|
|
||||||||





*
Institut für Prophylaxe der Kreislaufkrankheiten, and
Medizinische Poliklinik, Ludwig-Maximilians-Universität, München, Germany; and
Department of Medicine and Therapeutics, University of Aberdeen, Aberdeen, United Kingdom
| Abstract |
|---|
|
|
|---|
up-regulated mRNA and protein of CC and
CXC chemokines but not constitutive expression of the CX3C
chemokine fractalkine. While growth-related activity (GRO)-
was
immobilized to MC proteoglycans, monocyte chemotactic protein (MCP)-1
was secreted into the soluble phase. Firm adhesion and sequestration of
monocytes on activated MC was supported by the GRO-
receptor CXCR2
and to a lesser extent by CX3CR, whereas the MCP-1 receptor
CCR2 contributed to their transendothelial chemotaxis toward activated
MC. In contrast, fractalkine mRNA and protein was induced by TNF-
in
transformed rat GEC, and both CXCR2 and CX3CR mediated
monocyte arrest on GEC in shear flow. The relevance of these mechanisms
was confirmed in a rat nephrotoxic nephritis model where acute
glomerular macrophage recruitment was profoundly inhibited by blocking
CXCR2 or CCR2. In conclusion, our results epitomize a combinatorial
model in which chemokines play specialized roles in driving glomerular
monocyte recruitment and emphasize an important role for CXCR2 in
macrophage infiltration during early phases of nephrotoxic
nephritis. | Introduction |
|---|
|
|
|---|
Previous studies have demonstrated the expression of these key molecules in various forms of glomerulonephritis (10). Animal models have shown that the integrin ligands ICAM-1 and VCAM-1 are involved in nephrotoxic nephritis (NTN),3 immune complex, or lupus nephritis (11, 12). Multiple CC and CXC chemokines are expressed in distinct glomerulopathies, and the CC chemokines monocyte chemoattractant protein-1 (MCP-1; CCL2 according to the new chemokine classification (13) recently proposed) or RANTES (CCL5), as well as the CX3C chemokine fractalkine (CX3CL1), have been implicated in mononuclear cell recruitment during NTN, crescentic glomerulonephritis, or anti-Thy-1 nephritis (14, 15, 16, 17, 18, 19, 20). In addition, it has been inferred that the MCP-1 receptor CCR2 participates in early phases of NTN, while the RANTES receptor CCR1, as well as CCR2, appear to increase severity at later stages, suggesting potential anti-inflammatory activities (17, 18). In contrast, blocking CXC chemokines, such as macrophage inflammatory protein (MIP)-2 or growth-related activity (GRO) homologue cytokine-induced neutrophil chemoattractant (CINC), has been revealed to reduce initial neutrophil influx in NTN (19); however, their effect on mononuclear infiltration is not known.
Mononuclear cell infiltration has been identified as an early marker in the pathogenesis of glomerulonephritis (21, 22), and both mesangial cells (MC) and glomerular endothelial cells (GEC) have been involved in their recruitment (10). MC express the CC chemokines MCP-1 and RANTES (23, 24) and the CXC chemokines IL-8 (CXCL8) and GRO (CXCL1) (25, 26, 27). In contrast, GEC, which line the capillaries in the glomerulum, exhibit inducible expression of the chemokines RANTES and MCP-1 (28, 29). Moreover, immunofluorescence staining in nephritic but not normal kidneys has demonstrated that fractalkine is expressed in a nonlinear pattern typical of glomerular endothelium (15).
Although leukocyte adhesion and trafficking in the vascular system has
been widely studied in vitro and in vivo, less is known about
site-specific molecular mechanisms involved in glomerular recruitment.
Here we have established a combinatorial model of glomerular monocyte
infiltration by investigating the functional specialization of
chemokines produced by MC and GEC and the involvement of their
chemokine receptors in different steps of leukocyte recruitment. We
found that both fractalkine and GRO-
via their receptors
CX3CR and CXCR2 mediate monocyte arrest on
activated GEC, while MCP-1 and CCR2 induce diapedesis across EC, and
CXCR2 supports adhesion to residential MC. The relevance of these
mechanisms during glomerular infiltration in vivo was confirmed in a
telescoped model of NTN where glomerular recruitment and localization
of macrophages was almost completely blocked with a CXCR2 antagonist
and substantially inhibited with a CCR2 antagonist.
| Materials and Methods |
|---|
|
|
|---|
Primary human mesangial cells (Clonetics, San Diego, CA) were
used at passages 39 and cultured in basal MC medium (Clonetics)
supplemented with 5% FCS. HUVEC were used at passages 25 and grown
in low-serum PromoCell medium (30). Rat GEC (from H.
Holthöfer, Haartman Institute, University of Helsinki, Helsinki,
Finland) were used at passages 79 and maintained in RPMI 1640 medium
supplemented with 10% FCS. This cell line is transformed by an
oncogenic adenovirus, exhibits a highly proliferative phenotype, and
consistently expresses endothelial cell markers (31).
TNF-
stimulation of above cell types was conducted at 100 U/ml for
4 h. Human blood monocytes were isolated from healthy donors by
NycoPrep density gradient centrifugation (Nycomed, Oslo, Norway) and
separated from platelets by multiple low-gravity washes, as described
previously (3). This protocol resulted in a purity of
>85% monocytes and a minimal contamination with platelets (<5%), as
assessed by expression of CD14 and P-selectin. The rat macrophage cell
line NR8383 was cultured in complete Hams F-12 medium, supplemented
with 10% FCS and penicillin/streptomycin (32).
The
2 mAb TS1/18 was obtained from Dr. L.
Klickstein (Brigham and Womens Hospital, Boston, MA), and
4 mAb HP1/2 was obtained from Dr. R. Lobb
(Biogen, Cambridge, MA). The peptide analogs
GRO-
873 and MCP-1976
(33, 34) were provided by Dr. I. Clark-Lewis (University
of British Columbia, Vancouver, Canada), and Met-RANTES was provided by
Dr. A. Proudfoot (Serono Pharmaceutical Research, Randolph, MA).
Monoclonal Abs to human MCP-1, GRO-
, IL-8, or fractalkine and
isotype controls were purchased from Serotec (Oxford, U.K.), BioSource
(Camarillo, CA), or R&D Systems (Minneapolis, MN). Chemokines were
purchased from PeproTech (Rocky Hill, NJ). Reagents were obtained from
Sigma (Deisenhofen, Germany), unless otherwise stated.
RT-PCR
Total RNA was isolated by phenol/chloroform/isoamylalcohol
extraction and cDNA was reverse transcribed from 2 µg RNA. PCR
products were analyzed by agarose gel electrophoresis and quantitated
by HPLC analysis as described (3, 35, 36, 37). Primer
sequences were as published for
-actin (30) GRO-
,
MCP-1 (36), and fractalkine (38),
TACTCCAAACCTTTCCACCC (IL-8 sense), and AACTTCTCCACAACCCTCTG (IL-8
antisense). For PCR from GEC, primer sequences for G3PDH, MCP-1
(39), and GRO-
(40) were as published, and
for fractalkine were as follows: 5'-CTGGCGGGTCAGCACCTCGGCATG-3'
(fractalkine sense), 5'-CCGGGTGGCTGCCTGGGAGTCAGG-3' (fractalkine
antisense).
Flow cytometry and calcium mobilization
Confluent MC were trypsinized, washed, and reacted with
saturating mAb concentrations for 30 min on ice, stained with
FITC-conjugated IgG (Boehringer Mannheim, Mannheim, Germany), and
analyzed in a FACScan (Becton Dickinson, Mountain View, CA) (30, 41). Surface expression of CD11b (41, 42) and
intracellular calcium mobilization (41) in response to
chemokines was studied as previously described, using flow cytometry
and fura-2 spectrofluorometry, respectively. To test the cross-species
reactivity of chemokines and their antagonists, calcium influx and
Mac-1 surface expression was measured in rat macrophages and isolated
human blood monocytes stimulated by GRO-
and MCP-1 derived from the
other species and inhibited by GRO-
873 and
MCP-1976 (data not show). This suggested a
sufficiently high cross-species reactivity, allowing the use of these
peptides in our models.
Immunofluorescence
MC were grown to confluence on coverslips. MC were fixed in 2% paraformaldehyde and incubated for 2 h at room temperature (RT) with 10% heat-inactivated human serum in PBS to block nonspecific binding. To differentiate surface and cytoplasmic staining for MCP-1, some cells were permeabilized in 0.1% saponin for 2 min at RT. Cells were incubated with the primary Ab for 30 min at RT, washed, and then incubated with a FITC-conjugated IgG for 30 min at RT. Some cells were treated with heparitinase (0.5 U/ml) for 1 h at 37°C in HBSS supplemented with 10 mM HEPES, 0.5% human serum albumin, and 2 mM Ca2+. Coverslips were allowed to air dry, mounted with Mowiol (Calbiochem, Baol Soden, Germany), and analyzed using a Leica (Deerfield, IL) DMRBE fluorescence microscope with a 100x oil immersion objective.
Quantification of MCP-1, GRO-
, IL-8, and fractalkine protein
MC supernatants were collected and sterile filtered. The
concentration of MCP-1 and GRO-
protein present in the supernatants
was determined using a sandwich ELISA (R&D Systems) performed according
to the manufacturers protocols. IL-8 and fractalkine concentrations
were measured, following R&D Systems protocols for a double ligand
ELISA.
Western blotting
TNF-
(200 U/ml, 12 h)-stimulated HUVEC were prepared as
reported (43). MC or GEC were treated with TNF-
(100
U/ml) for 4 h, supernatants were collected and sterile filtered,
and then MC were lysed in sample buffer containing protease inhibitors.
Recombinant proteins were diluted in sample buffer. Proteins were
separated by 10% SDS-PAGE and transferred to Immobilon membranes
(Millipore, Eschborn, Germany) using an electroblotting system.
Membranes were blocked for 2 h at RT with 5% dry milk and 0.05%
Tween 20 (Filka, Buchs, Switzerland) in TBS and incubated with
anti-fractalkine Ab (0.1 µg/ml). Visualization of bound Abs was
conducted with the ECL system (Amersham, Little Chalfont, U.K.).
Monocyte adhesion in shear flow
Laminar flow assays were performed as previously described
(3, 44). MC, GEC, or HUVEC were grown to confluence in
35-mm petri dishes that were assembled as the lower wall in a parallel
wall flow chamber and mounted on the stage of an Olympus (New Hyde
Park, NY) IMT-2 microscope. Monocytes (0.5 x
106/ml) were suspended in HBSS containing 10
mmol/L HEPES, pH 7.4, 0.5% human serum albumin, 1 mmol/L
Mg2+ and Ca2+ (added
shortly before the assay), were kept in a heating block at 37°C
during assays, and were perfused into the flow chamber at a rate of 1.5
dyn/cm2 for 5 min. The number of firmly adherent
cells after 5 min was quantitated in multiple fields (at least five per
experiment) by analysis of images recorded with a long integration JVC
3CCD video camera and a SR L900 E video recorder and were expressed as
cells/mm2. The type of adhesion analyzed was
restricted to primary, i.e., direct interactions of monocytes with
endothelium. For inhibition experiments, monocytes were preincubated
with GRO-
873 or
MCP-1976 (1 µg/ml), fractalkine mAb or IL-8
mAb (10 µg/ml), for 30 min on ice, or with pertussis toxin (PTX) (250
ng/ml) for 1 h at 37°C. To block Fc receptors, monocytes were
preincubated in 5% human serum for 30 min. Data are expressed as
mean ± SD, and statistical significance was determined by
ANOVA.
Chemotaxis assays
Transendothelial monocyte chemotaxis assays were performed as described (3, 42, 45, 46, 47). In brief, HUVEC or GEC were grown on 6.5-mm transwell inserts (8 µM pore size; Costar, Cambridge, MA). MC were grown to confluence in the bottom chamber of the 24-well plate and stimulated or left untreated. Transwells were inserted, and monocytes were added to the top chamber. A dilution of cells served as a measure of input. Cells were allowed to transmigrate for 2 h. Input and migrated cells were counted by flow cytometry with monocyte light scatter gates. Flow cytometry following staining for the monocyte marker CD14 revealed that >90% of cells in the gated cell population were CD14-positive monocytes, thus confirming appropriate light scatter gates for monocytes (data not shown).
Nephrotoxic nephritis model and in vivo transfer of macrophages
The telescoped model of NTN was induced, and in vivo transfer of
fluorescently labeled macrophages was performed essentially as
described (32, 48). Male Sprague Dawley rats (purchased
from Harlan, Bicester, U.K.), weight 190250 g, were preimmunized with
1 mg rabbit IgG s.c. followed 1 wk later by injection of 5 ml/kg of
rabbit serum containing high titers of anti-rat glomerular basement
membrane Abs. NR8383 macrophages were harvested, and cell membranes
were fluorescently labeled with 2 µM PKH-26GL, washed in Hams F-12,
and rested in complete Hams F-12 for 24 h before injection. For
delivery of macrophages to the left kidney, rats were anesthetized
using hypnorm (Jannsen, High Wycombe, U.K.) i.m. (0.3 ml/kg) and
diazepam (Phoenix Pharmaceutics, Glouster, U.K.) i.p. (2.5 mg/kg)
24 h after induction of NTN. The left renal artery was exposed
using a standard anterior approach and directly cannulated using a
27-gauge needle. Fluorescently labeled macrophages (5 x
106) preincubated with or without
CX3CR mAb (Ref. 20 , kindly provided
by L. Feng), GRO-
873 or
MCP-1976 (3 µg each) in a volume of 0.4 ml
for 30 min on ice, were injected over 1 min. Bleeding was stopped by
compression of the renal artery, and adequate perfusion of the left
kidney was seen before closure of the abdominal wall. Animals were
killed 1 day after operation.
Pathology
Glomeruli were isolated from fresh kidney tissue by sieving through 250-µm and 150-µm diameter sieves with collection on a 65-µm sieve (32) or kidney tissue was snap-frozen in isopentane embedded in OCT. Isolated glomeruli were incubated with anti-rabbit IgG-FITC to outline the glomerular basement membrane. Localization of macrophages to inflamed glomeruli was assessed by counting the number of fluorescently labeled macrophages in 150200 randomly selected glomeruli.
Statistics
Statistical significance was determined by ANOVA, and differences with p < 0.05 were considered to be significant.
| Results |
|---|
|
|
|---|
up-regulates mRNA expression of chemokines in MC
To investigate whether TNF-
stimulation of MC induces mRNA
transcriptional activity for chemokines, RT-PCR was performed. Analysis
of PCR products showed that expression of mRNA of the chemokines
GRO-
, IL-8, and MCP-1 was markedly up-regulated by TNF-
(Fig. 1
A). In contrast, mRNA levels
of the CX3C chemokine fractalkine were not
clearly increased by stimulation of MC with TNF-
(Fig. 1
A). These results were confirmed by quantification of the
PCR products relative to
-actin using HPLC analysis (Fig. 1
B).
|
stimulation induces surface expression of chemokines
GRO-
and IL-8 but not fractalkine and secretion of MCP-1 and IL-8
We studied whether up-regulation of chemokine transcripts was
associated with an increase in surface protein expression. In
accordance with mRNA expression, Western blot and flow cytometric
analysis revealed that TNF-
did not affect total and surface protein
expression of fractalkine in MC but strongly induced fractalkine
expression on HUVEC (Fig. 1
, C and D). The
anti-fractalkine Ab seemed to be specific as it bound to
recombinant chemokine domain of fractalkine but not MCP-1 in Western
blots (Fig. 1
C). Endothelial activation with TNF-
has
been shown to result in surface immobilization of GRO-
, whereas
MCP-1 is secreted as a soluble protein (7). In activated
MC, IL-8 has been described to associate with the surface but is also
released into the soluble phase (25, 26). To detect
whether the chemokines GRO-
, IL-8, and MCP-1 are immobilized to the
MC surface following their induction, flow cytometric analysis and
immunofluorescence was performed. Resting MC showed marginal expression
of surface-associated GRO-
, which was markedly increased by TNF-
(Fig. 1
, E and F). Treatment with heparitinase
abolished staining for GRO-
(Fig. 1
F), revealing that
binding to heparan proteoglycans is involved in the surface
immobilization of GRO-
on MC. Immunofluorescence staining of MC with
mAbs to IL-8 and MCP-1 detected a similar pattern for IL-8 (data not
shown), but in contrast MCP-1 was not detected on the surface of
resting or TNF-
-treated nonpermeabilized MC but in the cytoplasm of
stimulated MC following permeabilization (Fig. 1
F). Thus, MC
indeed produce MCP-1 protein that is not immobilized on the cell
surface. To assess whether these chemokines were also released into the
soluble phase, MCP-1, GRO-
, and IL-8 in MC supernatants were
measured by ELISA. Supernatants of resting MC revealed basal levels of
MCP-1, GRO-
, and IL-8. After TNF-
stimulation, the amounts of
soluble MCP-1 and IL-8 were markedly increased, while GRO-
was only
slightly up-regulated (Fig. 1
G). In contrast, fractalkine
was not detected in MC supernatants by ELISA or Western blot (data not
shown). Thus, activated MC secrete MCP-1 and IL-8 as soluble proteins,
immobilize IL-8 and foremost GRO-
on the surface, while fractalkine
is constitutively expressed in its membrane form and not inducible.
Increased monocyte adhesion to TNF-
-stimulated MC: involvement
of CXCR2
Firm monocyte adhesion on activated endothelium under shear flow
involves
4 and
2
integrins interacting with Ig ligands (5, 44, 49).
Moreover, surface-bound GRO-
can support CXCR2-dependent monocyte
arrest on activated endothelium in shear flow (7).
Fractalkine has also been shown to mediate integrin- and
PTX-independent firm adhesion of leukocytes to endothelial cells
(50). Hence, we tested the role of integrins and
chemokines in shear-resistant monocyte arrest to activated MC under
flow conditions as a sensitive measure of adhesive strength.
TNF-
-activated MC supported spontaneous monocyte arrest (22.8
± 1.7 cells/mm2) (Fig. 2
A), albeit less efficiently
than activated endothelium (7). Pretreatment with a
combination of
4 and
2 integrin mAbs or with PTX reduced firm
arrest of monocytes to background levels supported by resting MC (Fig. 2
A), confirming that induced arrest was dependent on
integrins activated by signaling via
G
i protein-coupled
receptors. Preincubation with the GRO-
873
peptide analog, which competes with the binding of GRO-
and IL-8 to
their receptor CXCR2, but not the CCR2 receptor antagonist
MCP-1976 or a RANTES receptor antagonist
resulted in a significant inhibition of firm monocyte arrest (Fig. 2
A and data not shown). Desensitization of
CX3CR with soluble fractalkine only slightly
inhibited monocyte arrest, but in combination with PTX appeared to show
more marked effects than either substance alone, indicating an
involvement of fractalkine and CX3CR via
PTX-insensitive pathways (Fig. 2
A). Moreover, firm monocyte
arrest was attenuated by preincubation of MC with IL-8 mAb but less
markedly by preincubation with fractalkine mAb (data not shown).
|
Monocyte transmigration following arrest appears to require a
soluble chemokine gradient, e.g., MCP-1 (7). To study
transendothelial migration of monocytes toward activated MC secreting
chemokines, we performed a two-chamber chemotactic assay to mimic the
structural configuration of the glomerulus. Monocytes introduced to the
top chamber were allowed to transmigrate across HUVEC (Fig. 2
B) or GEC (not shown) monolayers grown on filter inserts
toward MC in the lower chamber. Transmigration of monocytes was
increased
2-fold by TNF-
stimulation of MC as compared with
transmigration elicited by resting MC. This response was significantly
inhibited in the presence of MCP-1976 but only
slightly reduced in the presence of GRO-
873
(Fig. 2
B). Notably, background migration toward resting MC
was unaffected by either peptide analog, suggesting that random
migration may prevail under these conditions. Hence, transendothelial
chemotaxis toward MC is preferentially mediated by CCR2.
Chemokine expression in GEC
The CX3C chemokine fractalkine, which is
induced by cytokines in endothelial cells (38), has been
involved in leukocyte recruitment during crescentic NTN, where it can
be detected in the glomerular endothelium (15). To assess
transcriptional regulation of GRO-
, MCP-1, and fractalkine in GEC,
cells were stimulated with TNF-
or IL-1
, and RT-PCR with specific
primers was performed. Resting GEC expressed fractalkine, GRO-
, and
MCP-1 mRNA, which was up-regulated after TNF-
or IL-1
stimulation
(Fig. 3
A and data not shown).
This was confirmed by quantification of PCR products using HPLC
analysis (Fig. 3
B). Flow cytometric analysis revealed that
the transcriptional up-regulation was accompanied by a strong induction
of fractalkine surface protein expression as compared with unstimulated
GEC (Fig. 3
C). In accordance with observations in HUVEC
(38), these data confirm that fractalkine expression can
be substantially induced by cytokines, such as TNF-
, in GEC. This
contrasts our findings in MC, and thus indicates a striking
cell-specific difference in fractalkine regulation.
|
-stimulated GEC and HUVEC
We then studied monocyte arrest to activated GEC in shear flow.
Treatment of GEC with TNF-
markedly increased firm monocyte arrest
(20.8 ± 2.0 cells/mm2), which was
profoundly diminished by treatment of monocytes with the CXCR2
antagonist GRO-
873 but not
MCP-1976 (Fig. 3
D and data not
shown). Moreover, firm arrest was also markedly reduced by
preincubation of monocytes with soluble fractalkine, and a combination
of PTX and soluble fractalkine had stronger effects than either
substance alone (Fig. 3
D). These data suggest that firm
monocyte arrest to activated GEC is predominantly mediated by CXCR2 and
fractalkine. In contrast, firm monocyte arrest on TNF-
-stimulated
HUVEC (92.8 ± 10.8 cell/mm2) was more
markedly decreased by pretreatment with PTX or
GRO-
873 than by soluble fractalkine and was
more markedly inhibited by cotreatment with soluble fractalkine and PTX
than with either substance alone (Fig. 3
E). These data
reveal a remarkable difference in the involvement of chemokines in
monocyte arrest to endothelial cells from different vascular beds,
although it cannot be excluded that this may also reflect species
differences.
CXCR2 and CCR2 antagonists inhibit the localization of macrophages to inflamed glomeruli in vivo
To study the effects of blocking CXCR2 and CCR2 on glomerular
leukocyte recruitment in vivo, macrophage localization was assessed in
a rat model of glomerular inflammation caused by experimentally induced
NTN. In the control group, the injected macrophages prominently
accumulated in inflamed glomeruli of diseased rats as early as 24
h after induction of NTN (Fig. 4
, A and B). This infiltration was markedly
attenuated when macrophages were pretreated with
MCP-1976 and even more substantially inhibited
after pretreatment with GRO-
873 (Fig. 4
, A and B). By contrast, pretreatment of
macrophages with a CX3CR mAb (15)
was rather ineffective at this early time point, in accordance with
glomerular detection of GRO-
and MCP-1 but not endothelial
fractalkine, which is expressed and involved at later stages (Ref.
19 and data not shown). Consistent with our findings in
vitro, these results show that CCR2 plays an important role in
glomerular infiltration. Notably, the more pronounced inhibition of
glomerular localization by blocking CXCR2 suggests that the initial
arrest triggered by CXCR2 is a crucial prerequisite for subsequent
steps of monocyte extravasation, i.e., diapedesis or retention.
|
| Discussion |
|---|
|
|
|---|
as a culprit of glomerular dysfunction provides
a link between increased glomerular and systemic expression of TNF-
and the perpetuation of glomerular damage (53, 54).
However, the site-specific cellular and molecular mechanisms involved
in the glomerular recruitment of monocytes in response to TNF-
remain to be elucidated.
Successful leukocyte emigration is mediated by the overlapping actions
of multiple signal molecules that are expressed in glomerulopathies and
are known to be inducible by TNF-
(10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 23, 24, 25, 26, 27, 28, 29). Here we confirm previous findings that TNF-
markedly
up-regulated the expression of the chemokines GRO-
, IL-8, and MCP-1
(10, 23, 25, 26, 27). Notably, the up-regulation of these
chemokines resulted in an increase in shear-resistant monocyte adhesion
to TNF-
-stimulated MC. Monocyte arrest was significantly inhibited
by PTX, indicating that integrin activation by signaling via
G
i protein-coupled
receptors is involved as seen with lymphocyte arrest on high
endothelial venules (55).
Chemokines can be immobilized on cell surfaces via heparan sulfate or
related glycoproteins or secreted as soluble molecules
(7, 8, 9). Immunofluorescence staining revealed that upon
TNF-
stimulation of MC, GRO-
, and IL-8 but not MCP-1 are
presented on the MC surface via binding to heparan proteoglycans,
whereas MCP-1 was secreted as a soluble protein. This differential
immobilization pattern was associated with a major involvement of the
GRO-
receptor CXCR2 in firm monocyte arrest on TNF-
-activated MC,
but not the MCP-1 receptor CCR2 and RANTES receptors, as shown by
blocking with peptide antagonists. Moreover, blocking IL-8 produced by
MC decreased monocyte arrest to activated MC to a lesser extent than
blocking CXCR2, suggesting a contribution of both GRO-
and IL-8.
Inhibition of CXCR2 also decreased monocyte arrest on activated GEC.
Monocytes exhibit higher surface expression of CXCR2 than CXCR1
(56), supporting that CXCR2 which binds both GRO-
and
IL-8 is the predominant receptor involved in inducing monocyte arrest.
Thus, our data clearly extend the principle that immobilized
chemokines, such as GRO-
and IL-8 and their receptor CXCR2, but not
soluble chemokines, such as MCP-1, are crucial for mediating firm
arrest of monocytes and neutrophils (5, 7).
MCP-1 and its receptor CCR2 may be more important in directing monocyte
migration, as observed on activated HUVEC (7). Indeed,
CCR2 was predominant in mediating transendothelial chemotaxis toward
activated MC, implicating soluble MCP-1 in this process. In contrast,
CXCR2 was less important for transmigration in this system, suggesting
minor roles for soluble IL-8 and GRO-
. Although chemoattractants can
trigger leukocyte adhesiveness both in a soluble or surface-bound form
depending on local concentrations achieved (5, 6, 7), we have
demonstrated that soluble MCP-1 is crucially involved in attraction of
monocytes to MC, whereas surface-associated GRO-
and IL-8 mediate
subsequent sequestration of monocytes on MC.
The CX3C chemokine fractalkine has recently been
detected in nephritic rat glomeruli and has been implicated in
leukocyte recruitment in crescentic glomerulonephritis
(15). While the soluble chemokine domain of fractalkine is
an effective chemotactic agent for leukocytes, fractalkine may also
trigger a PTX-insensitive and Ca2+- and
integrin-independent arrest of cells when immobilized on the cell
surface (38, 57, 58, 59). We have observed that TNF-
stimulation did not up-regulate expression of fractalkine mRNA and
surface-expressed protein in MC. In contrast, activation of GEC led to
a marked increase in fractalkine transcription, as has been found with
stimulated HUVEC (38). While playing a minor role in
monocyte sequestration on MC, fractalkine and
CX3CR were involved in shear-resistant monocyte
arrest to activated GEC, possibly explaining effects of
immunoneutralizing CX3CR in the prevention of
crescentic glomerulonephritis (15). Moreover, a
combination of PTX and CX3CR desensitization
additively inhibited monocyte arrest on GEC, inferring that G
protein-independent effects of fractalkine, and G protein-dependent
signaling by other chemokines, e.g., GRO-
, both contribute to
monocyte arrest on GEC. Together, these data suggest that while
fractalkine may act as a supportive, noninducible signal for monocyte
adhesion to MC, its interactions with CX3CR may
play an integral part in enabling firm monocyte arrest on GEC in
shear flow.
While the expression of MCP-1, MIP-1, CINC, RANTES, or fractalkine is
profoundly increased, immunoneutralization of
CX3CR, MIP-1, or CINC have been shown to suppress
leukocyte infiltration and proteinuria in early phases of NTN
(10, 14, 15, 19, 20). In vivo experiments in a telescoped
rat model of NTN further confirmed a combinatorial involvement of
chemokine receptors in glomerular recruitment of monocytes/macrophages.
The induction of calcium influx in rat macrophages was stimulated by
human GRO-
and was inhibited by GRO-
873,
suggesting a sufficient homology and reactivity for cross-species
studies. This extends previous findings that the human RANTES receptor
antagonist Met-RANTES effectively reduces renal transplant rejection in
a rat model (60). Glomerular macrophage infiltration in
the early phase of NTN was markedly reduced by antagonizing CCR2 and
even more drastically inhibited by antagonizing CXCR2, which is
expressed by activated macrophages (61). Together with the
in vitro data, this implies a sequential action of these chemokine
receptors in which CXCR2-triggered arrest to inflamed endothelium is
the initially critical and rate-limiting event prerequisite to
subsequent migration. Notably, in vivo macrophage localization was
considerably more inhibited by GRO-
873 than
by blocking
2 integrins or their ligands and
is consistent with an additive effect of PTX and GRO-
in inhibiting
arrest in vitro (D. C. Kluth, A. Zernecke, C. Weber, and A. J.
Rees, unpublished data). This indicates that GRO-
may act
through PTX-sensitive activation of integrin binding but may also serve
as a direct adhesive bond as has been suggested for fractalkine. Our
results extend findings in knockout models revealing an important role
for CXCR2 in macrophage infiltration of atherosclerotic lesions
(62) and demonstrate for the first time the crucial
involvement of CXCR2 and its ligands in the inflammatory recruitment
during glomerulonephritis.
The inhibition of inflammatory recruitment in our NTN model by the CCR2
antagonist was consistent with previous data showing that a MCP-1 Ab
can suppress leukocyte infiltration and ameliorate proteinuria in the
early phases of murine NTN (14) and that a CCR2 knockout
exerts protective effects on day 1 of an accelerated murine NTN model
(18). Notably, increased severity was observed at day 3
both in CCR1 and CCR2 knockout mouse models (17, 18). By
contrast, CX3CR Ab treatment was less effective
at day 1 than at later time points in our experiments. This is
suggestive of a preferential involvement of varying key chemokines
during distinct stages during disease progression, i.e., GRO-
and
MCP-1 may be crucial at early stages, while fractalkine may become
relevant at later time points. Alternatively, fractalkine may act to
attract cells from the less marginal circulation to the proximity of
the endothelial surface, where highly inducible and immobilized
chemokines acting via CXCR2 provide the ultimate signal for firm
arrest. Finally, it may be conceivable that an early engagement of a
specific receptor results in a pro- or anti-inflammatory commitment
that may only become effective in subsequent disease stages.
Our results indicate that a sequence of combinatorial mechanisms
enacted by chemokines and their receptors drive glomerular monocyte
infiltration. While fractalkine and GRO-
may synergize to mediate
initial firm arrest of monocytes on GEC, soluble gradients of MCP-1 and
possibly IL-8 established and maintained by secretion of underlying MC
direct transendothelial diapedesis of monocytes toward MC, and
presentation of immobilized GRO-
and IL-8 support the localization
and sequestration of monocytes on MC in the glomerular compartment.
This is the first concept of a site-specific multistep model for the
regulation of inflammatory monocyte recruitment by functionally
specialized chemokines in renal disease and may help envision more
finely tuned applications for chemokine (receptor) antagonists to
target specific inflammatory processes.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Christian Weber, Pettenkoferstrasse 9, D-80336 Munich, Germany. ![]()
3 Abbreviations used in this paper: NTN, nephrotoxic nephritis; CXCR, CXC chemokine receptor; GRO, growth related activity; MCP-1, monocyte chemotactic protein-1; CINC, cytokine-induced neutrophil chemoattractant; MIP, macrophage inflammatory protein; MC, mesangial cells; GEC, glomerular endothelial cells; PTX, pertussis toxin; RT, room temperature. ![]()
Received for publication September 5, 2000. Accepted for publication February 20, 2001.
| References |
|---|
|
|
|---|
4
1 and
5
1 integrin avidity by CC chemokines in monocytes: implications for transendothelial chemotaxis. J. Cell Biol. 134:1063.
and tumor necrosis factor-
induce gene expression and production of leukocyte chemotactic factors, colony-stimulating factors, and interleukin-6 in human mesangial cells. Am. J. Pathol. 138:991.[Abstract]
induces expression of the chemoattractant cytokine RANTES in cultured mouse mesangial cells. Kidney Int. 44:795.[Medline]
B mobilization and induction of vascular cell adhesion molecule-1 in endothelial cells stimulated to generate radicals. Arterioscler. Throm. 14:1665.
B mobilization and monocyte adhesion in stimulated human endothelial cells. Circulation 91:1914.
B-
. Blood 11:3685.
B activation and monocyte chemoattractant protein-1 synthesis. J. Immunol. 161:430.
1 and
2 integrin avidity by chemoattractants in eosinophils. Proc. Natl. Acad. Sci. USA 93:10939.
-stimulated endothelial cells under physiological flow conditions. Blood 89:4104.
and a protease inhibitor reduce immune glomerular injury. Kidney Int. 40:43.[Medline]
This article has been cited by other articles:
![]() |
D. Onan, E. H. Allan, J. M. W. Quinn, J. H. Gooi, S. Pompolo, N. A. Sims, M. T. Gillespie, and T. J. Martin The Chemokine Cxcl1 Is a Novel Target Gene of Parathyroid Hormone (PTH)/PTH-Related Protein in Committed Osteoblasts Endocrinology, May 1, 2009; 150(5): 2244 - 2253. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hundhausen, A. Schulte, B. Schulz, M. G. Andrzejewski, N. Schwarz, P. von Hundelshausen, U. Winter, K. Paliga, K. Reiss, P. Saftig, et al. Regulated Shedding of Transmembrane Chemokines by the Disintegrin and Metalloproteinase 10 Facilitates Detachment of Adherent Leukocytes J. Immunol., June 15, 2007; 178(12): 8064 - 8072. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hristov, A. Zernecke, K. Bidzhekov, E. A. Liehn, E. Shagdarsuren, A. Ludwig, and C. Weber Importance of CXC Chemokine Receptor 2 in the Homing of Human Peripheral Blood Endothelial Progenitor Cells to Sites of Arterial Injury Circ. Res., March 2, 2007; 100(4): 590 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. H. Rao, D. T. Meehan, D. Delimont, M. Nakajima, T. Wada, M. A. Gratton, and D. Cosgrove Role for Macrophage Metalloelastase in Glomerular Basement Membrane Damage Associated with Alport Syndrome Am. J. Pathol., July 1, 2006; 169(1): 32 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-N. Chen, S.-F. Chang, P.-L. Lee, K. Chang, L.-J. Chen, S. Usami, S. Chien, and J.-J. Chiu Neutrophils, lymphocytes, and monocytes exhibit diverse behaviors in transendothelial and subendothelial migrations under coculture with smooth muscle cells in disturbed flow Blood, March 1, 2006; 107(5): 1933 - 1942. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Yang, I-M. Fang, C.-P. Lin, C.-M. Yang, and M.-S. Chen Effects of the NF-{kappa}B Inhibitor Pyrrolidine Dithiocarbamate on Experimentally Induced Autoimmune Anterior Uveitis Invest. Ophthalmol. Vis. Sci., April 1, 2005; 46(4): 1339 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Tarlowe, A. Duffy, K. B. Kannan, K. Itagaki, R. F. Lavery, D. H. Livingston, P. Bankey, and C. J. Hauser Prospective Study of Neutrophil Chemokine Responses in Trauma Patients at Risk for Pneumonia Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 753 - 759. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weber, A. Schober, and A. Zernecke Chemokines: Key Regulators of Mononuclear Cell Recruitment in Atherosclerotic Vascular Disease Arterioscler. Thromb. Vasc. Biol., November 1, 2004; 24(11): 1997 - 2008. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Henke, A. Varga, S. De, C. B. Deatrick, J. Eliason, D. A. Arenberg, P. Sukheepod, P. Thanaporn, S. L. Kunkel, G. R. Upchurch Jr, et al. Deep Vein Thrombosis Resolution Is Modulated by Monocyte CXCR2-Mediated Activity in a Mouse Model Arterioscler. Thromb. Vasc. Biol., June 1, 2004; 24(6): 1130 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kruger, D. Benke, F. Eitner, A. Lang, M. Wirtz, E. E. Hamilton-Williams, D. Engel, B. Giese, G. Muller-Newen, J. Floege, et al. Identification and Functional Characterization of Dendritic Cells in the Healthy Murine Kidney and in Experimental Glomerulonephritis J. Am. Soc. Nephrol., March 1, 2004; 15(3): 613 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Chen, M.-I Hu-Tsai, S.-L. Lin, T.-J. Tsai, and B.-S. Hsieh Expression of CX3CL1/fractalkine by mesangial cells in vitro and in acute anti-Thy1 glomerulonephritis in rats Nephrol. Dial. Transplant., December 1, 2003; 18(12): 2505 - 2514. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Z. Simkhovich, P. Marjoram, C. Poizat, L. Kedes, and R. A. Kloner Brief episode of ischemia activates protective genetic program in rat heart: a gene chip study Cardiovasc Res, August 1, 2003; 59(2): 450 - 459. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Miller, R. M. Strieter, A. D. Gruber, S. B. Ho, and N. W. Lukacs CXCR2 Regulates Respiratory Syncytial Virus-Induced Airway Hyperreactivity and Mucus Overproduction J. Immunol., March 15, 2003; 170(6): 3348 - 3356. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Radeke, I. Janssen-Graalfs, E. N. Sowa, N. Chouchakova, J. Skokowa, F. Loscher, R. E. Schmidt, P. Heeringa, and J. E. Gessner Opposite Regulation of Type II and III Receptors for Immunoglobulin G in Mouse Glomerular Mesangial Cells and in the Induction of Anti-glomerular Basement Membrane (GBM) Nephritis J. Biol. Chem., July 19, 2002; 277(30): 27535 - 27544. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zernecke, K. S. C. Weber, and C. Weber Combined modulation of the mesangial machinery for monocyte recruitment by inhibition of NF-kappa B Am J Physiol Cell Physiol, December 1, 2001; 281(6): C1881 - C1888. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |