The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kingsbury, G. A.
Right arrow Articles by Villeval, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kingsbury, G. A.
Right arrow Articles by Villeval, J. L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*OMIM*Protein
*UniGene
The Journal of Immunology, 2001, 166: 5675-5680.
Copyright © 2001 by The American Association of Immunologists

Cloning, Expression, and Function of BLAME, a Novel Member of the CD2 Family

Gillian A. Kingsbury1, Lee Ann Feeney, Yuhua Nong, Susan A Calandra, Curran J. Murphy, Justin M. Corcoran, Yanjun Wang, Mercy R. Prabhu Das, Samantha J. Busfield2, Christopher C. Fraser and Jean Luc Villeval

Millennium Pharmaceutical, Cambridge, MA 02139


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CD2 family is a growing family of Ig domain-containing cell surface proteins involved in lymphocyte activation. Here we describe the cloning and expression analysis of a novel member of this family, B lymphocyte activator macrophage expressed (BLAME). BLAME shares the structural features of the CD2 family containing an IgV and IgC2 domain and clusters with the other family members on chromosome 1q21. Quantitative PCR and Northern blot analysis show BLAME to be expressed in lymphoid tissue and, more specifically, in some populations of professional APCs, activated monocytes, and DCs. Retroviral forced expression of BLAME in hematopoietic cells of transplanted mice showed an increase in B1 cells in the peripheral blood, spleen, lymph nodes, and, most strikingly, in the peritoneal cavity. These cells do not express CD5 and are CD23lowMac1low, characteristics of the B1b subset. BLAME may therefore play a role in B lineage commitment and/or modulation of signal through the B cell receptor.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Members of the CD2 family, a subset of the Ig superfamily (1), function as coreceptors for lymphoctye activation and/or adhesion. The family currently consists of CD2 (LFA-2) (2), CD48 (Blast-1, BCM-1, OX-45) (3), CD58 (LFA-3), CD84 (4), CD150 (signaling lymphocyctic activation molecule (SLAM)3) (5, 6), Ly-9 (7), and CD244 (2B4) (8, 9). Members have been defined primarily by homology and structural features, each consisting of an Ig variable-like domain and a membrane proximal Ig constant-2 domain (5). The exception is Ly-9, which contains two pairs of IgV-C domains. The cytoplasmic domains of CD150, CD84, CD244, and Ly-9 also contain some homology, most notably, multiple copies of the tyrosine-based motif TxYxxV/I/A. Disregulated signaling through SAP/SH2DIA (SLAM-associated protein/SH domain-containing gene 1A), which binds to this tyrosine-based motif, is thought to contribute to the phenotype of a sometimes fatal immunodeficiency X-linked lymphoproliferative syndrome (10, 11).

The genes encoding these proteins are found in two pericentric loci in humans, 1p13 (CD2 and CD58) (11) and 1q21–24 (CD48, CD84, CD150, CD244, and Ly-9) (12, 13). In the mouse, CD244, Ly-9, and CD48 are clustered on chromosome 1 (14), and CD2 is found on chromosome 3.

The ligands for CD2 family members that have been identified are within the CD2 family, CD2 to CD58 in humans (15) or CD48 in rodents (16), CD48 to CD244 (17), and the homotypic interaction of CD150 with itself (18). CD84 and Ly-9 are currently orphans.

CD2 is expressed on the surface of T cells and on NK cells (19). The extracellular domain of CD2 is an important adhesion molecule for the initial transient interaction of the T cell with an APC (20). Activation of the TCR by a MHC Ag complex leads to recruitment of CD2AP, an SH3 domain-containing adaptor protein, to the cytoplasmic tail of CD2. This leads to CD2 clustering and helps in the formation of the "immunological synapse" (21). Conversely, CD2 cross-linking has been shown to recruit the adaptor protein CD2BP1, which binds to the same region of the cytoplasmic domain of CD2 and is thought to down-regulate CD2-mediated adhesion (22). The ligand for CD2, CD58, is widely expressed on both hematopoetic and nonhematopoetic tissue.

Signaling via CD244 and CD150 involves competition between SAP and SHP-2 (SH2-domain containing protein tyrosine phosphatase 2) for binding to the tyrosine-based motifs (11, 23). CD244 is expressed on NK cells, CD8 T cells, and {gamma}{delta} T cells. Ligation of CD244 on NK cells by CD48 on target leukocytes results in an increase in target cell lysis. Although ligation of CD244 on CD8 cells does not increase their cytolytic activity, CD8+CD244+ cells have been shown to be responsible for non-MHC-restricted "natural" cytotoxicity (24). CD150 is expressed on activated T and B cells. Ligation on T cells results in costimulation of activation and an increase in IFN-{gamma} secretion (25), but not the Th2-type cytokines IL-4 and IL-5, and on B cells induces proliferation and Ig secretion (26).

CD84 and Ly-9 contain two tyrosine-based domains; however, they are currently orphans and their function is unclear. CD84 is expressed on B cells, thymocytes, memory T cells, monocytes, and platelets, and Ly-9 is found on thymocytes, T and B cells, and bone marrow lymphoid cells (27, 28). The remaining two family members, CD58 and CD48, are GPI-linked membrane proteins and so contain no cytoplasmic domains (13).

Several members of the family exist in different forms. Splice variants of CD150, CD244, and CD84 can be found with different cytoplasmic domains containing three or one, four or one, and two or zero tyrosine-based motifs respectively (6, 29, 30). In addition, there is a predicted secreted form of CD150 (26) and a transmembrane form of CD58 with a cytoplsmic domain of 12 amino acids containing no obvious signaling motifs.

In this paper, we describe the cloning, expression analysis, and possible function of a novel member of this family, B lymphocyte activator macrophage expressed (BLAME).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning BLAME

Mixed lymphocyte response library. Approximately 100 ml of blood was collected from 24 healthy donors with informed consent, and PBMCs were isolated by Ficoll gradient. Total lymphocytes were cultured at 1 x 107 cells/ml in RPMI 1640 with 10% FCS. Equal numbers of starting cells were harvested at 4, 8, and 24 h, and RNA was purified using standard techniques. The cDNA library was prepared as previously described (31).

Identification of human BLAME and the mouse ortholog and isolation of full-length clones. The MLR library was studied by high throughput single-pass sequencing and computer analysis. BLAME was originally identified by basic local alignment search tool analysis (32) as a homologue of SLAM (6), and a full-length clone was identified. The mouse ortholog was identified in the Millennium Pharmaceutical database as a full-length clone in a lung library from a mouse asthma model 3 h after Ag challenge (33)

Mapping. The chromosomal location of BLAME was mapped using the Genebridge 4 Human Radiation Hybrid mapping panel (Research Genetics, Huntsville, AL) with GGTACTGAGGCACTCTAGAATC as the forward primer and GGGTGAGAGAAACTGTGAACC as the reverse primer (34). PCR products were run on a 2% agarose gel and scored for the presence or absence of the band in each of the 93 cell line DNAs. The results were analyzed using Map Manager software program.

Expression of BLAME in human leukocytes

TaqMan analysis. PBMC and granulocytes were isolated from whole blood using Ficoll-Hypaque density gradient centrifugation. Whole blood was centrifuged in a step gradient of Ficoll at 1.077 and 1.119 g/ml. PBMCs were isolated from the interface between the plasma and the 1.077g/ml Ficoll layer; granulocytes were isolated from the lower interface. Both cell layers were depleted of erythrocytes and washed before activation or subsequent isolation of cell populations. Individual cell populations (CD3, CD4, CD8, CD14, and CD19) were isolated using Abs to respective cell surface markers conjugated to magnetic beads and passed through separation columns (Miltenyi Biotec, Auburn, CA). PBMC and T cells were activated with PHA (5 µg/ml), and CD14 cells were activated with LPS (100 ng/ml). Cells were cultured in RPMI 1640 medium with 10% FCS (Sigma, MO) supplemented with 2 mM L-glutamine, 0.1 mM nonessential amino acids, and 1 mM sodium pyruvate (Life Technologies, Rockville, MD).

Dendritic cells (DC) were differentiated from two sources, bone marrow-derived CD34+ cells to give DC 1 or CD14+ monocytes to give DC 2, as shown in Fig. 3Gob. Bone marrow-derived DC 1 were propagated from CD34+ cells cultured with GM-CSF (100 ng/ml), stem cell factor (SCF; 120 ng/ml), and TNF-{alpha} (10 ng/ml) for 7 days (35, 36, 37). CD1a+ cells were sorted, and fresh cytokines (GM-CSF and TNF-{alpha}) were added to replenish the medium. Cells were grown for 15–17 more days, stained for FACS analysis, and lysed for RNA isolation. CD14+-derived DC 2 were generated according to the method of Sallusto and Lanzavecchia (38) and Pickl et al. (39). Monocytes were cultured in medium containing GM-CSF (50 ng/ml; R&D Systems, Minneapolis, MN) and IL-4 (50 ng/ml; PeproTech, Rocky Hill, NJ) for 12–14 days, replacing half of the medium every 3 days. Cells were stimulated with TNF-{alpha} (100 ng/ml) for 4 days to promote maturation; they were then activated with LPS (1 µg/ml) for 24 h. These cells were CD83+ after LPS stimulation.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of BLAME in human lymphoid tissue and white blood cells. Northern blot (a, c, and d) and TaqMan (b) analysis of BLAME expression in human lymphoid tissue (a), stimulated and unstimulated purified leukocyte populations (b) as described in Materials and Methods, PBLs stimulated for 4 h with cytokines (c), and purified peripheral blood monocytes unstimulated or stimulated with IFN-{gamma} or LPS (ng/ml) for 4 h (d).

 
Th1 and Th2 cells were differentiated according to Sornasse et al. (40).

Total RNA was prepared from purified cells by a single-step extraction method using RNA STAT-60 according to the manufacturer’s instructions (Tel-Test, Friendswood, TX). Each RNA preparation was treated with DNase I (Ambion, Austin, TX) at 37°C for 1 h. DNase I treatment was determined to be complete if the sample required at least 38 PCR amplification cycles to reach a threshold level of fluorescence using {beta}2-microglobulin as an internal amplicon reference. After phenol extraction, cDNA was prepared from the sample using the SuperScript Choice System following the manufacturer’s instructions (Life Technologies).

BLAME expression was measured by TaqMan quantitative PCR (Applied Biosystems, Foster City, CA). PCR probes designed by PrimerExpress software (Applied Biosystems) were as follows: {beta}2-microglobulin forward primer, CACCCCCACTGAAAAAGATGA; {beta}2-microglobulin probe, ATGCCTGCCGTGTGAACCACGTG; {beta}2-microglobulin reverse primer, CTTAACTATCTTGGGCTGTGACAAAG; BLAME reverse primer, GCCTAAGGACTTTCAGGTAATCAGAGT; BLAME probe, CATGGGCCCTCAAAGGTAAATTGCAGT; and BLAME forward primer, TGTCAACCATCCTCGGTGTCTA.

BLAME probe was labeled using 6-carboxyfluorescein, and the {beta}2-microglobulin probe was labeled with VIC. Each reaction contained 200 nM of forward and reverse primers plus 100 nM probe for {beta}2-microglobulin and 600 nM forward and reverse primers plus 200 nM probe for BLAME, and reactions were conducted in TaqMan Universal PCR Master Mix (Applied Biosystems) using an ABI PRISM 7700 Sequence Detection System (Applied Biosystems). Conditions were as follows: hold for 2 min at 50°C and 10 min at 95°C, followed by two-step PCR for 40 cycles of 95°C for 15 s followed by 60°C for 1 min.

{Delta}Ct value (expression of BLAME relative to {beta}2-microglobulin) was calculated using the following formula: {Delta}Ct = CtBLAME - Ct{beta} -2 microglobulin. The {Delta}Ct value (expression of BLAME compared with a control tissue) for each tissue sample was calculated according to the following formula: {Delta}Ct = {Delta}Ctsample - {Delta}Ctcalibrator. Relative expression was then calculated using the arithmetic formula given by 2-{Delta}{Delta}Ct.

Northern blot analysis. Human poly(A)+ immune blot (Clontech Laboratories, Palo Alto, CA) was probed using a 32P-labeled probe corresponding to aa 1–233 of human BLAME according to the manufacturer’s instructions.

Total PBMCs were stimulated for 4 h in RPMI 1640 with 10% FCS supplemented with IL-2, IL-6, IL-9, IL-12, IFN-{gamma} (10 ng/ml), IL-10, TGF-{beta}, IL-5 (20 ng/ml), IL-4 (40 ng/ml), or TNF-{alpha} (100 U/ml). Resting monocytes were isolated from PBMCs by Percol gradient centrifugation and were >90% CD14+. CD4+, CD8+, and CD19+ cells were isolated from PBMCs by positive selection using MACS magnetic beads according to manufacturer’s protocols (Miltenyi Biotec). Monocytes were stimulated for 4 h in RPMI 1640 with 10% FCS with or without LPS or IFN-{gamma}. RNA was prepared using RNeasy Mini Kit (Qiagen, Chatsworth, CA) according to the manufacturer’s instructions, and Northern blots were probed as for commercial blots.

Overexpression of BLAME in bone marrow-reconstituted irradiated mice

Construction and production of retroviruses. Full-length BLAME was PCR amplified to introduce unique 5' XhoI and a 3' EcoRI restriction sites and a Kozak sequence (ACCGCC) in the original cDNAs (Advantage-HF kit; Clontech Laboratories). The PCR products were ligated into the murine stem cell virus Neo retroviral vector (41), and clones were sequenced and selected for base-perfect match with the original cDNA. Viral supernatants were generated into the 293-EBV nuclear Ag cells (Invitrogen, Carlsbad, CA) by cotransfecting three constructs: the BLAME retroviral construct or control (empty murine stem cell Neo EB virus), pN8{epsilon} vector containing the gag/pol genes from the murine Moloney leukemia virus, and a pN8{epsilon} vector containing the vesicular stomatitis virus envelope glycoprotein G gene. Concentrated viral supernatants were prepared by centrifugation for 2 h at 50,000 x g (SW28 rotor, 25,000 rpm) at 4°C. Pellets were resuspended in DMEM with 10% FCS (Stem Cell Technologies, Vancouver, Canada), shaken at 4°C for 24 h, filtered, and frozen at -80°C.

Infection procedure. Bone marrow cells were collected from C57BL/6 SJL mice (Taconic Farms, Germantown, NY) 4 days after 5-fluorouracil treatment of 150 mg/kg administrated i.v. Lin- cells were selected using a MACS depletion column (type BS; Miltenyi Biotec). Briefly, cells were labeled with a mixture of four FITC-conjugated Abs against CD3{epsilon}, CD11b, CD45R, and Ly-6G (BD PharMingen, San Diego, CA). Cells were washed and incubated with anti-FITC microbeads (Miltenyi Biotec). Labeled cells were removed using depletion columns according to manufacturer’s instructions. After separation, Lin- cells were washed and resuspended in DMEM with 10% FCS.

Before infection, Lin- cells (106 cells/ml) were prestimulated with recombinant mouse (rm)IL-3 (10 ng/ml; Endogen, Woburn, MA), rmIL-6 (10 ng/ml; Endogen), rmSCF (100 ng/ml; R&D Systems), rm fms-like tyrosine kinase-3 ligand (100 ng/ml; R&D Systems) and mouse thrombopoietin (102 U/ml, conditioned medium) for 2 days. Cells were centrifuged, resuspended in DMEM with 10% FCS and viral supernatant (1/1 v/v) in the presence of rmIL-3, rmIL-6, rm-SCF, rm fms-like tyrosine kinase-3 ligand, and thrombopoietin, and incubated at 37°C, 10% CO2. This infection procedure was repeated 24 h later and 4 h after this second infection, the cells were collected, washed twice, and injected into lethally irradiated C57BL/6 mice (9.5 Gy; {gamma} rays generated by cobalt source).

Analysis of mice. Major organs were harvested and tissue fixed in 10% buffered formalin stained with hematoxylin and eosin and subject to histologic analysis. Tissue examined included skin, kidneys, sternum, uterus, thymus, bladder, heart (weighed), ovaries, lungs, skeletal muscle, thyroid/parathyroid, femur, brain (weighed), brown and white fat, pituitary, head, eyes, diaphragm, aorta, spleen (weighed), stomach, intestines, liver (weighed), and adrenals.

RNA expression of BLAME was confirmed in the spleens of the transduced mice using a slot blot analysis (Slot Blot Manifold, Amersham Pharmacia Biotech, Piscataway, NJ). Total RNA (5 µg/sample) was loaded onto duplicated membranes using the slot blot apparatus. The membranes were washed with 10x SSC and irradiated with an UV transilluminator. Hybridization was conducted using 75 ng of randomly 32P-labeled (Rediprime; Amersham Pharmacia Biotech) BLAME (0.7 kb corresponding to the extracellular domain) or GAPDH (1.2 kb) cDNA probes displaying similar specific activities. After washing, signals were analyzed using a phosphoimager (Fujifilm BAS-2500; Fuji Medical Systems, Stamford, CT). Using the same virus containing a green fluorescent protein (GFP) gene in place of the BLAME gene, we found that 74 ± 6% of the peripheral blood cells were GFP positive when mice were studied 15 wk after transplantation. Among these cells, similar percentages of GFP-positive cells were found in the Mac1+ population (87 ± 6%), the CD3+ population (67 ± 8%) and the B220+ cell populations (74 ± 8%). This result strongly suggests that the ectopic expression of BLAME is observed in all hematopoietic cell populations, including macrophages, T cells, and B cells.

Blood was collected from the tail vein or at necropsy by heart puncture. RBC were lysed, and FACS was conducted using FITC, PE, and CyChrome directly conjugated Abs from BD PharMingen according to the manufacturer’s instructions. Peritoneal lavage was conducted at necropsy by washing the peritoneum twice with 2 ml PBS. All FACS was gated for viable leukocytes on the basis of forward and side scatter.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BLAME is a novel cell surface protein of the CD2 family

BLAME was originally cloned from a human MLR library. The open reading frame encodes a 28 amino acid protein (Fig. 1Go) with a 22 amino acid leader sequence predicted by signal P (42). The mature protein is a type 1 transmembrane protein with a 212 amino acid extracellular domain, 21 amino acid transmembrane domain (predicted by MEMSAT (43)), and a short 31 amino acid cytoplasmic tail. Using the HMMER software (44) and the PFAM database of models (45), the extracellular domain was shown to contain the two Ig-like domains typical of the CD2 family, an N-terminal IgV-like fold that does not contain the conserved disulfide bonds, and a membrane proximal C2-like fold. There are no distinctive signaling motifs in the intracellular domain; in particular, the consensus SAP/SH2D1A binding site does not appear to be present. The mouse ortholog shows 75% identity on the amino acid level with human BLAME. BCM-like membrane protein precursor was recently entered in to the public data base (GenBank accession number AAF67470) and is identical with BLAME except for one amino acid (S99 to G).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. Sequence of mouse and human BLAME. Amino acid sequence of mouse and human BLAME. Putative signal peptides are in italics and transmembrane domains are in bold.

 
Clustal analysis of the human CD2 family shows BLAME to be most closely related to CD48. Comparison of the extracelluar domain of the mature protein (that is without the signal peptide as predicted by signal P or the transmembrane and intracellular domains) shows BLAME to be most closely related to CD58 (Fig. 2Go). Interestingly, CD48 and CD58 are currently the only two members of the family that, like BLAME, have no cytoplasmic signaling motifs. Annotated as an early response gene that encodes an Ig superfamily member with structural similarity to CD2, 19A (GenBank accession number CAB81950) was included in this analysis.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. Homology between BLAME and other CD2 family members. Results as predicted by clustal analysis. Dendograms showing relationship of the (A) full-length or (B) extracellular domains (as predicted by MEMSAT (43 )) of CD2 family members.

 
The human BLAME mapping indicated that the gene was located at chromosomal location hu1q21 (with synteny to mouse chromosome 3). This region of chromosome 1 (1q21–24) also contains multiple other family members: CD48, CD84, CD150, CD244, and Ly-9 (12) (13).

Expression

Human immune Northern blot analysis revealed two transcripts of ~2 and 3.5 kb (Fig. 3Goa). In the lymph node, spleen, thymus, and bone marrow, the smaller transcript was more abundant, and highest BLAME expression was seen in lymph node. To identify the specific cell types expressing BLAME, we used real-time quantitative PCR and primers/probes within the 3' untranslated region of BLAME. Significant expression was seen in PBMCs, monocytes, and certain DCs (Fig. 3Gob). However, Northern blot analysis showed no detectable expression in resting PBMCs. Using 4 h of stimulation with a variety of cytokines, we found that BLAME was induced by IFN-{gamma} (Fig. 3Goc). In fact, purification of monocytes by adhesion to plastic provided sufficient stimulation to induce relatively high expression (data not shown), and all additional experiments were conducted using resting monocytes purified by Percoll gradient. Northern blot analysis of isolated monocytes stimulated with IFN-{gamma} (but not LPS) confirmed the data generated using the sensitive TaqMan technique suggesting that BLAME is expressed in activated monocytes (Fig. 3God).

Therefore, BLAME is expressed on at least two populations of professional APCs, DCs, and activated monocytes.

Retroviral forced expression of BLAME in vivo using bone marrow reconstitution of lethally irradiated mice

To investigate the in vivo function of BLAME, we used reconstitution of lethally irradiated mice with retrovirally infected bone marrow to give expression of mouse BLAME in all hematopoietically derived cells. As a control, empty vector was used. Mice were examined between 8 and 16 wk after bone marrow transplantation, when a full hematopoietic reconstitution from these infected cells is expected. Fifty-four percent of progenitor cells were infected with virus as evaluated by resistance to G418 in methyl cellulose cultures (data not shown). The level of BLAME RNA in the spleen of transduced mice was ~10 times that found in control mice (~3 times GAPDH RNA level for BLAME mice compared with 0.3 times GAPDH RNA for endogenous BLAME level in control mice).

The mice showed normal blood cell counts (white blood cells, RBC, platelets, neutrophils, lymphocytes, monocytes, eosinophils, and basophils), and lymphoid organs (spleen, peripheral lymph nodes, and thymus) were normal size and showed no gross alteration in architecture. Pathologic examination of a panel of major organs showed no differences from control animals. However, FACS analysis of peripheral blood using a panel of Abs (CD3/NK1.1, CD4/CD8, GR1/Mac1, and B220/IgD) in combination with a marker for donor cells (CD45.1) showed an increase in Mac1low (Mac1low compared with Mac1high levels on monocytes) and B220+/IgD+ cells. Further analysis by three-color staining revealed that these were in fact the same population of Mac1lowB220+IgD+ cells and that the increase was statistically significant (p = 0.006; Fig. 4Go). Mac1 is not normally expressed by peripheral B cells; however, it is expressed on B1 cells, which are usually found primarily in the peritoneum. FACS analysis of the peritoneal lavage showed that this population of Mac1lowB220+IgD+ cells was greatly increased (an average of 21.5% in control mice compared with an average of 59.5% in BLAME mice; SD 7.6 and 5.0, respectively; p = 0.0001). The spleen showed a less dramatic but still statistically significant increase in B1 cells (an average of 9.2% in control mice compared with an average of 12.6% in BLAME mice; SD 2.3 and 1.0, respectively; p = 0.04), whereas thymus and bone marrow were similar to control. Three-color FACS analysis showed the cells to be predominantly B220+Mac1+CD5-CD23lowIgD+ cells (Fig. 5Go), which is the phenotype of B1b "sister" cells. Both B220 and IgD expression levels are slightly lower than in B cells of control mice, as one would expect for B1b cells. In addition, the total percentage of B cells in the peritoneal lavage, as defined by expression of surface Ig, was increased from 46% (SD 9.7) to 73% (SD 9.7). This phenotype was duplicated in three separate experiments with five mice per group in each experiment.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 4. Increase in B220+Mac1low cells of blood, spleen, and peritoneal lavage of mice overexpressing BLAME in bone marrow-derived cells. Peripheral blood, spleen, and peritoneal lavage cells were stained for expression of B220 (CD45R) and Mac1 (CD11b) 12 wk after adoptive transfer of BLAME retrovirally infected bone marrow.

 


View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 5. The increased B cell population in BLAME overexpressing mice are B1b sister cells. Peritoneal lavage cells were harvested 12 wk after adotptive tranfer from mice reconstituted with bone marrow infected with control or BLAME retrovirus. Cells were gated for viability on the basis of forward and side scatter and analyzed for expression of B220 (CD45R), Mac1 (CD11b), CD5-, CD23, and IgD. B1b sister cells are B220+Mac1+CD5-CD23lowIgD+

 
Serum titers of blood from BLAME and control retroviral mice at 7 and 11 wk after reconstitution showed no differences in total IgM or IgG (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Two B cell lineages can be readily distinguished on the basis of cell surface markers, Ab repertoire, and anatomic location (46). Conventional B2 cells are found predominantly in the spleen, lymph nodes, and blood, whereas B1 cells are predominantly found in the peritoneal and pleural cavities. B1 cells can be further divided on the basis of CD5 expression. B1a cells express CD5, and B1b sister cells are CD5 negative. These three lineages have previously been shown to develop independently and will replenish their own populations on adoptive transfer (47). B2 cells are bone marrow derived, whereas B1 cells are derived from the fetal liver and then form a self-renewing population of cells (48, 49). B1b cells differ from B1a cells in that they can also be derived from adult bone marrow (50, 51).

In normal mice, the majority of B cells in the peritoneal cavity are B1a CD5+ cells. However, because these cells are not bone marrow derived, they are almost completely absent in the peritoneal cavity of lethally irradiated bone marrow-reconstituted mice. In their place, there is an increase in the percentage of B2 cells (B220+CD5-CD23high) from ~15–20% in wild-type mice to 40–50% in bone marrow-reconstituted mice, and B1b cells (B220+CD5-CD23low) from ~0–10% to 15–30% (data not shown).

Forced expression of BLAME in bone marrow-transplanted cells results in a significantly different population of B cells in the peritoneal cavity and a significant, but not as dramatic, difference in the B cells found in the spleen, peripheral blood, and peripheral lymph nodes. Analysis of total viable leukocytes in the peritoneal lavage revealed a notable increase in the percentage of B cells in BLAME-transduced mice. Analysis of these B cells shows them to be predominantly B1b sister cells based on cell surface Ag expression. In the spleen, peripheral blood, and lymph nodes, we could not see a significant increase in the total number of B cells; however, there was an increase in the percentage of these cells with a B1b phenotype.

The mechanism of this increase in B1b cells is unclear. Recent publications have shown that the differentiation of these B cell lineages depends upon the specificity and the surface density of Ig expressed during B cell development (52). It is not only the Ag specificity of the Ig but the total signal through the B cell receptor complex that determines B cell fate. CD19 normally associates with CD21 (complement receptor 2, the receptor for C3d) and provides a positive signal for B cell proliferation. In CD19-/- mice or mice lacking the associated CD81 tetraspanning molecule, a striking reduction in B1 cells, in addition to an alteration in the response of B cells to Ag, was observed (53, 54, 55). Conversely, CD22, which normally decreases Ag receptor-mediated signal, leads to an enlargement of the B1 cell population when it is knocked out (56), and overexpression of CD19 increases CD5+ cell differentiation (57).

It is possible that forced BLAME expression is modulating the signal through the B cell receptor complex by binding to a presumed receptor on B cells and acting as a costimulator or an adhesion molecule. This may occur during initial differentiation to the B1 phenotype or by increasing proliferation or survival of B1b cells (there are no B1a cells in bone marrow-reconstituted mice) once they have reached the peritoneal cavity. Although overexpression of a cell surface gene may lead to constitutive signaling, without the necessity of interaction with a ligand/coreceptor, this seems unlikely in this case because BLAME does not contain the signaling motifs usually used by this family. However, we cannot exclude the possibility that BLAME associates with another chain that does contain a signaling domain. In the retroviral system, BLAME is expected to be expressed on all bone marrow-derived cells, whereas expression is normally restricted to activated macrophages and DCs. The possibility of a direct interaction between B cells and other APCs has been well established (58), and it is possible that in normal mice interaction between BLAME on activated macrophages/DCs and its receptor on B cells is responsible for B1 cell differentiation or maintenance.

The phenotype of the retrovirally transduced mice is similar to that described for IL-9-transgenic mice (59). Although IL-9 does not directly induce expression of BLAME, it is possible that it modulates the expression of the ligand for BLAME or that, conversely, BLAME modulates the expression of IL-9. However, unlike the IL-9-transgenic mice, we saw no alteration in the circulating Ig levels in mice overexpressing BLAME.

It was proposed (23), and has since been validated (12, 60), that the ligand/receptor pairs within the CD2 family are genetically linked. It seems likely that the ligands for the orphan receptors CD84 and Ly-9 would map to the same location, chromosome 1q21–23. Both of these receptors contain long cytoplasmic domains that include the TxYxxV/I/A motifs and may be likely to bind to a nonsignaling ligand. Both CD84 and Ly-9 are currently of unknown function and are expressed on B cells. It will be interesting to see whether BLAME is in fact the ligand for either of these two genes or for a novel CD2 family member.


    Acknowledgments
 
We thank J. Morgenstern for pN8{epsilon} vector, James Boden for assistance with necropsies, and Keith Robison for help with computer analysis.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Gillian A. Kingsbury, Millennium Pharmaceutical, 75 Sidney Street, Cambridge, MA 02139. Back

2 Current address: Western Australia Institute for Medical Research, rear 50 Murray Street, Perth, Australia 6000. Back

3 Abbreviations used in this paper: SLAM, signaling lymphocytic activation protein; SAP, SLAM-associated protein; SH, Src homology; DC, dendritic cells; SCF, stem cell factor; BLAME, B lymphocyte activator macrophage expressed; rm, recombinant mouse; GFP, green fluorescent protein. Back

Received for publication November 6, 2000. Accepted for publication February 21, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tangye, S. G., J. H. Phillips, L. L. Lanier. 2000. The CD2-subset of the Ig superfamily of cell surface molecules: receptor-ligand pairs expressed by NK cells and other immune cells. Semin. Immunol. 12:149.[Medline]
  2. Seed, B., A. Aruffo. 1987. Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. Proc. Natl. Acad. Sci. USA 84:3365.[Abstract/Free Full Text]
  3. Staunton, D. E., D. A. Thorley-Lawson. 1987. Molecular cloning of the lymphocyte activation marker Blast-1. EMBO J. 6:3695.[Medline]
  4. de la Fuente, M. A., P. Pizcueta, M. Nadal, J. Bosch, P. Engel. 1997. CD84 leukocyte antigen is a new member of the Ig superfamily. Blood 90:2398.[Abstract/Free Full Text]
  5. Davis, S. J., P. A. van der Merwe. 1996. The structure and ligand interactions of CD2: implications for T-cell function. Immunol. Today 17:177.[Medline]
  6. Cocks, B. G., C. C. Chang, J. M. Carballido, H. Yssel, J. E. de Vries, G. Aversa. 1995. A novel receptor involved in T-cell activation. Nature 376:260.[Medline]
  7. Sandrin, M. S., M. M. Henning, M. F. Lo, E. Baker, G. R. Sutherland, I. F. McKenzie. 1996. Isolation and characterization of cDNA clones for Humly9: the human homologue of mouse Ly9. Immunogenetics 43:13.[Medline]
  8. Garni-Wagner, B. A., A. Purohit, P. A. Mathew, M. Bennett, V. Kumar. 1993. A novel function-associated molecule related to non-MHC-restricted cytotoxicity mediated by activated natural killer cells and T cells. J. Immunol. 151:60.[Abstract]
  9. Valiante, N. M., G. Trinchieri. 1993. Identification of a novel signal transduction surface molecule on human cytotoxic lymphocytes. J. Exp. Med. 178:1397.[Abstract/Free Full Text]
  10. Parolini, S., C. Bottino, M. Falco, R. Augugliaro, S. Giliani, R. Franceschini, H. D. Ochs, H. Wolf, J. Y. Bonnefoy, R. Biassoni, et al 2000. X-linked lymphoproliferative disease: 2B4 molecules displaying inhibitory rather than activating function are responsible for the inability of natural killer cells to kill Epstein-Barr virus-infected cells. J. Exp. Med. 192:337.[Abstract/Free Full Text]
  11. Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik, L. Notarangelo, R. Geha, M. G. Roncarolo, et al 1998. The X-linked lymphoproliferative-disease gene product SAP regulates signals induced through the coreceptor SLAM. Nature 395:462.[Medline]
  12. Sewell, W. A., R. W. Palmer, N. K. Spurr, D. Sheer, M. H. Brown, Y. Bell, M. J. Crumpton. 1988. The human LFA-3 gene is located at the same chromosome band as the gene for its receptor CD2. Immunogenetics 28:278.[Medline]
  13. Staunton, D. E., R. C. Fisher, M. M. LeBeau, J. B. Lawrence, D. E. Barton, U. Francke, M. Dustin, D. A. Thorley-Lawson. 1989. Blast-1 possesses a glycosyl-phosphatidylinositol (GPI) membrane anchor, is related to LFA-3 and OX-45, and maps to chromosome 1q21–23. J. Exp. Med. 169:1087.[Abstract/Free Full Text]
  14. de la Fuente, M. A., V. Tovar, P. Pizcueta, M. Nadal, J. Bosch, P. Engel. 1999. Molecular cloning, characterization, and chromosomal localization of the mouse homologue of CD84, a member of the CD2 family of cell surface molecules. Immunogenetics 49:249.[Medline]
  15. Shaw, S., G. E. Luce, R. Quinones, R. E. Gress, T. A. Springer, M. E. Sanders. 1986. Two antigen-independent adhesion pathways used by human cytotoxic T-cell clones. Nature 323:262.[Medline]
  16. Kaplan, A. J., K. D. Chavin, H. Yagita, M. S. Sandrin, L. H. Qin, J. Lin, G. Lindenmayer, J. S. Bromberg. 1993. Production and characterization of soluble and transmembrane murine CD2: demonstration that CD48 is a ligand for CD2 and that CD48 adhesion is regulated by CD2. J. Immunol. 151:4022.[Abstract]
  17. Latchman, Y., P. F. McKay, H. Reiser. 1998. Identification of the 2B4 molecule as a counter-receptor for CD48. J. Immunol. 161:5809.[Abstract/Free Full Text]
  18. Mavaddat, N., D. W. Mason, P. D. Atkinson, E. J. Evans, R. J. Gilbert, D. I. Stuart, J. A. Fennelly, A. N. Barclay, S. J. Davis, M. H. Brown. 2000. Signaling lymphocytic activation molecule (CDw150) is homophilic but self-associates with very low affinity. J. Biol. Chem. 275:28100.[Abstract/Free Full Text]
  19. Moingeon, P., J. L. Lucich, D. J. McConkey, F. Letourneur, B. Malissen, J. Kochan, H. C. Chang, H. R. Rodewald, E. L. Reinherz. 1992. CD3{zeta} dependence of the CD2 pathway of activation in T lymphocytes and natural killer cells. Proc. Natl. Acad. Sci. USA 89:1492.[Abstract/Free Full Text]
  20. Moingeon, P., H. C. Chang, B. P. Wallner, C. Stebbins, A. Z. Frey, E. L. Reinherz. 1989. CD2-mediated adhesion facilitates T lymphocyte antigen recognition function. Nature 339:312.[Medline]
  21. Dustin, M. L., M. W. Olszowy, A. D. Holdorf, J. Li, S. Bromley, N. Desai, P. Widder, F. Rosenberger, P. A. van der Merwe, P. M. Allen, A. S. Shaw. 1998. A novel adaptor protein orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts. Cell 94:667.[Medline]
  22. Li, J., K. Nishizawa, W. An, R. E. Hussey, F. E. Lialios, R. Salgia, R. Sunder-Plassmann, E. L. Reinherz. 1998. A cdc15-like adaptor protein (CD2BP1) interacts with the CD2 cytoplasmic domain and regulates CD2-triggered adhesion. EMBO J. 17:7320.[Medline]
  23. Wong, Y. W., A. F. Williams, S. F. Kingsmore, M. F. Seldin. 1990. Structure, expression, and genetic linkage of the mouse BCM1 (OX45 or Blast-1) antigen: evidence for genetic duplication giving rise to the BCM1 region on mouse chromosome 1 and the CD2/LFA3 region on mouse chromosome 3. J. Exp. Med. 171:2115.[Abstract/Free Full Text]
  24. Kubota, K., H. Katoh, K. Muguruma, K. Koyama. 1999. Characterization of a surface membrane molecule expressed by natural killer cells in most inbred mouse strains: monoclonal antibody C9.1 identifies an allelic form of the 2B4 antigen. Immunology 96:491.[Medline]
  25. Aversa, G., J. Carballido, J. Punnonen, C. C. Chang, T. Hauser, B. G. Cocks, J. E. De Vries. 1997. SLAM and its role in T cell activation and Th cell responses. Immunol. Cell Biol. 75:202.[Medline]
  26. Punnonen, J., B. G. Cocks, J. M. Carballido, B. Bennett, D. Peterson, G. Aversa, J. E. de Vries. 1997. Soluble and membrane-bound forms of signaling lymphocytic activation molecule (SLAM) induce proliferation and Ig synthesis by activated human B lymphocytes. J. Exp. Med. 185:993.[Abstract/Free Full Text]
  27. Mathieson, B. J., S. O. Sharrow, K. Bottomly, B. J. Fowlkes. 1980. Ly 9, an alloantigenic marker of lymphocyte differentiation. J. Immunol. 125:2127.[Abstract]
  28. T. Kishimoto, and A. E. G. von demBorne, and S. M. Goyert, and D. Y. Mason, and M. Miyasake, and L. Moretta, and K. Okumura, and S. Shaw, and T. A. Springer, and K. Sagamura, and H. Zola, eds. Leukocyte Typing VI 1997 Garland, New York.
  29. Stepp, S. E., J. D. Schatzle, M. Bennett, V. Kumar, P. A. Mathew. 1999. Gene structure of the murine NK cell receptor 2B4: presence of two alternatively spliced isoforms with distinct cytoplasmic domains. Eur. J. Immunol. 29:2392.[Medline]
  30. Palou, E., F. Pirotto, J. Sole, J. H. Freed, B. Peral, C. Vilardell, R. Vilella, J. Vives, A. Gaya. 2000. Genomic characterization of CD84 reveals the existence of five isoforms differing in their cytoplasmic domains. Tissue Antigens 55:118.[Medline]
  31. Tartaglia, L. A., M. Dembski, X. Weng, N. Deng, J. Culpepper, R. Devos, G. J. Richards, L. A. Campfield, F. T. Clark, J. Deeds, et al 1995. Identification and expression cloning of a leptin receptor, OB-R. Cell 83:1263.[Medline]
  32. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403.[Medline]
  33. Gonzalo, J. A., C. M. Lloyd, L. Kremer, E. Finger, A. C. Martinez, M. H. Siegelman, M. Cybulsky, J. C. Gutierrez-Ramos. 1996. Eosinophil recruitment to the lung in a murine model of allergic inflammation. The role of T cells, chemokines, and adhesion receptors. J. Clin. Invest. 98:2332.[Medline]
  34. Gyapay, G., K. Schmitt, C. Fizames, H. Jones, N. Vega-Czarny, D. Spillett, D. Muselet, J. F. Prud’Homme, C. Dib, C. Auffray, et al 1996. A radiation hybrid map of the human genome. Hum. Mol. Genet. 5:339.[Abstract/Free Full Text]
  35. Caux, C., B. Vanbervliet, C. Massacrier, C. Dezutter-Dambuyant, B. de Saint-Vis, C. Jacquet, K. Yoneda, S. Imamura, D. Schmitt, J. Banchereau. 1996. CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF+TNF{alpha}. J. Exp. Med. 184:695.[Abstract/Free Full Text]
  36. Caux, C., C. Massacrier, B. Vanbervliet, B. Dubois, I. Durand, M. Cella, A. Lanzavecchia, J. Banchereau. 1997. CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to granulocyte-macrophage colony-stimulating factor plus tumor necrosis factor {alpha}. II. Functional analysis. Blood 90:1458.[Abstract/Free Full Text]
  37. Davis, T. A., A. A. Saini, P. J. Blair, B. L. Levine, N. Craighead, D. M. Harlan, C. H. June, K. P. Lee. 1998. Phorbol esters induce differentiation of human CD34+ hemopoietic progenitors to dendritic cells: evidence for protein kinase C-mediated signaling. J. Immunol. 160:3689.[Abstract/Free Full Text]
  38. Sallusto, F., A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha}. J. Exp. Med. 179:1109.[Abstract/Free Full Text]
  39. Pickl, W. F., O. Majdic, P. Kohl, J. Stockl, E. Riedl, C. Scheinecker, C. Bello-Fernandez, W. Knapp. 1996. Molecular and functional characteristics of dendritic cells generated from highly purified CD14+ peripheral blood monocytes. J. Immunol. 157:3850.[Abstract]
  40. Sornasse, T., P. V. Larenas, K. A. Davis, J. E. de Vries, H. Yssel. 1996. Differentiation and stability of T helper 1 and 2 cells derived from naive human neonatal CD4+ T cells, analyzed at the single-cell level. J. Exp. Med. 184:473.[Abstract/Free Full Text]
  41. Hawley, R. G., F. H. Lieu, A. Z. Fong, T. S. Hawley. 1994. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1:136.[Medline]
  42. Nielsen, H., J. Engelbrecht, S. Brunak, G. von Heijne. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10:1.[Abstract/Free Full Text]
  43. Jones, D. T., W. R. Taylor, J. M. Thornton. 1994. A model recognition approach to the prediction of all-helical membrane protein structure and topology. Biochemistry 33:3038.[Medline]
  44. Eddy, S. R.. 1998. Profile hidden Markov models. Bioinformatics 14:755.[Abstract/Free Full Text]
  45. Bateman, A., E. Birney, R. Durbin, S. R. Eddy, K. L. Howe, E. L. Sonnhammer. 2000. The Pfam protein families database. Nucleic Acids Res. 28:263.[Abstract/Free Full Text]
  46. Tarakhovsky, A.. 1997. Bar Mitzvah for B-1 cells: how will they grow up?. J. Exp. Med. 185:981.[Free Full Text]
  47. Hayakawa, K., R. R. Hardy, L. A. Herzenberg. 1985. Progenitors for Ly-1 B cells are distinct from progenitors for other B cells. J. Exp. Med. 161:1554.[Abstract/Free Full Text]
  48. Solvason, N., X. Chen, F. Shu, J. F. Kearney. 1992. The fetal omentum in mice and humans: a site enriched for precursors of CD5 B cells early in development. Ann. NY Acad. Sci. 651:10.[Medline]
  49. Hardy, R. R., K. Hayakawa. 1992. Developmental origins, specificities and immunoglobulin gene biases of murine Ly-1 B cells. Int. Rev. Immunol. 8:189.[Medline]
  50. Hardy, R. R., K. Hayakawa. 1994. CD5 B cells, a fetal B cell lineage. Adv. Immunol. 55:297.[Medline]
  51. Kantor, A. B., A. M. Stall, S. Adams, L. A. Herzenberg. 1992. Differential development of progenitor activity for three B-cell lineages. Proc. Natl. Acad. Sci. USA 89:3320.[Abstract/Free Full Text]
  52. Lam, K. P., K. Rajewsky. 1999. B cell antigen receptor specificity and surface density together determine B-1 versus B-2 cell development. J. Exp. Med. 190:471.[Abstract/Free Full Text]
  53. Rickert, R. C., K. Rajewsky, J. Roes. 1995. Impairment of T-cell-dependent B-cell responses and B-1 cell development in CD19-deficient mice. Nature 376:352.[Medline]
  54. Sato, S., A. S. Miller, M. C. Howard, T. F. Tedder. 1997. Regulation of B lymphocyte development and activation by the CD19/CD21/CD81/Leu 13 complex requires the cytoplasmic domain of CD19. J. Immunol. 159:3278.[Abstract]
  55. Tsitsikov, E. N., J. C. Gutierrez-Ramos, R. S. Geha. 1997. Impaired CD19 expression and signaling, enhanced antibody response to type II T independent antigen and reduction of B-1 cells in CD81- deficient mice. Proc. Natl. Acad. Sci. USA 94:10844.[Abstract/Free Full Text]
  56. O’Keefe, T. L., G. T. Williams, S. L. Davies, M. S. Neuberger. 1996. Hyperresponsive B cells in CD22-deficient mice. Science 274:798.[Abstract/Free Full Text]
  57. Sato, S., N. Ono, D. A. Steeber, D. S. Pisetsky, T. F. Tedder. 1996. CD19 regulates B lymphocyte signaling thresholds critical for the development of B-1 lineage cells and autoimmunity. J. Immunol. 157:4371.[Abstract]
  58. Dubois, B., J. M. Bridon, J. Fayette, C. Barthelemy, J. Banchereau, C. Caux, F. Briere. 1999. Dendritic cells directly modulate B cell growth and differentiation. J. Leukocyte Biol. 66:224.[Medline]
  59. Vink, A., G. Warnier, F. Brombacher, J. C. Renauld. 1999. Interleukin 9-induced in vivo expansion of the B-1 lymphocyte population. J. Exp. Med. 189:1413.[Abstract/Free Full Text]
  60. Kingsmore, S. F., M. L. Watson, W. S. Moseley, M. F. Seldin. 1989. Physical linkage of genes encoding the lymphocyte adhesion molecules CD2 and its ligand LFA-3. Immunogenetics 30:123.[Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
Q. Yan, V. N. Malashkevich, A. Fedorov, E. Fedorov, E. Cao, J. W. Lary, J. L. Cole, S. G. Nathenson, and S. C. Almo
Structure of CD84 provides insight into SLAM family function
PNAS, June 19, 2007; 104(25): 10583 - 10588.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Dorsch, Y. Qiu, D. Soler, N. Frank, T. Duong, A. Goodearl, S. O'Neil, J. Lora, and C. C. Fraser
PK1/EG-VEGF induces monocyte differentiation and activation
J. Leukoc. Biol., August 1, 2005; 78(2): 426 - 434.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Monti, K. J. Savage, J. L. Kutok, F. Feuerhake, P. Kurtin, M. Mihm, B. Wu, L. Pasqualucci, D. Neuberg, R. C. T. Aguiar, et al.
Molecular profiling of diffuse large B-cell lymphoma identifies robust subtypes including one characterized by host inflammatory response
Blood, March 1, 2005; 105(5): 1851 - 1861.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Mooney, J. Klem, C. Wulfing, L. A. Mijares, P. L. Schwartzberg, M. Bennett, and J. D. Schatzle
The Murine NK Receptor 2B4 (CD244) Exhibits Inhibitory Function Independent of Signaling Lymphocytic Activation Molecule-Associated Protein Expression
J. Immunol., September 15, 2004; 173(6): 3953 - 3961.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. G. Tangye, K. E. Nichols, N. J. Hare, and B. C. M. van de Weerdt
Functional Requirements for Interactions Between CD84 and Src Homology 2 Domain-Containing Proteins and Their Contribution to Human T Cell Activation
J. Immunol., September 1, 2003; 171(5): 2485 - 2495.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Dorsch, G. Zheng, D. Yowe, P. Rao, Y. Wang, Q. Shen, C. Murphy, X. Xiong, Q. Shi, J.-C. Gutierrez-Ramos, et al.
Ectopic expression of Delta4 impairs hematopoietic development and leads to lymphoproliferative disease
Blood, August 28, 2002; 100(6): 2046 - 2055.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Bouchon, M. Cella, H. L. Grierson, J. I. Cohen, and M. Colonna
Cutting Edge: Activation of NK Cell-Mediated Cytotoxicity by a SAP-Independent Receptor of the CD2 Family
J. Immunol., November 15, 2001; 167(10): 5517 - 5521.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kingsbury, G. A.
Right arrow Articles by Villeval, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kingsbury, G. A.
Right arrow Articles by Villeval, J. L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*OMIM*Protein
*