal populations and role of GroEL heat shock proteins. Scand. J. Immunol. 36:107.[Medline]
  14. Davodeau, F., M.-A. Peyrat, M.-M. Hallet, J. Gaschet, I. Houde, R. Vivien, H. Vie, M. Bonneville. 1993. Close correlation between Daudi and mycobacterial antigen recognition by human {gamma}{delta} T cells and expression of V9JPC1{gamma}/V2DJC{delta}-encoded T cell receptors. J. Immunol. 151:1214.[Abstract]
  15. Morita, C. T., S. Verma, P. Aparicio, C. Martinez-A., H. Spits, M. B. Brenner. 1991. Functionally distinct subsets of human {gamma}/{delta} T cells. Eur. J. Immunol. 21:2999.[Medline]
  16. Bukowski, J. F., C. T. Morita, Y. Tanaka, B. R. Bloom, M. B. Brenner, H. Band. 1995. V{gamma}2V{delta}2 TCR-dependent recognition of non-peptide antigens and Daudi cells analyzed by TCR gene transfer. J. Immunol. 154:998.[Abstract]
  17. Morita, C. T., E. M. Beckman, J. F. Bukowski, Y. Tanaka, H. Band, B. R. Bloom, D. E. Golan, M. B. Brenner. 1995. Direct presentation of nonpeptide prenyl pyrophosphate antigens to human {gamma}{delta} T cells. Immunity 3:495.[Medline]
  18. Spada, F. M., E. P. Grant, P. J. Peters, M. Sugita, A. Melián, D. S. Leslie, H. K. Lee, E. van Donselaar, D. A. Hanson, A. M. Krensky, et al 2000. Self recognition of CD1 by {gamma}{delta} T cells: implications for innate immunity. J. Exp. Med. 191:937.[Abstract/Free Full Text]
  19. Kratzin, H. D., W. Palm, M. Stangel, W. E. Schmidt, J. Friedrich, N. Hilschmann. 1989. The primary structure of crystallizable monoclonal immunoglobulin IgG1 Kol. II. Amino acid sequence of the L-chain, {gamma}-type, subgroup I. Biol. Chem. Hoppe-Seyler 370:263.[Medline]
  20. Satow, Y., G. H. Cohen, E. A. Padlan, D. R. Davies. 1986. Phosphocholine binding immunoglobulin Fab McPC603: an x-ray diffraction study at 2.7 Å. J. Mol. Biol. 190:593.[Medline]
  21. Jr Furey, W., B. C. Wang, C. S. Yoo, M. Sax. 1983. Structure of a novel Bence-Jones protein (Rhe) fragment at 1.6 Å resolution. J. Mol. Biol. 167:661.[Medline]
  22. Bukowski, J. F., C. T. Morita, H. Band, M. B. Brenner. 1998. Crucial role of TCR{gamma} chain junctional region in prenyl pyrophosphate antigen recognition by {gamma}{delta} T cells. J. Immunol. 161:286.[Abstract/Free Full Text]
  23. Bürk, M. R., L. Mori, G. De Libero. 1995. Human V{gamma}9-V{delta}2 cells are stimulated in a cross-reactive fashion by a variety of phosphorylated metabolites. Eur. J. Immunol. 25:2052.[Medline]
  24. Belmant, C., E. Espinosa, F. Halary, Y. Tang, M.-A. Peyrat, H. Sicard, A. Kozikowski, R. Buelow, R. Poupot, M. Bonneville, et al 2000. A chemical basis for selective recognition of nonpeptide antigens by human {gamma}{delta} T cells. FASEB J. 14:1669.[Abstract/Free Full Text]
  25. Morita, C. T., C. M. Parker, M. B. Brenner, H. Band. 1994. T cell receptor usage and functional capabilities of human {gamma}{delta} T cells at birth. J. Immunol. 153:3979.[Abstract]
  26. Parker, C. M., V. Groh, H. Band, S. A. Porcelli, C. Morita, M. Fabbi, D. Glass, J. L. Strominger, M. B. Brenner. 1990. Evidence for extrathymic changes in the T cell receptor {gamma}/{delta} repertoire. J. Exp. Med. 171:1597.[Abstract/Free Full Text]
  27. Delfau, M.-H., A. J. Hance, D. Lecossier, E. Vilmer, B. Grandchamp. 1992. Restricted diversity of V{gamma}9-JP rearrangements in unstimulated human {gamma}/{delta} T lymphocytes. Eur. J. Immunol. 22:2437.[Medline]
  28. Davodeau, F., M. A. Peyrat, M. M. Hallet, I. Houde, H. Vie, M. Bonneville. 1993. Peripheral selection of antigen receptor junctional features in a major human {gamma}{delta} subset. Eur. J. Immunol. 23:804.[Medline]
  29. De Libero, G., G. Casorati, C. Giachino, C. Carbonara, N. Migone, P. Matzinger, A. Lanzavecchia. 1991. Selection by two powerful antigens may account for the presence of the major population of human peripheral {gamma}/{delta} T cells. J. Exp. Med. 173:1311.[Abstract/Free Full Text]
  30. Hoft, D. F., R. M. Brown, S. T. Roodman. 1998. Bacille Calmette-Guérin vaccination enhances human {gamma}{delta} T cell responsiveness to mycobacteria suggestive of a memory-like phenotype. J. Immunol. 161:1045.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. K. Aydintug, C. L. Roark, X. Yin, J. M. Wands, W. K. Born, and R. L. O'Brien
Detection of Cell Surface Ligands for the {gamma}{delta} TCR Using Soluble TCRs
J. Immunol., April 1, 2004; 172(7): 4167 - 4175.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Yamashita, Y. Tanaka, M. Harazaki, B. Mikami, and N. Minato
Recognition mechanism of non-peptide antigens by human {gamma}{delta} T cells
Int. Immunol., November 1, 2003; 15(11): 1301 - 1307.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. R. Klimpel, M. A. Matthias, and J. M. Vinetz
Leptospira interrogans Activation of Human Peripheral Blood Mononuclear Cells: Preferential Expansion of TCR{gamma}{delta}+ T Cells vs TCR{alpha}{beta}+ T Cells
J. Immunol., August 1, 2003; 171(3): 1447 - 1455.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Wang, H. K. Lee, J. F. Bukowski, H. Li, R. A. Mariuzza, Z. W. Chen, K.-H. Nam, and C. T. Morita
Conservation of Nonpeptide Antigen Recognition by Rhesus Monkey V{gamma}2V{delta}2 T Cells
J. Immunol., April 1, 2003; 170(7): 3696 - 3706.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Hebart, C. Bollinger, P. Fisch, J. Sarfati, C. Meisner, M. Baur, J. Loeffler, M. Monod, J.-P. Latge, and H. Einsele
Analysis of T-cell responses to Aspergillus fumigatus antigens in healthy individuals and patients with hematologic malignancies
Blood, December 15, 2002; 100(13): 4521 - 4528.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Grigoriadou, L. Boucontet, and P. Pereira
T Cell Receptor-{gamma} Allele-Specific Selection of V{gamma}1/V{delta}4 Cells in the Intestinal Epithelium
J. Immunol., October 1, 2002; 169(7): 3736 - 3743.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. E. Rojas, M. Torres, J.-J. Fournie, C. V. Harding, and W. H. Boom
Phosphoantigen Presentation by Macrophages to Mycobacterium tuberculosis-Reactive V{gamma}9V{delta}2+ T Cells: Modulation by Chloroquine
Infect. Immun., August 1, 2002; 70(8): 4019 - 4027.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morita, C. T.
Right arrow Articles by Tanaka, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morita, C. T.
Right arrow Articles by Tanaka, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS