HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bendall, H. H. Articles by Oltz, E. M. Search for Related Content PubMed PubMed Citation Articles by Bendall, H. H. Articles by Oltz, E. M.

Transcription Factor NF-B Regulates Ig Light Chain Gene Rearrangement¹

Department of Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
The tissue- and stage-specific assembly of Ig and TCR genes is mediated by a common V(D)J recombinase complex in precursor lymphocytes. Directed alterations in the accessibility of V, D, and J gene segments target the recombinase to specific Ag receptor loci. Accessibility within a given locus is regulated by the functional interaction of transcription factors with cognate enhancer elements and correlates with the transcriptional activity of unrearranged gene segments. As demonstrated in our prior studies, rearrangement of the Ig locus is regulated by the inducible transcription factor NF-B. In contrast to the Ig locus, known transcriptional control elements in the Ig locus lack functional NF-B binding sites. Consistent with this observation, the expression of assembled Ig genes in mature B cells has been shown to be NF-B independent. Nonetheless, we now show that specific repression of NF-B inhibits germline transcription and recombination of Ig gene segments in precursor B cells. Molecular analyses indicate that the block in NF-B impairs Ig rearrangement at the level of recombinase accessibility. In contrast, the activities of known Ig promoter and enhancer elements are unaffected in the same cellular background. These findings expand the range of NF-B action in precursor B cells beyond Ig to include the control of recombinational accessibility at both L chain loci. Moreover, our results strongly suggest the existence of a novel Ig regulatory element that is either directly or indirectly activated by NF-B during the early stages of B cell development.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Precursor lymphocytes generate functional Ig and TCR genes via a program of DNA recombination involving large arrays of V, D, and J gene segments. The lymphoid-specific components of V(D)J recombinase, recombination-activating genes (RAG)³-1 and RAG-2, initiate recombination by generating double-strand breaks at recombination signal sequences (RSSs) that flank all Ag receptor gene segments (1, 2). RAG-mediated cleavage produces two distinct intermediates, termed coding ends (CEs) and signal ends (SEs), which are differentially processed before their resolution by ubiquitous DNA repair enzymes. In general, SEs are ligated with few modifications to produce flush, extrachromosomal signal joins. In contrast, nucleotides are randomly added to or deleted from CEs to further diversify chromosomal coding joins (3).

Despite the action of a common recombinase on highly conserved RSSs, the assembly of individual Ag receptor genes occurs in a stage- and tissue-specific manner. Prior studies have demonstrated that substrate specificity is imposed on the recombination process by modulating the accessibility of gene segment clusters within Ig and TCR loci (4, 5). In the vast majority of cases, recombinational accessibility of a given gene segment correlates temporally with its transcriptional status in vivo (4, 5, 6). Consistent with a causal relationship between these two processes, transcriptional promoter and enhancer activities are required for the efficient rearrangement of chromosomal gene segments in cis (5, 6, 7). In precursor lymphocytes, fluctuations in the activity of transcription factors that target promoter/enhancer elements likely play a major role in the developmental control of Ig and TCR locus accessibility (5, 8). The precise molecular mechanisms by which cis-acting elements regulate accessibility remain elusive. However, recent studies indicate that directed alterations in the chromatin associated with gene segment clusters act to relieve nucleosome-mediated repression of RSS cleavage by the RAG proteins (9, 10).

In the B lymphocyte lineage, pro-B cells must first rearrange a functional IgH gene before recombination of the Ig locus at the pre-B cell stage (11). In pre-B cell models, the onset of J germline transcription and VJ rearrangement requires the induction of transcription factor NF-B (12), which binds to a consensus site in the Ig intronic enhancer (iE). Individual pre-B clones that fail to generate an in-frame VJ coding join subsequently initiate rearrangement of the second L chain locus, Ig (11). Relative to Ig, little is known about the transcription factors and DNA elements that regulate recombination of Ig gene segments. Two nearly identical Ig enhancers (E3-1 and E2-4), which are active in mature B and plasma cells, require binding by the PU.1/IFN regulatory factor-4 transcription factor complex (13). Importantly, E3-1 and E2-4 function in an NF-B-independent manner in these late-stage cells (14).

During the course of our studies on Ig regulation (12), we discovered that cells defective for NF-B signaling also were affected at the Ig locus. Consistent with this initial observation, we now demonstrate that the NF-B signaling pathway is required to induce germline transcription and recombination of all murine V and J gene segments. In contrast, the activities of known Ig regulatory elements are unaffected in NF-B-arrested cells. These findings highlight a novel mechanism by which NF-B acts as a global regulator of Ig L chain (IgL) gene assembly in precursor B cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell lines and culture

The 103/BCL-2/4 pre-B cell line is conditionally transformed with a temperature-sensitive (ts) mutant of the v-abl oncogene (15, 16). Stable transfectants of ts-abl expressing a dominant inhibitor of NF-B, termed IBN (N.1, N.7), and a control line expressing the histidinol resistance gene (WT.24) have been described previously (12). Cells were routinely propagated at 34°C in RPMI 1640 supplemented with 10% FCS, 50 µM 2-ME, and 0.01% penicillin-streptomycin. Inactivation of v-abl was achieved by incubation at the nonpermissive temperature (38.5°C) for either 24 or 48 h.

DNA PCR

Relative levels of VJ and VJ coding joins and total DNA content (C) were assessed by semiquantitative PCR in 25-µl reactions containing 200 ng genomic DNA, 10 mM Tris (pH 8.3), 1 µg/ml BSA, 200 µM dNTPs, Taq polymerase (1 U), and 25 ng of each primer. Amplifications were performed as follows: 94°C (1 min), 60°C (C) or 52°C (VJ, VJ) for 1 min, and 72°C (1.5 min) for either 24 (C) or 28 cycles (VJ, VJ). All PCR products were separated on 2% agarose gels and transferred to ZetaProbe membranes (Bio-Rad, Richmond, CA) for hybridization with the appropriate radiolabeled probes.

For V and J SEs, 2.5 x 10⁶ cells were cultured at the permissive or nonpermissive temperature for 24 or 48 h. Linker-ligated DNA plugs were prepared as described previously (17). SE assays were performed on 3 µl of molten plugs (95°C, 10 min) in 25-µl reaction mixtures as described for the coding joins assays, except that reactions were incubated at 72°C (5 min) before the addition of Taq polymerase (1 U). The 12-cycle amplifications consisted of 1 min at 92°C, 1 min at 52°C, and 1.5 min at 72°C. An aliquot of the primary PCR (2 µl) then was amplified for 28 cycles under the same conditions, but with a nested primer.

RT-PCR analyses

Total cellular RNA (3 µg) was treated with RNase-free DNase I (Promega, Madison, WI) and subjected to reverse transcription with random hexamer primers. To discount genomic DNA contamination, all PCR assays included controls lacking reverse transcriptase. Samples were normalized for cDNA input using a separate PCR specific for -actin cDNA sequences. PCR amplifications were performed as follows: 94°C (1 min), 58°C (-actin), 50°C (V1, V2, V), or 48°C (J1, J2/3) for 1 min, and 72°C (1.5 min) for either 24 (-actin) or 28 cycles (IgL germline transcripts).

PCR primers and probes

Oligonucleotide primers for PCR and Southern blot probes were as follows: VJ2 coding joins: primers V(S) (GGCTGCAGSTTCAGTGGAAGTGGGTC) and 3'J2 (GTGAACAAGAGTTGAGAAGAC), probe J2 cod (TTCGGAGGGGGGACCAAGCTGG); VJ coding joins: primers VR1 (ATGAATTCACTGGTCTAATAGGTGGTACCA) and JR1 (TAGAATTCACTYACCTAGGACAG), probes VR (CTGTGCTCTATGGTACAGCACCC), V1CP (GGATGAGGCAATAT), V2CP (GATGATGCAATGTAT), J1CP (TTGGTGTTCTGGTGG), J2CP (TATGTTTTCGGCGGT), and J3CP (TTTATTTTCGGCAGT); C control: primers 5'C (CAGAATTCACCTTCCYCTGARGAG) and 3'C (GAGTCGACARACTCTTCTCCA), probe CP (TACGAGAACGACAGTCCCAG); V1 SEs: primers BW-1H (CCGGGAGATCTGAATTCCAC), 3'V1-1 (GGTTCTCTTCTCAATG), and 3'V1-2 (TATGTTGTGCCAAGTTGG), probe 3'V1P (AAGTGGTAGTTATGAGACTGT); V2 SEs: primers BW-1H, 3'V2-1 (GTTGATAAACAAAGCTTGTC), and 3'V2-2 (ATCAAGGCATAATTATTATAC), probe 3'V2P (AGAAGATGGTAGTGAGACTG); V SE control: primers VR1 (ATGAATTCACTGGTCTAATAGGTGGTACCA) and 3'V1-2, probe VP (GTGTAGATGGGGAAGTAGA); J2/3 SEs: primers BW-1H, 5'J2/3-1 (TACCACCCACTKCWWS), and 5'J2/3-2 (AGGTCAYAGCTCCACC), probes J2SE (ACCAGGTGCTGGCCCCATAGG) and J3SE (CCCAGGTGCTTGCCCCACAGG); J2/3 SE control: primers JR1 and 3'J2/3-2 (AGGTCAYAGCTCCACC), probe J2/3P (GGTTGGGTTTYAGTCA); V1 RT-PCR: primers VB (CACTTATACTCTCTCTCCTGG) and VR, probes V1CP or V2CP; V RT-PCR: primers VB (GACATTCAGCTGACCCAGTCTCCA) and VRT (GGCCCGGGTTTWTGTTMWGRBYGTAKCACAGTG), probe VR (GTYCCWGAYCCACTGCCACTGAASC); J1 RT-PCR: primers 5'J1-2 (GATCTTTCAGTGATGTA) and JR1, probe J1CP; J2 RT-PCR: primers 5'J2/3-2 and JR1, probe J2CP; -actin RT-PCR: primers 5' -actin (AGAGCTATGAGCTGCCTGACGGCC) and 3' -actin (AGTAATCTCCTTCTGCATCCTGTC), probe 450-bp cDNA amplification product of the 5'-actin and 3' -actin primers.

Reporter gene assays

The ts-abl clones (5 x 10⁵ cells/transfection) were resuspended in 0.8 ml serum-free medium and transfected transiently with a 0.2-ml mixture containing 12.5 µl of Lipofectin (Life Technologies, Rockville, MD), luciferase plasmid (2.5 µg), and a control Renilla plasmid (0.5 µg, pRL-TK; Promega). Samples were cultured at 34°C for 5 h, washed in serum-free medium, and resuspended in complete medium. Subsequently, one-third of the transfected cells were cultured at the permissive temperature, and the remaining two-thirds were incubated at the nonpermissive temperature for 22 h. Firefly and Renilla luciferase activities were measured in protein extracts (25 µg) with a dual assay kit (Promega). The pV and pVE constructs contain the V2 promoter alone (14) or together with E2-4 (14) in the BamHI site of the pGL2 basic plasmid (Promega). The 6xB plasmid contains six B binding sites located upstream of a minimal thymidine kinase promoter in pGL2-basic plasmid (18).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
NF-B regulates Ig gene rearrangement

To investigate the transcriptional mechanisms that control IgL gene assembly, we have used a conditionally transformed pre-B cell model that closely mimics the physiology of primary pre-B cells. Inactivation of the temperature-sensitive v-abl oncogene in these cells (ts-abl cells) induces levels of RAG gene expression, NF-B, and IgL rearrangement that are comparable to those observed in vivo (12, 15, 16). We generated transfectants of the ts-abl line that stably express a mutant form of the NF-B inhibitory protein IB, termed IBN. This transdominant inhibitor is resistant to signal-dependent proteolysis and blocks nuclear translocation of NF-B complexes containing the transactivating subunits c-Rel and RelA (12). In prior studies, we found that inhibition of the NF-B signaling pathway in ts-abl cells blocked germline J transcription and VJ rearrangement, presumably by interfering with iE function (12).

Unlike the Ig locus, which contains 100 V gene segments that randomly rearrange with four functional J elements, the murine Ig locus primarily uses two V gene segments, V1 and V2 (19). In cells that fail to express functional Ig protein, V segments rearrange preferentially to their most proximal set of J-C clusters (refer to diagram of the Ig locus in Fig. 1A). Prior studies had shown that Ig enhancers lack B sites and function in plasma cells that are deficient for nuclear NF-B (14). Therefore, we expected that levels of Ig rearrangements would be unaffected in ts-abl cells expressing a dominant repressor of NF-B signaling. To quantify Ig rearrangements in control ts-abl cells (103 and WT.24 transfectant lacking IBN) and two IBN expressing clones (N.1 and N.7), we used a set of degenerate PCR primers that amplify all VJ coding joins with equal efficiency. Surprisingly, inactivation of v-abl in control cells induced levels of VJ rearrangement at 48 h that were at least 5- to 10-fold greater than those observed for NF-B-defective clones (Fig. 1B, top, lanes 3, 6, 9, and 12). Recombinase activity was unaffected in IBN clones as judged by RAG-1/2 expression and rearrangement of extrachromosomal substrates (12). Similar decreases in VJ rearrangement were observed when cells cultured at the nonpermissive temperature were sorted for viability before DNA extraction (data not shown). Thus, IBN-expressing cells in the process of VJ or VJ recombination are not subject to significant negative selection during the 48 h of v-abl inactivation.

View larger version (30K): [in this window] [in a new window]   FIGURE 1. IBN inhibits VJ and VJ rearrangement. A, Schematic structure of the murine Ig locus. Boxes represent coding sequences, triangles depict RSSs, and dashed lines indicate the predominant V to J rearrangement events observed in murine B cells (J4 is a pseudogene segment lacking a consensus RS and the Vx gene segment rarely rearranges). B, PCR analyses of VJ (middle) and VJ coding joins (top). Genomic DNAs from the 103-BCL-2/4 pre-B cell line (103), transfectants expressing IBN (N.1 and N.7), or a control transfectant lacking IBN (WT.24) were cultured at permissive (P) or nonpermissive (N) temperatures for 24 (N24) or 48 h (N48). Rearrangement levels were analyzed with degenerate PCR primers that recognize all V or J gene segments (see Materials and Methods). The linearity of each PCR assay was confirmed with serial dilutions of the 103/N48 sample (lanes 12–14), and control reactions were performed without input genomic DNA (). A PCR assay specific for the C coding exon was used to assess relative amounts of input DNA (bottom). C, Genomic DNA samples were amplified as in B. Resultant PCR products were analyzed by Southern blotting with oligonucleotide probes specific for V1 or V2. The specificity of the probes was verified with DNA samples from sequenced V1J1 (V1) or V2J2 (V2) coding joins (right).

c-Rel and RelA are required for efficient generation of V and J SEs

The repressive effects of IBN on VJ rearrangement in pre-B cells might occur at two distinct levels—accessibility of Ig gene segments or efficient resolution of V and J CEs by DNA repair complexes (20). To examine whether Ig accessibility is regulated by NF-B, levels of RAG-mediated cleavage were monitored with ligation-mediated PCR (LM-PCR) assays that specifically detect V or J SEs (17). As shown in Fig. 2, the kinetics of SE appearance for all Ig gene segments was similar to that observed for coding joins. High levels of SEs accumulated only after 24–48 h of culturing at the nonpermissive temperature (lanes 7–12). Importantly, IBN-expressing clones exhibited a 5- to 10-fold reduction in all V and J SEs when compared with the control clones (Fig. 2, A and B). Our prior studies of extrachromosomal substrates showed that recombination of accessible RSSs is unaffected by IBN (12). Together with the data presented in Fig. 2, these findings strongly suggest that NF-B is required for RAG-mediated cleavage of Ig gene segments, the initial step of VJ rearrangement.

View larger version (20K): [in this window] [in a new window]   FIGURE 2. IBN reduces V and J SE formation. A, The indicated ts-abl transfectants were cultured at the permissive (P) or nonpermissive (N) temperature for 24 (N24) or 48 h (N48). Agarose-embedded cells were assayed for V1 (top) or V2 (middle) SEs with nested LM-PCR techniques as described previously (17 ). The identity of each SE (right) was verified by comigration with products specifically amplified in bone marrow DNA samples (data not shown). The linearity of each LM-PCR assay was confirmed with serial dilutions of the 103/N48 sample (lanes 13–15). Levels of input DNA were assessed with primers that amplify sequences within the V2 coding region (CTRL, bottom). B, Samples in A were amplified by LM-PCR methods that specifically detect J2 (top) or J3 SEs (middle). Control assays for input DNA amplify J2 coding sequences (CTRL, bottom).

Ig germline transcription is repressed in Rel-deficient pre-B cells

Current evidence suggests that Ag receptor loci are activated for rearrangement via the binding of developmentally regulated transcription factors to Ig and TCR enhancers (21). In turn, functional enhancers direct germline transcription of linked gene segments, which is likely required for their accessibility. Consistent with this regulatory model, we have demonstrated previously a requirement for c-Rel/RelA in the activation of J-C germline transcription and rearrangement in ts-abl cells (12). To investigate accessibility mechanisms at the Ig locus, we designed a series of semiquantitative RT-PCR assays that are specific for transcripts derived from unrearranged Ig gene segments. Initially, total cDNA was prepared from each ts-abl clone cultured at the permissive and nonpermissive temperatures. Subsequent to PCR amplification, germline transcripts were detected with oligonucleotide probes specific for the J1 or J2 gene segments, which reside in separate Ig cassettes. As shown in Fig. 3A, levels of germline J transcripts were significantly reduced in IBN-expressing pre-B cells cultured at the nonpermissive temperature.

View larger version (45K): [in this window] [in a new window]   FIGURE 3. NF-B regulates Ig germline transcription. A, Total RNA from the indicated ts-abl transfectants propagated 24 h at the indicated temperatures were subjected to RT-PCR assays with primer combinations that amplify germline J gene segments. PCR products were blotted and probed with oligonucleotides specific for J1 (top) or J2 coding sequences (middle). Relative levels of input cDNA were measured by an RT-PCR assay for -actin transcripts (bottom). The linearity of each assay was demonstrated by serial dilutions of the 103/N cDNA (lanes 9–11). B, Quantitation of RT-PCR assays for germline IgL transcripts. Each bar represents the amount of signal from indicated germline transcription assays (phosphor imager; Fuji) normalized for levels of -actin signal in each sample. Data from a representative experiment are shown from control (WT) and IBN-expressing clones (N) incubated at either the permissive () or the nonpermissive () temperature for 24 h. The maximum normalized signal in each assay was standardized to the value of 1.0 in each data set.

Ig promoter and enhancer activities are unaffected by IBN

Prior DNA sequence analyses provide no evidence for the presence of NF-B binding sites in the known Ig enhancers (E3-1 and E2-4). Moreover, both Ig enhancers are fully functional in a plasma cell line that lacks nuclear NF-B (14). However, it remained possible that NF-B regulates E function via an indirect mechanism in earlier stages of B cell development. In this regard, we have shown that NF-B controls the inducible expression of Oct-2, a B lineage-specific transcription factor that binds to critical sites in all Ig promoters (22). To test the possibility that NF-B regulates known Ig elements in ts-abl cells, we monitored the activity of E2-4 and the V2 promoter (PV) with a series of luciferase reporter genes. As expected, luciferase expression from a control construct driven by a hexamer of NF-B sites was severely impaired in IBN clones cultured at the nonpermissive temperature (Fig. 4). In contrast, the function of both PV and E was similar in the IBN and control cells. These data are in keeping with the prior finding that E activity is NF-B-independent in mature B cell lines (14). Collectively, our results strongly suggest that Ig germline transcription and recombinational accessibility are regulated independently of E function in pre-B lymphocytes.

View larger version (23K): [in this window] [in a new window]   FIGURE 4. PV and E activities are NF-B-independent in ts-abl pre-B cells. Control ts-abl cells (WT and WT.24, ) and an IBN-expressing clone (N.7, ) were transfected with luciferase reporter constructs driven by either a hexamer of NF-B binding sites (6xB), the V2 promoter (pV), or PV2 in conjunction with the E2-4 enhancer (pVE). Cells were cotransfected with a control plasmid encoding Renilla luciferase and were maintained at the nonpermissive temperature for 22 h. Protein extracts (25 µg) were assayed for firefly and Renilla luciferase activities by standard methods. Results from a representative experiment are reported as relative light units (RLU) for firefly luciferase and are normalized for Renilla luciferase activity.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

What is the mechanism by which NF-B exerts global control over the Ig locus in pre-B cells? Our functional data (Fig. 4) exclude the possibility that the core V promoter (PV) or E elements are regulated either directly or indirectly by NF-B in extrachromosomal vectors. However, V germline transcription is clearly inhibited in the NF-B-arrested cells, whereas V germline transcription is unaffected (Fig. 3). Therefore, it seems likely that endogenous PV function is potentiated in a chromosomal context by unidentified element(s) that respond to the NF-B signaling pathway in ts-abl cells. Similarly, NF-B may control the activities of J germline promoters. Emerging studies have identified the presence of JC germline transcripts in pre-B cells (24), but the location and functional architecture of the putative J promoters remain unknown. Given the results from germline transcription assays (Fig. 3), it is tempting to speculate that these promoter elements may be either directly or indirectly regulated by NF-B. Resolution of these important issues awaits identification of the precise regulatory sequences within the Ig locus that are NF-B-responsive in pre-B cells.

In summary, our findings support a model for Ig activation that is highly reminiscent of the mechanisms that regulate Ig activation. Both L chain loci require c-Rel and RelA for initiation of V-J rearrangement and for J-C germline transcription. During Ig activation, NF-B is thought to function primarily via binding to its cognate site in iE (25). Mouse knockout studies indicate that iE is critical for mediating VJ rearrangement in pre-B cells (26). In contrast, the distal 3'E is NF-B-independent and plays a dominant role in constitutive expression of rearranged Ig genes in mature B cells (27). Likewise, the distal Ig enhancers (E2-4 and E3-1), which are NF-B-independent, are likely to be the major regulators of Ig expression in mature B cell subsets (13). By analogy to iE, unidentified NF-B-dependent elements may control initial locus activation in pre-B cells. In both the ts-abl system and a second pre-B cell model (24), the kinetics of Ig germline transcription and rearrangement (24–48 h) are delayed relative to Ig (12–24 h, data not shown). Because activation of NF-B in pre-B cells induces Ig gene assembly by its direct binding to iE, these kinetic data suggest that efficient VJ rearrangement may require the prior induction of other transcription factors by NF-B (e.g., Oct-2). Thus, indirect regulation of a novel Ig element by NF-B may provide an attractive explanation for the temporal order of L chain gene assembly in pre-B cells.

	Acknowledgments

 
We thank Michelle Rohling for technical assistance, Ursula Storb (University of Chicago, Chicago, IL) for PV/E fragments, Larry Kerr for the 6xB construct, and D. Ballard and W. Khan (Vanderbilt University, Nashville, TN) for valuable comments.

	Footnotes

 
¹ This work is supported by National Institutes of Health Grants AI36944 and AI01412 (to E.M.O.) and a National Cancer Institute predoctoral training grant (to H.H.B.).

² Address correspondence and reprint requests to Dr. Eugene M. Oltz, Department of Microbiology and Immunology, Vanderbilt University School of Medicine, A-4203 Medical Center North, Nashville, TN 37232-2363. E-mail address: oltzem{at}ctrvax.vanderbilt.edu

³ Abbreviations used in this paper: RAG, recombination-activating gene; RSS, recombination signal sequence; CE, coding end; SE, signal end; iE, Ig intronic enhancer; LM-PCR, ligation-mediated PCR; ts, temperature sensitive.

Received for publication February 9, 2001. Accepted for publication April 18, 2001.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Eastman, Q. M., T. M. Leu, D. G. Schatz. 1996. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature 380:85.[Medline]
2. van Gent, D. C., D. A. Ramsden, M. Gellert. 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Cell 85:107.[Medline]
3. Bogue, M., D. B. Roth. 1996. Mechanism of V(D)J recombination. Curr. Opin. Immunol. 8:175.[Medline]
4. Stanhope-Baker, P., K. M. Hudson, A. L. Shaffer, A. Constantinescu, M. S. Schlissel. 1996. Cell type-specific chromatin structure determines the targeting of V(D)J recombinase activity in vitro. Cell 85:887.[Medline]
5. Sleckman, B. P., J. R. Gorman, F. W. Alt. 1996. Accessibility control of antigen-receptor variable-region gene assembly: role of cis-acting elements. Annu. Rev. Immunol. 14:459.[Medline]
6. Sikes, M. L., C. C. Suarez, E. M. Oltz. 1999. Regulation of V(D)J recombination by transcriptional promoters. Mol. Cell. Biol. 19:2773.[Abstract/Free Full Text]
7. Whitehurst, C. E., S. Chattopadhyay, J. Chen. 1999. Control of V(D)J recombinational accessibility of the D1 gene segment at the TCR locus by a germline promoter. Immunity 10:313.[Medline]
8. Glimcher, L. H., H. Singh. 1999. Transcription factors in lymphocyte development T and B cells get together. Cell 96:13.[Medline]
9. McMurry, M. T., M. S. Krangel. 2000. A role for histone acetylation in the developmental regulation of VDJ recombination. Science 287:495.[Abstract/Free Full Text]
10. Kwon, J., K. B. Morshead, J. R. Guyon, R. E. Kingston, M. A. Oettinger. 2000. Histone acetylation and hSWI/SNF remodeling act in concert to stimulate V(D)J cleavage of nucleosomal DNA. Mol. Cell 6:1037.[Medline]
11. Yamagami, T., E. ten Boekel, C. Schaniel, J. Andersson, A. Rolink, F. Melchers. 1999. Four of five RAG-expressing JC^-/- small pre-BII cells have no L chain gene rearrangements: detection by high-efficiency single cell PCR. Immunity 11:309.[Medline]
12. Scherer, D. C., J. A. Brockman, H. H. Bendall, G. M. Zhang, D. W. Ballard, E. M. Oltz. 1996. Corepression of RelA and c-rel inhibits immunoglobulin gene transcription and rearrangement in precursor B lymphocytes. Immunity 5:563.[Medline]
13. Brass, A. L., A. Q. Zhu, H. Singh. 1999. Assembly requirements of PU.1-Pip (IRF-4) activator complexes: inhibiting function in vivo using fused dimers. EMBO J. 18:977.[Medline]
14. Hagman, J., C. M. Rudin, D. Haasch, D. Chaplin, U. Storb. 1990. A novel enhancer in the immunoglobulin locus is duplicated and functionally independent of NF-B. Genes Dev. 4:978.[Abstract/Free Full Text]
15. Klug, C. A., S. J. Gerety, P. C. Shah, Y. Y. Chen, N. R. Rice, N. Rosenberg, H. Singh. 1994. The v-abl tyrosine kinase negatively regulates NF-B/Rel factors and blocks gene transcription in pre-B lymphocytes. Genes Dev. 8:678.[Abstract/Free Full Text]
16. Chen, Y. Y., L. C. Wang, M. S. Huang, N. Rosenberg. 1994. An active v-abl protein tyrosine kinase blocks immunoglobulin light-chain gene rearrangement. Genes Dev. 8:688.[Abstract/Free Full Text]
17. Schlissel, M. S.. 1998. Structure of nonhairpin coding-end DNA breaks in cells undergoing V(D)J recombination. Mol. Cell. Biol. 18:2029.[Abstract/Free Full Text]
18. Inoue, J., L. D. Kerr, L. J. Ransone, E. Bengal, T. Hunter, I. M. Verma. 1991. c-rel activates but v-rel suppresses transcription from B sites. Proc. Natl. Acad. Sci. USA 88:3715.[Abstract/Free Full Text]
19. Reilly, E. B., B. Blomberg, T. Imanishi-Kari, S. Tonegawa, H. N. Eisen. 1984. Restricted association of V and J-C gene segments for mouse chains. Proc. Natl. Acad. Sci. USA 81:2484.[Abstract/Free Full Text]
20. Hempel, W. M., P. Stanhope-Baker, N. Mathieu, F. Huang, M. S. Schlissel, P. Ferrier. 1998. Enhancer control of V(D)J recombination at the TCR locus: differential effects on DNA cleavage and joining. Genes Dev. 12:2305.[Abstract/Free Full Text]
21. Lauzurica, P., X. P. Zhong, M. S. Krangel, J. L. Roberts. 1997. Regulation of T cell receptor gene rearrangement by CBF/PEBP2. J. Exp. Med. 185:1193.[Abstract/Free Full Text]
22. Bendall, H. H., D. C. Scherer, C. R. Edson, D. W. Ballard, E. M. Oltz. 1997. Transcription factor NF-B regulates inducible Oct-2 gene expression in precursor B lymphocytes. J. Biol. Chem. 272:28826.[Abstract/Free Full Text]
23. Bailey, S. N., N. Rosenberg. 1997. Assessing the pathogenic potential of the V(D)J recombinase by interlocus immunoglobulin light-chain gene rearrangement. Mol. Cell. Biol. 17:887.[Abstract]
24. Engel, H., A. Rolink, S. Weiss. 1999. B cells are programmed to activate and for rearrangement at consecutive developmental stages. Eur. J. Immunol. 29:2167.[Medline]
25. Sen, R., D. Baltimore. 1986. Inducibility of immunoglobulin enhancer-binding protein NF-B by a posttranslational mechanism. Cell 47:921.[Medline]
26. Xu, Y., L. Davidson, F. W. Alt, D. Baltimore. 1996. Deletion of the Ig light chain intronic enhancer/matrix attachment region impairs but does not abolish VJ rearrangement. Immunity 4:377.[Medline]
27. Gorman, J. R., N. van der Stoep, R. Monroe, M. Cogne, L. Davidson, F. W. Alt. 1996. The Ig enhancer influences the ratio of Ig versus Ig B lymphocytes. Immunity 5:241.[Medline]

This article has been cited by other articles:

				E. J. Cadera, F. Wan, R. H. Amin, H. Nolla, M. J. Lenardo, and M. S. Schlissel NF-{kappa}B activity marks cells engaged in receptor editing J. Exp. Med., August 3, 2009; 206(8): 1803 - 1816. [Abstract] [Full Text] [PDF]

				L. R. Thomas, H. Miyashita, R. M. Cobb, S. Pierce, M. Tachibana, E. Hobeika, M. Reth, Y. Shinkai, and E. M. Oltz Functional Analysis of Histone Methyltransferase G9a in B and T Lymphocytes J. Immunol., July 1, 2008; 181(1): 485 - 493. [Abstract] [Full Text] [PDF]

				M. M. Souto-Carneiro, R. Fritsch, N. Sepulveda, M. J. Lagareiro, N. Morgado, N. S. Longo, and P. E. Lipsky The NF-{kappa}B Canonical Pathway Is Involved in the Control of the Exonucleolytic Processing of Coding Ends during V(D)J Recombination J. Immunol., January 15, 2008; 180(2): 1040 - 1049. [Abstract] [Full Text] [PDF]

				R. Martone, G. Euskirchen, P. Bertone, S. Hartman, T. E. Royce, N. M. Luscombe, J. L. Rinn, F. K. Nelson, P. Miller, M. Gerstein, et al. Distribution of NF-{kappa}B-binding sites across human chromosome 22 PNAS, October 14, 2003; 100(21): 12247 - 12252. [Abstract] [Full Text] [PDF]

				L. G. Cowell, M. Davila, K. Yang, T. B. Kepler, and G. Kelsoe Prospective Estimation of Recombination Signal Efficiency and Identification of Functional Cryptic Signals in the Genome by Statistical Modeling J. Exp. Med., January 20, 2003; 197(2): 207 - 220. [Abstract] [Full Text] [PDF]

				M. L. Sikes, A. Meade, R. Tripathi, M. S. Krangel, and E. M. Oltz Regulation of V(D)J recombination: A dominant role for promoter positioning in gene segment accessibility PNAS, September 17, 2002; 99(19): 12309 - 12314. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bendall, H. H. Articles by Oltz, E. M. Search for Related Content PubMed PubMed Citation Articles by Bendall, H. H. Articles by Oltz, E. M.