|
|
||||||||

T Cells1



*
Division of Rheumatology, Department of Internal Medicine and the Interdisciplinary Group in Immunology, University of Iowa College of Medicine, Iowa City, IA 52242;
Structural and Cell Biology Program, Department of Biomedical Sciences, Wadsworth Center, New York State Department of Health, Albany, NY 12201;
Center for Advanced Research in Biotechnology, University of Maryland Biotechnology Institute, Rockville, MD 20850; and
Department of Immunology and Cell Biology, Kyoto University Medical School, Kyoto, Japan
| Abstract |
|---|
|
|
|---|
2V
2+ T cells proliferate in vivo during
many microbial infections. We have found that V
2V
2+ T
cells recognize nonpeptide prenyl pyrophosphates and alkylamines. We
now have defined structural features that determine the antigenicity of
prenyl pyrophosphates by testing synthetic analogs for bioactivity. We
find that the carbon chain closest to the pyrophosphate moiety plays
the major role in determining bioactivity. Changes in this area, such
as the loss of a double bond, abrogated bioactivity. The loss of a
phosphate from the pyrophosphate moiety also decreased antigenicity
100- to 200-fold. However, nucleotide monophosphates could be added
with minimal changes in bioactivity. Longer prenyl pyrophosphates also
retained bioactivity. Despite differences in CDR3 sequence,
V
2V
2+ clones and a transfectant responded similarly.
Ag docking into a V
2V
2 TCR model reveals a potential binding site
in germline regions of the V
2J
1.2 CDR3 and V
2 CDR2 loops.
Thus, V
2V
2+ T cells recognize a core carbon chain and
pyrophosphate moiety. This recognition is relatively unaffected by
additions at distal positions to the core Ag unit. | Introduction |
|---|
|
|
|---|

T cells, exhibit specialized Ag recognition
properties and functions (1). 
T cells appear to
function as a bridge between the innate and adaptive immune systems and
play important roles in the control of infections and autoimmune
responses. To perform these functions, 
T cells recognize unique
nonpeptide Ags distinct from those recognized by 
T cells
(2, 3, 4). The recognition of nonpeptide Ags correlates with
the expression of V
2 and V
2 gene segments and is characterized by
a polyclonal T cell expansion that does not require prior antigenic
exposure (2, 5, 6). Although this response resembles
superantigen recognition of 
and 
T cells, there are
fundamental differences between 
T cell recognition of nonpeptide
Ags and superantigens (7).
There are a variety of different prenyl pyrophosphate and alkylamine
Ags (1). At least five different phosphoantigens are
produced by mycobacteria in the form of unconjugated and
nucleotide-conjugated pyrophosphomonoesters (3, 8, 9, 10).
Pyrophosphate Ags also are produced by malaria parasites
(11). These microbial Ags may be intermediates or side
products in isoprenoid synthetic pathways. However, human B cell tumor
cell lines, such as Daudi (12) and RPMI 8226
(13), also express uncharacterized Ags that precisely
mimic the ability of bacterial phosphoantigens to stimulate V
2V
2
T cell clones (14). This suggests that prenyl
pyrophosphate Ags may also be important in the recognition of human B
cell lymphomas.
In this study we have analyzed V
2V
2+ T cell
responses to different prenyl pyrophosphate Ags and analogs. The core
five-carbon chain proximal to the pyrophosphate moiety and the
pyrophosphate moiety itself play important roles in determining the
antigenicity of phosphoantigens. Distal carbon residues or
substitutions on the end of the pyrophosphate moiety play less
important roles. Individual 
T cells with distinct TCR sequences
have similar responses to different pyrophosphate Ags, suggesting that
variations in the junctional regions do not greatly affect recognition
by the V
2V
2 TCR. Docking of these compounds into a model of the
V
2V
2 TCR suggests that these more distal regions of
phosphoantigens may position into open areas or large pockets on the
TCR, whereas the more proximal carbon chain and the pyrophosphate
moiety are in close contact to the TCR.
| Materials and Methods |
|---|
|
|
|---|
A series of alcohol compounds was condensed with ditriethylammonium phosphate in the presence of trichloroacetonitrile (2). The resulting reaction mixtures were bound to Q-Sepharose anion exchange resin, and the mono- and pyrophosphomonoesters eluted with a linear gradient of triethylammonium bicarbonate buffer, pH 7.5. The purified compounds were converted to sodium salts using Dowex 50W cation exchange column chromatography (Aldrich, Milwaukee, WI). Prenyl pyrophosphates were purchased from Sigma (St. Louis, MO). Nucleotide-conjugated compounds were synthesized (3) or purchased from Molecular Probes (Eugene, OR).
Maintenance of T cell lines and clones and proliferation assays
The 12G12 and CP.1.15 T cell clones were derived from peripheral blood from normal adults, and the DG.SF68 clone was derived from synovial fluid from a patient with rheumatoid arthritis (2, 15). The clones were maintained by periodic restimulation (15) and used 1740 days after restimulation. For proliferation assays T cells were plated in triplicate in round-bottom 96-well plates at 510 x 104 T cells/well with 1 x 105 irradiated (7000 rad) allogeneic PBMC feeder cells and the various Ags. Ags in ammonium hydroxide and methanol were dried by N2 gas and dissolved in medium by sonication in an ultrasonic water bath for 5 min. The cultures were pulsed with 1 µCi [3H]thymidine (2 Ci/mmol) on day 1 and were harvested 1618 h later.
IL-2 release and assay
The DBS43 transfectant was derived by transfecting
TCR- Jurkat T cells with cDNAs encoding V
2
and V
2 chains from the DG.SF13 T cell clone as previously described
(16). For IL-2 release, the DBS43 transfectant or the
CP.1.15 T cell clone was cultured with prenyl pyrophosphate analogs in
the presence of mitomycin C-treated DG.EBV B cells. After 24 h the
supernatants were harvested, frozen, thawed, and used at a 1/8 dilution
to stimulate the proliferation of the IL-2-dependent cell line, CTLL-20
(17).
Sequencing of V
2V
2 TCR
RNA was isolated from T cells (Micro RNA isolation kit,
Stratagene, La Jolla, CA) followed by cDNA synthesis using SuperScript
II RNase H reverse transcriptase (Life Technologies, Gaithersburg, MD).
PCR was performed with Platinum Taq High Fidelity DNA
polymerase (Life Technologies). Primers used for full-length V
2C
and V
2C
chains were described previously (18),
except for V
2, where the following primer was used:
5'-gggctcgagCAGGCAGAAGGTTGTTGAGAG-3' (5' untranslated region). The
V
2C
and V
2C
PCR products were cloned into pREP7 and pREP9
vectors (Invitrogen, Carlsbad, CA), respectively. Sequencing was
performed with an automated sequencer using the pREP forward and
reverse primers along with the following reverse primers: C
3'-untranslated region, ATGGCCTCCTTGTGCCACCG; C
internal,
TGTGTCGTTAGTCTTCATGG; C
3'-untranslated region,
GGAGTGTAGCTTCCTCATGC; and C
internal, GACAATAGCAGGATCAAACT.
Junctional sequences are shown in Table I
.
|
2V
2 TCR
A model of the DG.SF13 TCR V
2V
2 domain was built using
homology modeling as described for the V
2 domain (7).
The variable domains of the light chains, 2FB4 (19) and
2MCP (20), and the Bence Jones protein fragment, 2RHE
(21), were selected for homology modeling of the V
2
domain in a similar fashion as the V
2 domain. The DG.SF13 TCR is
expressed by a synovial V
2V
2+ T cell clone
isolated from a patient with rheumatoid arthritis. This receptor was
used for our previous transfection and mutagenesis experiments on the
V
2V
2 TCR (16, 22), and its sequence has been
published (22). Docking was performed with the Sybyl
program (Tripos, St. Louis, MO) at the University of Iowa Image
Analysis Facility using the model of the V
2V
2 TCR and models of
prenyl pyrophosphate compounds made with Chem3-D 2000 (CambridgeSoft,
Cambridge, MA).
| Results and Discussion |
|---|
|
|
|---|
The carbon chain closest to the pyrophosphate moiety (designated
X) was of paramount importance in determining bioactivity. Changes as
simple as the addition of one carbon could abrogate bioactivity. For
example, n-butyl pyrophosphate (four carbons) retained
bioactivity, whereas n-amyl pyrophosphate (five carbons) did
not (Fig. 1
A). For alkyl
chains, the two-carbon chain, ethyl pyrophosphate, had the highest
specific activity, although one- to four-carbon chain compounds were
active for both the 12G12 and DG.SF68 T cell clones. Although the two
clones varied in their sensitivity to the different analogs, the
relative activities of the analogs were identical.
|
|
Effect of substitutions on the pyrophosphate moiety
Large chemical groups could be added to the pyrophosphate moiety
opposite the alkyl chain (the N position). Thus, the addition of AMP to
the pyrophosphate moiety of ethyl pyrophosphate had no effect on
bioactivity (Fig. 1
C). However, as noted for
phosphomonoesters, the addition of large groups aromatic chains to the
alkyl chain (X) position of nucleotide compounds resulted in the loss
of bioactivity (Fig. 1
C). Although pyrophosphates with
adjacent large chemical groups were inactive, longer prenyl
pyrophosphate, such as geranylgeranyl pyrophosphate, retained
bioactivity despite having four isoprenoid unit carbon chains (20
carbons; Fig. 1
D). This suggested that large groups spaced
away from the pyrophosphates by an isoprenoid unit (containing a carbon
double bond at the C2-C3 position) would be active. This prediction was
confirmed by the bioactivity of a compound with aromatic groups spaced
one isoprenoid unit away from the
pyrophosphate moiety (C. T. Morita et al., manuscript in preparation).
Thus, V
2V
2+ T cells specifically recognize
a core Ag unit of X-pyrophosphate (X-OPP)3 (Fig. 2
). Recognition is not greatly affected
by the addition of chemical groups at distal positions, allowing the
addition of alkenyl or aromatic substitutions in the position adjacent
to the proximal alkyl chain.
|

T cells with the addition of a halohydrin
to the C3 position (24). Moreover, TUBag1, the natural Ag
that has an aldehyde group at the C4 position and lacks the C3-C4
double bond (10), has a 1000-fold higher specific activity
than isopentenyl pyrophosphate.
Consistent with our finding that monophosphate compounds had reduced
specific activity compared with pyrophosphate compounds (Table II
),
Belmant et al. also noted that alteration in the pyrophosphate moiety
abolished recognition; the activity of monophosphate compounds suggests
that the hydrolysis of the pyrophosphate moiety is not an absolute
requirement for V
2V
2 TCR recognition. Instead, the differences in
activity may reflect the ability of the V
2V
2 TCR to distinguish
between pyrophosphate and pyrophosphonate moieties. Nonhydrolyzable
analogs of prenyl pyrophosphates may inhibit recognition by binding to
a presenting element for these compounds, preventing the recognition of
the presenting element-nonpeptide Ag complex by the V
2V
2
TCR.
Ag specificity of the DBS43 V
2V
2 TCR transfectant is similar
to that of V
2V
2+ T cell clones
To determine whether factors other than the expression of the
V
2V
2 TCR affect fine Ag specificity, the V
2V
2 TCR
transfectant, DBS43, and the V
2V
2 T cell clone, CP.1.15, were
stimulated with various prenyl pyrophosphate analogs. Although the
DBS43 transfectant was less sensitive than the CP.1.15 T cell clone,
there were minimal differences in the relative potencies of different
analogs such that the hierarchy of phosphoantigen bioactivity did
not change. For example, isopentenyl pyrophosphate (IPP) was
11-fold more potent than dimethylallyl pyrophosphate (DMAPP) at
stimulating half-maximal IL-2 release by the DBS43 transfectant (130
µM for IPP vs 1400 µM for DMAPP; Fig. 3
). For the CP.1.15 T cell clone, IPP was
33-fold more stimulatory than DMAPP (half-maximal IL-2 release at 3
µM for IPP vs 100 µM for DMAPP). Similar differences were noted in
the half-maximal proliferative responses of the T cell clones, 12G12
(38-fold) and DG.SF68 (19-fold), when IPP and DMAPP were compared (Fig. 1
D). Thus, the relative potencies of different compounds are
determined primarily by the V
2V
2 TCR, although the Ag
concentration required for half-maximal stimulation can vary between
different V
2V
2 T cells.
|
2V
2
TCR
The recognition of nonpeptide Ags strictly correlates with the
expression of V
2 and V
2 gene segments (14, 22) and
is characterized by a polyclonal T cell expansion that does not require
prior antigenic exposure (5). Almost all adult V
2V
2
TCR use the J
1.2 junctional region, whereas many fetal V
2V
2 T
cells use other J
segments, suggesting that selection for this J
segment occurs during the expansion of the V
2V
2 T cell subset
during youth (25, 26). Moreover, the V
2V
2 TCR shows
conservation in the V
2 CDR3 length (98% of adult V
2V
2 TCR
have V
2 CDR3 lengths of ±1 of a modal value (27)),
conservation of the lysine residues in the J
1.2 junctional region,
and conservation of a hydrophobic residue in the V
2 CDR3 region
(14, 28). These findings suggested that the recognition of
prenyl pyrophosphates is mediated by germline-encoded elements of the
classical Ag binding region of the V
2V
2 TCR.
Further supporting this hypothesis, when TCR-
Jurkat cells were transfected with cDNAs encoding wild-type or mutant
V
2J
1.2C
chains and a V
2C
chain, we found that mutation
of the N-encoded region of the V
2J
1.2 CDR3 abolished
reactivity to both monoethyl phosphate and mycobacterial Ags (16, 22). Moreover, a V
2J
1.3V
2 TCR transfectant was unable
to respond to the prenyl pyrophosphate analog, monoethyl phosphate,
although it did respond to the pyrophosphomonoester from mycobacteria.
These two V
2 chains vary only in the CDR3 region, primarily in the
J
region, with the substitution of a lysine at position 110 for the
lysine residues at positions 108 and 109 (22).
Furthermore, many V
2V
2+ T cells expressing
the rare V
2J
1.3/2.3 rearrangement and a few
V
2V
2+ T cells expressing V
2J
1.2V
2
TCRs are unable to respond to nonpeptide Ags (14, 29).
These nonreactive 
T cells differ primarily in the V
2 CDR3
region, again suggesting that this region is involved in Ag
recognition.
Based on the TCR mutagenesis studies and the results reported here, we
propose the following model for the binding of prenyl pyrophosphates to
the V
2V
2 TCR. Homology modeling of the DBS43 V
2V
2 TCR
reveals that the amino groups of the positively charged lysine residues
at positions 108 and 109 are predicted to be solvent exposed and near
the amino group of a lysine at position 51 (or potentially the amino
group of an arginine at position 49) in the germline-encoded CDR2
region of the V
2 chain (Fig. 4
A). Positively charged amino
acids are commonly found in the binding site of proteins that bind
phosphate-containing compounds because they neutralize the negative
charges carried by phosphate moieties. When IPP or IPP-UMP is docked
into the V
2V
2 receptor, the Ags can be oriented at low energy,
such that the pyrophosphate moiety makes hydrogen bonds to the amino
groups of the lysines (Fig. 4
, BD). For nucleotide
conjugates, the nucleotide may project over the V
2 CDR2 region (Fig. 4
D). Longer carbon chain compounds, such as geranylgeranyl
pyrophosphate (four isoprenoid units), can fit into a hydrophobic
pocket formed between the V
2 CDR2 region and the V
2 CDR3 region
(Fig. 4
C). Alternatively, the carbon chain may bind to a
pocket in a putative Ag-presenting molecule for prenyl
pyrophosphates.
|
While prenyl pyrophosphates and analogs are expected to interact with
the CDR regions of V
2 and V
2, such interaction would probably not
be sufficient to activate 
T cells, much as free haptens do not
activate anti-hapten-specific B cells even with high affinity Ab
receptors. Instead, cross-linking and clustering of T cell and B cell
Ag receptors is required to reach critical signaling thresholds. With
such small molecules such as prenyl pyrophosphates, a protein or other
structure might be expected to play a presenting function similar to
that played by MHC or CD1 molecules (17). Such a
presenting molecule would allow multivalent interaction with the
V
2V
2 TCR that are required for T cell activation.
A better understanding of the structural features of prenyl pyrophosphates that determine their antigenicity may aid in the design of nonpeptide vaccines. Already, high potency synthetic Ags have been designed as well as blocking analogs (24). As substitutions are permitted in the distal portions of a triphosphate moiety, it may be possible to design phosphoantigens that are capped on the terminal triphosphate moiety, such as nucleotide-conjugated prenyl pyrophosphates, to prevent degradation by alkaline phosphatases. The development of nonpeptide phosphoantigen vaccines may allow us to vaccinate individuals to enhance their immunity to a number of different pathogens.
The recognition of nonpeptide Ags by the V
2V
2 TCR probably plays
important roles in human immunity to infection and to tumors by
controlling the early phases of the diseases.
V
2V
2+ T cells expand in response to many
different bacterial and protozoal pathogens to very high levels in the
peripheral blood (reviewed in Ref. 1).
V
2V
2+ T cells also recognize non-Hodgkins
B cell lymphomas (12). In monkeys, we have found that
V
2V
2+ T cells can expand up to 2530% of
peripheral blood T cells following Mycobacterium bovis
Calmette-Guérin bacillus infection, and these expansions
correlated with the resolution of active infection (Y. Shen et al.,
manuscript in preparation). Reinfection resulted in greater and earlier
expansions of V
2V
2+ T cells, providing
evidence for the adaptive nature of the response. Similar evidence for
enhancement of human V
2V
2+ T cell responses
has been obtained after immunization with M. bovis
Calmette-Guérin bacillus, suggesting that humans also mount
adaptive V
2V
2+ T cell responses
(30). Since 20% of normal adults do not mount responses
to prenyl pyrophosphate Ags in M. tuberculosis extracts
(5), prenyl pyrophosphate vaccines could lead to more
effective early human immunity to mycobacterial, bacterial, and
protozoal infections.
In conclusion, we find that T cells expressing the V
2V
2 TCR
recognize prenyl pyrophosphate compounds and their analogs. Recognition
is critically dependent on the structure of the proximal carbon chain
and the pyrophosphate moiety. Based on a model of the V
2V
2 TCR
and our data, we speculate that the CDR3 region of V
2 and the CDR2
regions of V
2 may contribute to part of the binding site for prenyl
pyrophosphate Ags.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Craig T. Morita, Division of Rheumatology, Department of Internal Medicine and the Interdisciplinary Group in Immunology, University of Iowa College of Medicine, EMRB 340F, Iowa City, IA 52242. E-mail address: craig-morita{at}uiowa.edu ![]()
3 Abbreviations used in this paper: OPP, pyrophosphate moiety; IPP, isopentenyl pyrophosphate; DMAPP, dimethylallyl pyrophosphate; NPE, 1-(2-nitrophenyl)ethyl; DMNPE, 1-(4,5-dimethoxy-2-nitrophenyl)ethyl; desyl, (1,2-diphenyl-2-oxo)ethyl. ![]()
Received for publication February 14, 2001. Accepted for publication April 24, 2001.
| References |
|---|
|
|
|---|

T cells: pattern recognition by the adaptive immune system. Springer Semin. Immunopathol. 22:191.[Medline]

T cells. Proc. Natl. Acad. Sci. USA 91:8175.
T cells. Nature 375:155.[Medline]

T cells recognize alkylamines derived from microbes, edible plants, and tea: implications for innate immunity. Immunity 11:57.[Medline]
2/V
2 subset in human mycobacteria-responsive T cells suggests germline gene encoded recognition. J. Immunol. 147:3360.[Abstract]

T cells reactive to Mycobacterium tuberculosis are encoded by specific V genes but diverse V-J junctions. J. Immunol. 147:3353.[Abstract]

T cells: SEA recognition site for human V
2 T cell receptors. Immunity 14:331.[Medline]

T cells by nonpeptidic mycobacterial ligands. Science 264:267.
T lymphocytes. Eur. J. Immunol. 26:2344.[Medline]

T cells. J. Biol. Chem. 274:32079.
T cells are related to phosphorylated antigens of mycobacteria. Infect. Immun. 64:2892.[Abstract]
9/V
2 T cells of a GroEL homolog on Daudi Burkitts lymphoma cells. Science 250:1269.
T cells induced by the tumour cell line RPMI 8226: functional heterogeneity of clonal populations and role of GroEL heat shock proteins. Scand. J. Immunol. 36:107.[Medline]

T cells and expression of V9JPC1
/V2DJC
-encoded T cell receptors. J. Immunol. 151:1214.[Abstract]
/
T cells. Eur. J. Immunol. 21:2999.[Medline]
2V
2 TCR-dependent recognition of non-peptide antigens and Daudi cells analyzed by TCR gene transfer. J. Immunol. 154:998.[Abstract]

T cells. Immunity 3:495.[Medline]

T cells: implications for innate immunity. J. Exp. Med. 191:937.
-type, subgroup I. Biol. Chem. Hoppe-Seyler 370:263.[Medline]
chain junctional region in prenyl pyrophosphate antigen recognition by 
T cells. J. Immunol. 161:286.
9-V
2 cells are stimulated in a cross-reactive fashion by a variety of phosphorylated metabolites. Eur. J. Immunol. 25:2052.[Medline]

T cells. FASEB J. 14:1669.
T cells at birth. J. Immunol. 153:3979.[Abstract]
/
repertoire. J. Exp. Med. 171:1597.
9-JP rearrangements in unstimulated human
/
T lymphocytes. Eur. J. Immunol. 22:2437.[Medline]

subset. Eur. J. Immunol. 23:804.[Medline]
/
T cells. J. Exp. Med. 173:1311.
T cell responsiveness to mycobacteria suggestive of a memory-like phenotype. J. Immunol. 161:1045.This article has been cited by other articles:
![]() |
P. Vantourout, J. Mookerjee-Basu, C. Rolland, F. Pont, H. Martin, C. Davrinche, L. O. Martinez, B. Perret, X. Collet, C. Perigaud, et al. Specific Requirements for V{gamma}9V{delta}2 T Cell Stimulation by a Natural Adenylated Phosphoantigen J. Immunol., September 15, 2009; 183(6): 3848 - 3857. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sarikonda, H. Wang, K.-J. Puan, X.-h. Liu, H. K. Lee, Y. Song, M. D. Distefano, E. Oldfield, G. D. Prestwich, and C. T. Morita Photoaffinity Antigens for Human {gamma}{delta} T Cells J. Immunol., December 1, 2008; 181(11): 7738 - 7750. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Spencer, G. Abate, A. Blazevic, and D. F. Hoft Only a Subset of Phosphoantigen-Responsive {gamma}9{delta}2 T Cells Mediate Protective Tuberculosis Immunity J. Immunol., October 1, 2008; 181(7): 4471 - 4484. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wei, D. Huang, X. Lai, M. Chen, W. Zhong, R. Wang, and Z. W. Chen Definition of APC Presentation of Phosphoantigen (E)-4-Hydroxy-3-methyl-but-2-enyl Pyrophosphate to V{gamma}2V{delta}2 TCR J. Immunol., October 1, 2008; 181(7): 4798 - 4806. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Aydintug, C. L. Roark, X. Yin, J. M. Wands, W. K. Born, and R. L. O'Brien Detection of Cell Surface Ligands for the {gamma}{delta} TCR Using Soluble TCRs J. Immunol., April 1, 2004; 172(7): 4167 - 4175. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamashita, Y. Tanaka, M. Harazaki, B. Mikami, and N. Minato Recognition mechanism of non-peptide antigens by human {gamma}{delta} T cells Int. Immunol., November 1, 2003; 15(11): 1301 - 1307. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Klimpel, M. A. Matthias, and J. M. Vinetz Leptospira interrogans Activation of Human Peripheral Blood Mononuclear Cells: Preferential Expansion of TCR{gamma}{delta}+ T Cells vs TCR{alpha}{beta}+ T Cells J. Immunol., August 1, 2003; 171(3): 1447 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, H. K. Lee, J. F. Bukowski, H. Li, R. A. Mariuzza, Z. W. Chen, K.-H. Nam, and C. T. Morita Conservation of Nonpeptide Antigen Recognition by Rhesus Monkey V{gamma}2V{delta}2 T Cells J. Immunol., April 1, 2003; 170(7): 3696 - 3706. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hebart, C. Bollinger, P. Fisch, J. Sarfati, C. Meisner, M. Baur, J. Loeffler, M. Monod, J.-P. Latge, and H. Einsele Analysis of T-cell responses to Aspergillus fumigatus antigens in healthy individuals and patients with hematologic malignancies Blood, December 15, 2002; 100(13): 4521 - 4528. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Grigoriadou, L. Boucontet, and P. Pereira T Cell Receptor-{gamma} Allele-Specific Selection of V{gamma}1/V{delta}4 Cells in the Intestinal Epithelium J. Immunol., October 1, 2002; 169(7): 3736 - 3743. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Rojas, M. Torres, J.-J. Fournie, C. V. Harding, and W. H. Boom Phosphoantigen Presentation by Macrophages to Mycobacterium tuberculosis-Reactive V{gamma}9V{delta}2+ T Cells: Modulation by Chloroquine Infect. Immun., August 1, 2002; 70(8): 4019 - 4027. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |