|
|
||||||||


*
Department of Dermatology, Kansai Medical University, Moriguchi, Japan;
Department of Molecular Behavioral Biology, Osaka Bioscience Institute, Osaka, Japan; and
Institute for Molecular and Cellular Biology, Osaka University, Osaka, Japan
| Abstract |
|---|
|
|
|---|
in the skin of XPA mice. Treatment
with indomethacin, a potent inhibitor of PG biosynthesis, inhibited
DMBA-induced inflammation and local immunosuppression. In XPA mice,
increased serum IL-10 was detected after DMBA treatment. Excess
production of PGE2, TNF-
, and IL-10 after DMBA
application may be involved in the enhanced local and systemic
immunosuppression in DMBA-treated XPA mice. Susceptibility to
DMBA-induced skin tumors in XPA mice may be due to easy impairment of
the immune system by DMBA in addition to a defect in the repair of
DMBA-DNA adduct. Enhanced immunosuppression by chemical carcinogens as
well as the mutagenicity of these mutagens might be associated with the
high incidence of internal malignancies seen in XP patients. Moreover,
these results supported the hypothesis that persistent DNA damage is a
trigger for the production of immunoregulatory
cytokines. | Introduction |
|---|
|
|
|---|
UVB radiation not only acts as a carcinogen, but also induces specific
suppression within the cutaneous immune system (6, 7). The
immunosuppressive effects of UVB, as well as its mutagenic properties,
may contribute to the mechanisms of sunlight-induced skin cancer
(6, 7, 8). We have already studied the effects of UVB on the
immunologic function of XPA mice. Although contact hypersensitivity
(CHS) was induced equally in XPA and wild-type mice, there was a
greater impairment of sensitization through UVB-irradiated skin in XPA
mice than in wild-type mice. Moreover, irradiation of XPA mice with UVB
greatly suppressed CHS systemically, i.e., when a sensitizer was
applied to a site that had not been irradiated (5). A high
incidence of UVB-induced skin cancer in XPA mice may be mainly due to a
defect in the repair of UVB-induced DNA lesions of cutaneous cells.
Moreover, the enhancement of UVB-induced local and systemic
immunosuppression in XPA mice could be involved in the high incidence
of skin cancer in XP. Although not completely delineated, several
mechanisms have been implicated to explain these immunosuppressive
effects of UVB. UVB directly impairs the activity of APCs in the skin.
It also increases the production of cytokines or soluble factors with
immunomodulatory activity, including cis urocanic acid
(9), TNF-
(10), IL-4 and IL-10
(11), and PGE2 (12).
Among them, PGE2 is also known to be an
inflammatory mediator. We have reported that the amount of
PGE2 significantly increased after UVB radiation
in XPA mice in contrast to that in wild-type mice (13).
This result suggested that the increased PGE2
production may be involved in the enhancement of inflammation and
immunosuppression caused by UVB radiation in XPA mice.
As in the case of UVB radiation, certain chemical carcinogens, such as dimethylbenz(a)anthracene (DMBA), have been shown to be immunosuppressive. The following parameters have been reportedly affected in DMBA-exposed mice: proliferative response to T cell mitogens, unidirectional mixed lymphocyte response, generation of cytotoxic lymphocytes, and NK cell tumor cytolysis (14, 15). Application of DMBA to the skin depletes epidermal Langerhans cells (LCs) (16) and suppresses CHS locally, when a sensitizer is applied to DMBA-treated skin (17, 18, 19). Similar to UVB-induced immunosuppression, DMBA-induced local immunosuppression is reported to be associated with the development of Ag-specific suppressor T lymphocytes, which inhibit the induction of both cellular and humoral immune responses when adoptively transferred to naive syngeneic recipients (17, 18). In contrast to UVB, topically applied DMBA inhibits cutaneous immunological functions only at the site of application, because when DMBA is applied at one skin site, and animals are immunized to the hapten at another site, a normal CHS response is observed (18). Although these findings suggested that DMBA exerts immunosuppressive effects by reducing LC numbers and/or function, the precise mechanisms by which DMBA induces immunosuppression have not been clarified. XPA mice also showed a high incidence of skin tumors by topical application of DMBA as well as by UVB radiation (4). It is well established that the formation of DMBA adducts with DNA is a necessary precondition for the development of skin cancer and that the level of adducts correlates closely with tumorigenicity (20, 21). Because XPA protein is required to repair DMBA-DNA adducts, the high incidence of DMBA-induced skin cancer in XPA mice may be mainly due to a defect in the repair of DMBA-induced DNA lesions of cutaneous cells. We hypothesized that the immunosuppression by DMBA in addition to its mutagenicity may contribute to the development of skin tumors initiated by the application of DMBA to XPA mice. DNA damage caused by UVB radiation has been demonstrated to be one of the primary molecular mechanisms for initiation of UVB-induced immunosuppression. However, it is not known whether other forms of DNA damage, including the DMBA-DNA adduct, also cause immunosuppression, or whether the same immunosuppressive pathway is activated by chemical carcinogens and UVB radiation. We investigated the effects of DMBA on the immunologic function of XPA mice and the mechanisms of DMBA-induced immunosuppression.
| Materials and Methods |
|---|
|
|
|---|
XPA gene-deficient mice with CBA, C57BL/6, and CD-1 chimeric genetic background (4) were backcrossed with hairless albino mice of the inbred strains Hos/HR-1, which were supplied by Hoshino Experimental Animal Farm (Saitama, Japan), and the resultant hairless XPA-/- and XPA+/+ mice were used in this study. All mice were female and 810 wk of age at the beginning of each experiment, but within a single experiment, all mice were age-matched. Each experimental panel consisted of 514 mice.
Reagents
The [5,6,8,11,12,14,15-3H]PGE2 (7.4 x 109 Bq/mol) was obtained from New England Nuclear (Boston, MA), DMBA and indomethacin were purchased from Sigma (St. Louis, MO), and dinitrofluorobenzene (DNFB) was obtained from WAKO (Osaka, Japan).
Ear swelling response to DMBA application
The ears of mice were treated with 20 µl of different concentrations of DMBA in acetone. Ear thickness was measured with a dial thickness gauge (Peacock, Tokyo, Japan) immediately before and 1, 2, 3, 4, and 5 days after application. An ear swelling response was represented by an increment in thickness above the value before application.
ADPase staining
The epidermal sheets were prepared from skin samples using EDTA and were stained with ADP according to the method of Chaker et al. (22). Stained LCs were counted in 30 randomly selected interfollicular fields per sheet with the aid of a calibrated ocular grid.
Sensitization and elicitation of CHS
The mice were sensitized using an epicutaneous application of 25 µl of 1% DNFB solution in acetone/olive oil (4/1) on abdominal or ventral skin. CHS was elicited after using an application of 20 µl of a 0.2% DNFB solution on the surface of each left ear 6 days after sensitization. Ear thickness was measured before and 24 h after application of the challenge dose, and the difference between the two readings was recorded as ear swelling.
Assay for DMBA-induced immunosuppression of CHS
To assay the induction of local immunosuppression by DMBA, 60 µl of a 0.5 or 0.1% DMBA in acetone was applied on the dorsal area of the mice on day 0 unless otherwise stated, and sensitization with DNFB was performed at the DMBA-applied site on day 4. Elicitation at the left ear was performed on day 10.
To assay the induction of systemic immunosuppression by DMBA, 100 µl of 0.05 or 0.1% DMBA was applied on the dorsal area of the mice on day 0, and sensitization with DNFB was performed at the abdominal region on day 4. Elicitation at the left ear was performed on day 10.
To determine whether any tolerance was induced, we sensitized all mice again by applying 25 µl of 1% DNFB on the nontreated dorsal skin immediately after measurement of ear swelling. The second challenge test was performed on the right ear 6 days after the second sensitization. Suppression of the ear swelling response was calculated as follows: 100 - (ear swelling of test mice/ear swelling of DMBA-nontreated control mice) x 100%.
Determination of PGE2 in mouse skin
The amount of PGE2 in mouse ears at 0, 1, 2, 3, and 4 days after application of 20 µl of 0.5% DMBA was determined by enzyme immunoassay, as described previously (23). In brief, both ears of each mouse were cut off and immediately dropped into liquid nitrogen. Four frozen ears were combined into one sample, and then weighed and homogenized with a Polytron homogenizer (Brinkmann, Westbury, NY) in 10 ml of ethanol containing 0.1 ml of 5 N HCl, which was precooled at -20°C. [3H]PGE2 (10,000 dpm each) was added to the homogenates as a tracer for estimation of the recovery. After centrifugation, PGE2 in the ethanol extract was applied to Sep-Pak C18 cartridges (Waters Associates, Milford, MA) and purified by HPLC. The amount of PGE2 was measured in duplicate using an enzyme immunoassay kit (Cayman Chemical, Ann Arbor, MI).
Immunohistochemical analysis for IL-10 and TNF-
IL-10 and TNF-
in the skin were examined by an
immunoperoxidase method using monoclonal rat anti-mouse IL-10 (BD
PharMingen, San Diego, CA) and monoclonal rat anti-mouse TNF-
(BD PharMingen). DMBA-treated mouse skin was removed 2 days after
treatment, embedded in an OTC compound, and frozen in liquid nitrogen;
4-µm cryostat sections were fixed with 2% paraformaldehyde.
Endogenous peroxidase activity was blocked with 3% hydrogen peroxide;
slides were incubated with a protein blocking solution (10% normal
horse serum and 1% normal goat serum) for 20 min, followed by
treatment with rat anti-mouse IL-10 or TNF-
mAb overnight at
4°C. The slides were washed with PBS and incubated for 30 min with
peroxidase-labeled streptavidin and for 20 min with diaminobenzidine.
As a negative control, isotype rat IgG1
(BD PharMingen) was used
instead of mAbs.
RT-PCR for IL-10
Whether the application of DMBA induced IL-10 mRNA signals was determined according to Enk and Katz (24) with some modification. At various times after application of DMBA, the mice were killed, and ears were excised, split, and floated dermal side down in 10,000 U of Dispase (Godo Shusei,Tokyo, Japan) in 10 ml of PBS for 2 h at 37°C. Epidermal cell suspensions were prepared, and total epidermal RNA was extracted by the method of Chomczynski and Sacchi (25).
The cDNA was synthesized from 1 µg of mRNA in a 20-µl volume containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl2, 10 mM DTT, 1 mM dNTPs, 0.5 µg of oligo(dT), and 2.5 U of SuperScript II RT (Life Technologies Oriental, Tokyo, Japan). The mixture was incubated at 42°C for 50 min and heated at 70°C for 10 min to inactivate the enzyme. The mixture was incubated with 2 U of Escherichia coli RNase H at 37°C for 20 min.
PCR amplification was performed according to Saiki et al. (26). The cycling conditions chosen were 1 min at 94°C, 1 min at 58°C, and 2 min at 72°C, and 30 cycles were used. Primers for IL-10 were purchased from Clontech (Palo Alto, CA). Primer sequences for G3PDH were ACCACAGTCCATGCCATCAC (5' primer) and TCCACCACCCTGTTGCTGTA (3' primer). After the final cycle, the temperature was maintained at 72°C for 10 min. PCR products were then electrophoresed though 1% agarose gels in Tris/acetate/EDTA buffer containing ethidium bromide, and the gels were photographed under UV light.
Measurement of TNF-
protein
Samples of ear tissue extract for ELISA were prepared as described by Ferguson et al. (27) with some modification. Briefly, at various times after application of DMBA, ears were excised and immediately homogenized with a 5-fold volume of 0.1% Tween 20 in PBS. Samples were then quickly frozen in liquid nitrogen, thawed in a 37°C water bath, sonicated for 15 s, and centrifuged for 5 min at 13,000 x g, and supernatants were used for ELISA (Genzyme, Minneapolis, MN).
Determination of serum IL-10 by ELISA
Peripheral blood was obtained by venipuncture 2 days after the epicutaneous application of 100 µl of 1% DMBA and was anticoagulated with heparin. Following centrifugation, serum IL-10 was measured in duplicate using an ELISA kit (BD PharMingen), according to the manufacturers procedures.
Statistical analysis
Students t test was used to determine the statistical difference between means, with p < 0.05 considered significant.
| Results |
|---|
|
|
|---|
A single application of 20 µl of 0.5% DMBA resulted in
significant ear swelling in XPA mice 2 days after application, and
edema was still increasing on day 5 (Fig. 1
). XPA mice developed lesser ear
swelling using a 0.1% DMBA application than with 0.5% DMBA, reaching
a plateau on day 3. The application of 0.05% DMBA produced no
significant ear swelling in XPA mice. In contrast, the wild-type mice
did not develop any significant ear swelling even with a 2.5% DMBA
application.
|
XPA mice developed stronger damage to ADPase+ LCs after DMBA application
In nontreated skin, approximately the same numbers of
ADPase+ LCs were found in the epidermal sheet of
XPA and wild-type mice (614.4 ± 104.32 and 577.6 ±
155.52/mm2, respectively). The time course of
change in the number of ADPase+ LCs after
application of 0.5% DMBA was similar in both types of mice (Fig. 2
). The number of
ADPase+ LCs significantly decreased 2 days after
application of 0.5% DMBA, reached a minimum on day 4 and then
recovered, but was still significantly lower than the pretreated level
on day 9. By day 16, the density of ADPase+ LCs
in both types of mice recovered and reached a higher level than that
before treatment. During the period from days 29, the number of
ADPase+ LCs in XPA mice was smaller than that in
wild-type mice. The DMBA application of a lower concentration (0.1%)
significantly reduced ADPase+ LCs in XPA mice 2
and 4 days after application (p < 0.0001
compared with the pretreated level, on days 2 and day 4), but not in
the wild-type mice. Morphologically, dendritic cells in untreated XPA
mice skin were indistinguishable from those in wild-type mice; both
showed intense staining and multiple branched dendrites. The
ADPase+ LCs remaining after the 0.1% DMBA
application were rounded and lacked dendrites in the XPA mice, but
those in the wild-type mice had multiple branched dendrites.
|
The immune status of mice sensitized to DNFB through DMBA-treated
skin was investigated. Both XPA and wild-type mice developed a strong
CHS response when nontreated skin was sensitized with DNFB (Fig. 3
a). Sensitization with DNFB
on skin that had received a 0.1 or 0.5% DMBA application resulted in
almost complete suppression of the CHS response in XPA mice (96 and
94% suppression, respectively). In contrast, less suppression was
induced in the wild-type mice with pretreatment using 0.1 or 0.5% DMBA
(24 and 36% suppression, respectively). In these mice, the induction
of tolerance was confirmed by the second challenge tests, which
revealed almost the same reduced responses as those of the first
challenge (Fig. 3
b).
|
Application of 0.1% DMBA on the back 4 days before sensitization
with DNFB on the abdominal skin induced a stronger suppression of CHS
in the XPA mice than in wild-type mice (82 vs 45% suppression; Fig. 4
a). Although 0.05% DMBA
induced only slight suppression in wild-type mice (32% suppression),
it produced pronounced suppression in XPA mice (59% suppression). In
these mice, the induction of tolerance was also confirmed by the second
challenge tests. Because the intensity of the second challenge tests
was almost the same as that of the first challenge (Fig. 4
b), it was thought that systemic suppression induced by
DMBA application may be an active tolerance, but not a transient
unresponsiveness.
|
PGE2 is known to be not only an inflammatory
mediator, but also an immunomodulator. To investigate the molecular
mechanisms of enhanced DMBA-induced inflammation and immunosuppression
in XPA mice, the amounts of PGE2 in mouse ears
were measured by enzyme immunoassay at various times after 0.5% DMBA
application (Table I
). In nontreated
skin, approximately the same amounts of PGE2 were
detected in XPA (0.97 ± 0.02 ng/g tissue) and wild-type mice
(2.3 ± 0.88 ng/g tissue). Although the amount of
PGE2 in the skin of the wild-type mice had not
changed by 4 days after application of 0.5% DMBA, the amount in the
skin of XPA mice had increased at 2 days after application (15.9
± 6.1 ng/g tissue) and was still increasing on day 4 (53.9 ± 2.2
ng/g tissue).
|
To determine whether the DMBA-induced edema was mediated by
PGE2, the effect of indomethacin (a potent
inhibitor of PG biosynthesis) on the DMBA-induced ear swelling response
was examined. Twenty microliters of 1% indomethacin was applied to the
ears of XPA mice immediately after the application of 0.1% DMBA, and
the thickness of the ears was measured (Fig. 5
). A slight ear swelling response
developed 1 day after application in the mice that only received DMBA
(3.67 ± 0.47 x 10-3 cm), but there
was no observable swelling in the mice that also received indomethacin
after DMBA application (0.58 ± 0.76 x
10-3 cm; p < 0.0005). Although
the ear swelling in both groups of mice increased after treatment,
reaching maximum swelling 34 days after application, indomethacin
inhibited DMBA-induced ear swelling by 4070% at all of the time
points studied.
|
To determine whether PGE2 is involved in the
DMBA-induced immunosuppression, we studied the effect of indomethacin
on DMBA-induced local immunosuppression. Immediately after the
application of 40 µl of 0.1 or 0.05% DMBA, 40 µl of 1%
indomethacin was applied to the DMBA-treated area, and sensitization
with DNFB was performed on the DMBA- and indomethacin-treated skin 4
days later. Epicutaneous application of indomethacin on DMBA-treated
skin abrogated the suppressive effect of DMBA in both XPA and wild-type
mice (Fig. 6
). In XPA mice, sensitization
with DNFB on skin that had been exposed to 0.1 or 0.05% DMBA resulted
in a significantly decreased CHS response (98 and 75.3% suppression,
respectively). However, application of 1% indomethacin immediately
after exposure to 0.1 or 0.05% DMBA inhibited the degree of
suppression (43.2 and 30% suppression, respectively). Similarly, the
degree of suppression decreased after treatment with indomethacin in
wild-type mice, although less suppression was induced using DMBA in
wild-type mice than in XPA mice.
|
production in the epidermis was
enhanced in XPA mice
IL-10 and TNF-
have been implicated as participants in the
immunosuppressive cascade. The ability of DMBA to induce IL-10 and
TNF-
production in mouse skin in vivo was analyzed by mAb and
immunoperoxidase staining of skin sections. Constitutive expression of
IL-10 was not detected in the skin of XPA (Fig. 7
A) and wild-type mice (data
not shown). IL-10 could be detected in the epidermis 2 days after 0.1%
DMBA application in XPA mice (Fig. 7
B), but not in wild-type
mice (Fig. 7
C). There was no detectable staining using
isotype control rat IgG1 as a negative control in epidermis of XPA mice
treated with 0.1% DMBA (Fig. 7
D). Similarly, application of
0.1% DMBA induced detectable TNF-
production in the epidermis of
XPA mice, but not in that of wild-type mice (data not shown).
|
|
production more
easily in XPA mice than wild-type mice, production of TNF-
at
protein level in the DMBA-treated skin of both types of mice. There was
no detection of TNF-
protein in nontreated skin of XPA and wild-type
mice. In the skin of XPA mice, TNF-
production at the protein level
was detected 24 h after the application of 0.1% DMBA and
increased at 48 h (Table II
production was enhanced by 0.5% DMBA application in
XPA mice. However, production of TNF-
protein was undetectable in
wild-type mice treated with 0.1 and 0.5% DMBA throughout the
observation period.
|
IL-10 has been reported to play a role in the induction of
systemic immunosuppression by alteration of the Ag-presenting property
of APC in draining lymph nodes. The release of IL-10 in peripheral
blood was examined after DMBA application. IL-10 was not detected in
serum constitutively in either XPA or wild-type mice. However, in all
XPA mice that received an application of 100 µl of 1% DMBA, IL-10
was detected in serum 2 days after application (Table III
). In contrast, there was no
detectable serum level of IL-10 by ELISA in wild-type mice treated with
DMBA. In animals treated with 100 µl of 0.5% DMBA 2 days previously,
serum IL-10 was detectable in two of five XPA mice (22 and 27 pg/ml,
respectively), but not in five wild-type mice. Application of 100 µl
of 0.1% DMBA did not induce a detectable serum level of IL-10 by ELISA
in either type of mouse.
|
| Discussion |
|---|
|
|
|---|
A single cutaneous application of 0.1 or 0.5% DMBA induced significant
ear swelling in XPA mice, but not in wild-type mice. In contrast, the
intensities of ear swelling responses after treatment with croton oil
or phenol were almost the same in both types of mouse. Croton oil and
phenol do not form DNA adduct, or XPA protein is not required to repair
DNA damage, if any, caused by these chemicals. Thus, a defect in the
repair of DMBA-DNA adduct in XPA mice might be involved in the
enhancement of DMBA-induced inflammation. In XPA mice, LCs are impaired
at a lower DMBA concentration than in wild-type mice. Moreover,
DMBA-induced local immunosuppression was enhanced in XPA mice, but not
in wild-type mice. In XPA mice, enhanced reduction of LC number after
application of DMBA might be involved in the enhancement of
DMBA-induced local immunosuppression. Addition to the cytotoxic effects
of DMBA, DMBA-induced inflammation might contribute to the reduction of
the number of LCs, because inflammation will prompt LCs to emigrate
from skin and to home to regional lymph nodes. Furthermore, the fact
that LC numbers in DMBA-treated skin remain low for several days may
indicate that DMBA and/or DMBA-induced inflammation inhibits the
immigration of LC precursors or their terminal development in the skin.
Kinetics of epidermal ADPase+ LC in XPA mice
after DMBA application were different from those after UVB radiation
with regard to the following points: 1) the number of
ADPase+ LCs after DMBA application decreased and
then increased to higher level than those before treatment, whereas the
density of ADPase+ LCs after UVB radiation
recovered only to the pretreatment level (5). 2) Although
the reappearance of ADPase+ LC after UVB
radiation in XPA mice was delayed compared with that in wild-type mice,
that after DMBA application in XPA mice was not. The reasons for these
findings were not clarified. Mice rendered unresponsive by immunization
with DNFB through DMBA-treated dorsal skin remained unresponsive when
reimmunized through nontreated abdominal skin. Therefore, contact with
hapten through DMBA-treated skin might have stimulated suppressor cells
that inhibited the development of CHS to that hapten. Actually,
Halliday et al. reported that DMBA-induced immunosuppression was
associated with the development of Ag-specific suppressor T lymphocytes
that inhibited the induction of cellular immune responses when
adoptively transferred to naive syngeneic recipients (17, 18). However, the mechanisms by which DMBA induces suppressor T
cells have not been clarified. We assumed that, similar to UVB
radiation, DMBA may exert its immunosuppressive effects by altering APC
function in skin. In our experiments although the number of epidermal
ADPase+ LCs was significantly decreased in both
XPA and wild-type mice 4 days after a 0.5% DMBA application (Fig. 2
),
local immunosuppression was greatly enhanced in XPA mice when DNFB
sensitization was performed 4 days after 0.5% DMBA application (Fig. 3
). This result might indicate that LC depletion alone cannot explain
DMBA-induced inhibition of the CHS. It is possible that mechanisms
similar to UVB-induced immunosuppression might be involved in
DMBA-induced local immunosuppression. Exposure to DMBA was demonstrated
to suppress the IL-2 production of Th cells in vivo (29)
and in vitro (30). These observations suggest the
dysfunction of Th1 cells in establishing DMBA-induced
immunosuppression. It has been demonstrated that UV-treated LCs are
unable to stimulate Th1 cells, whereas their ability to stimulate Th2
cells is unaffected. UVB radiation induces the production and secretion
of a variety of immunomodulatory factors in the skin. Among them,
PGE2 is known to be an inflammatory mediator as
well as an immunosuppressive factor. We previously reported that the
amount of PGE2 in skin significantly increased
after UVB irradiation in XPA mice, which might account for the enhanced
inflammation and local immunosuppression induced by UVB radiation in
XPA mice (13). In the present study, we demonstrated that
the application of DMBA also induced the production of a pronounced
amount of PGE2 in the skin of XPA mice. Moreover,
in XPA mice, the DMBA-induced ear swelling response and local
immunosuppression were partially inhibited by treatment with
indomethacin, a potent inhibitor of PG biosynthesis. Therefore,
enhanced production of PGE2 after DMBA
application, similar to that after UVB radiation, might cause
enhancement of inflammation and local immunosuppression in XPA mice.
Unrepaired DMBA-induced DNA lesions might cause an excess production of
PGE2 in XPA mice. In addition to
PGE2, IL-10 and TNF-
production in the
epidermis were detected by 0.1% DMBA application in XPA mice, but not
in wild-type mice. Previously, Nishigori et al. provided direct
evidence that UVB-induced DNA damage initiates the production of IL-10
in keratinocytes (31). They showed that treatment with
liposomal T4 endonuclease V, an excision repair enzyme specific for CPD
in DNA, reduced UVB-induced production of IL-10 in mice in vivo and in
vitro. Similarly, it is possible that unrepaired DMBA-DNA adduct in XPA
mice stimulates keratinocytes to produce IL-10 and TNF-
, thereby
modifying critical steps in the immunological pathway and ultimately
leading to the suppression of the immune response and generation of
Ag-specific suppressor T cells.
In this study, DMBA-induced systemic immunosuppression was enhanced in XPA mice. These mice became tolerant against DNFB, because they could not be resensitized against the same hapten. Therefore, DMBA-induced systemic immunosuppression might be mediated by the development of Ag-specific suppressor T cells, similar to DMBA-induced local immunosuppression. A key element in UVB-induced systemic immunosuppression is the production of epidermal cytokines, PGs, and cis-urocanic acid, which mediate the transfer of signals from UV-irradiated skin to lymphoid cells. Shreedhar et al. suggested that the cytokine cascade, including PGE2, IL-4, and IL-10, is responsible for UV-induced systemic immunosuppression (12), because PGE2 can induce the secretion of IL-10 from PBMC (32) or from keratinocytes via IL-4 (12). We demonstrated that DMBA treatment induced a detectable release of serum IL-10 in XPA mice. Thus, it is possible that PGE2 derived from DMBA-treated skin induces the secretion of IL-10 from keratinocytes and/or PBMC. Consequently, the APC function in the lymph nodes is altered by PGE2 and/or IL-10 to develop systemic immunosuppression. Although systemic suppression was induced by application of 0.05 and 0.1% DMBA in XPA mice, there was detectable serum level of IL-10 by ELISA only in 1% DMBA-treated XPA mice. There was also detectable serum IL-10 in two of five XPA mice treated with 0.1% DMBA, but not in 0.05% DMBA-treated XPA mice. These findings might be due to the limitation of the detectability of this assay. Similarly, elevation of serum IL-10 was detectable only after high dose UVB radiation (33). Therefore, even an undetectable amount of IL-10 in serum seems to play a crucial role in the induction of systemic immunosuppression.
The results presented here suggest that DMBA-DNA adduct formation is a
primary molecular event for the initiation of immunosuppression induced
by DMBA, because XPA mice, having a defect in the repair of DMBA-DNA
adduct, showed enhanced local and systemic immunosuppression in
response to DMBA. Regarding UVB-induced immunosuppression, DNA damage
caused by UVB has been demonstrated to be one of the primary molecular
mechanisms for initiation of immunosuppression. Kripke and colleagues
reported that reducing the number of CPDs in UV-irradiated skin
abrogated the systemic suppression of CHS and delayed-type
hypersensitivity (34, 35). The action spectra for
UV-induced suppression of the mixed lymphocyte and mixed epidermal
cell-lymphocyte reactions were shown to closely resemble those for the
induction of CPD and 6-4 photoproducts (36). Action
spectra for local and systemic suppression of CHS are also consistent
with DNA damage as initiators of these effects (37, 38).
Our previous study, in which XPA mice showed increased local and
systemic immunosuppression induced by UVB radiation, supported this
hypothesis (5). Moreover, Kripke and colleagues indicated
that DNA damage other than CPD also causes immune suppression. They
reported that the liposomal HindIII restriction enzyme,
which causes double-strand breaks at the 5'-AAGCTT-3' base sequence in
DNA, induced local and systemic immunosuppression (39, 40). However, treatment of HindIII failed to induce
suppressor T cells, suggesting that the mechanisms inducing
immunosuppression were different for UVB and HindIII
treatment. Our results support the possibility that DNA damage by other
than UVB can also induce immune suppression and trigger the production
of immunomodulatory cytokines. Recently, Yarosh et al. reported that
UVB-induced DNA damage leading to an increase in and activation of
FKBP12-rapamycin-associated protein kinase, resulted in gene expression
of TNF-
(41). Moreover, it was demonstrated that
TNF-
induced cyclooxygenase-2 expression, leading to the production
of PGE2 in human lung epithelial cells
(42). In our model it is speculated that DMBA-induced DNA
damage might lead to the production of TNF-
mediated by DNA protein
kinase, resulting in the expression of cyclooxygenase-2 and production
of PGE2. Further studies are necessary to
elucidate the precise molecular mechanisms by which DNA damage in cells
induces production of immunomodulately cytokines and
PGE2.
Clinically, XP patients show increased rates of neoplasms in organs that are not exposed to UV radiation. Kraemer and colleagues reported that XP patients had a 10- to 20-fold increase in the occurrence of neoplasms in sites not exposed to UV radiation compared with the general population (43). We have previously shown that NK function is easily suppressed by UVB radiation in XPA mice, suggesting that impairment of NK function by UVB radiation might contribute to an increased internal malignancy in XP patients (44). Exposure to environmental carcinogens, endogenous mutagens, and/or oxygen-free radicals (45) may be important for the development of these internal neoplasms in XP patients. XP cells are hypersensitive to mutagenic tryptophan pyrolysis products in charbroiled meat and fish (46, 47) and are also hypersensitive to killing and are hypermutable to DNA-damaging chemical carcinogens, such as benzopyrene, found in cigarette smoke (48, 49). Moreover, oral treatment of XPA mice with benzopyrene, acetylaminofluorene, and aminomethylphenylidazopyridine resulted in lymphomas, liver and bladder tumors, and intestinal adenomas and lymphomas, respectively (50). DMBA is a prototype carcinogenic polyaromatic hydrocarbon. Polyaromatic hydrocarbons are ubiquitous environmental contaminants generated as byproducts of the incomplete combustion of fossil fuels, wood, and other organic materials (51). The high incidence of internal cancers in XP patients may be due to a defect in the repair of such chemical carcinogen-damaged DNA. Moreover, the present study suggested that easy impairment of the immune surveillance system by chemical carcinogens demonstrated in XPA mice could also be involved in the high incidence of internal malignancy in XP patients. The role of cyclo-oxygenase and PGs in tumorigenesis is well established (52, 53), and cyclo-oxygenase inhibitors are effective in tumor patients in both prophylactic and therapeutic settings (52, 54). Overexpression of PGE2 induced by UVB and chemical carcinogens may also be responsible for the increased incidence of neoplasms in XPA patients. If this is true, cyclo-oxygenase inhibitors may be beneficial for XPA patients.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hiroko Miyauchi-Hashimoto, Department of Dermatology, Kansai Medical University, Fumizono-cho 10-15, Moriguchi, Osaka 570-8507, Japan. ![]()
3 Abbreviations used in this paper: XP, xeroderma pigmentosum; XPA, XP group A; CHS, contact hypersensitivity; DMBA, 9,10-dimethyl-1,2-benz(a)anthracene; DNFB, 1-fluoro-2,4-dinitrobenzene; CPD, cyclobutane pyrimidine dimer; LC, Langerhans cell. ![]()
Received for publication June 14, 2000. Accepted for publication February 20, 2001.
| References |
|---|
|
|
|---|
in the immune suppression induced by ultraviolet radiation. J. Leukocyte Biol. 56:769.[Abstract]
-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350.
]anthracene and its restoration by interleukin 2. Int. J. Immunopharmacol. 9:83.
-induced cyclooxygenase-2 expression in human lung epithelial cells: involvement of the phospholipase C-
2, protein kinase C-
, tyrosine kinase, NF-
B-inducing kinase, and I-
B kinase 1/2 pathway. J. Immunol. 165:2719.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |