|
|
||||||||
Millennium Pharmaceutical, Cambridge, MA 02139
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The genes encoding these proteins are found in two pericentric loci in humans, 1p13 (CD2 and CD58) (11) and 1q2124 (CD48, CD84, CD150, CD244, and Ly-9) (12, 13). In the mouse, CD244, Ly-9, and CD48 are clustered on chromosome 1 (14), and CD2 is found on chromosome 3.
The ligands for CD2 family members that have been identified are within the CD2 family, CD2 to CD58 in humans (15) or CD48 in rodents (16), CD48 to CD244 (17), and the homotypic interaction of CD150 with itself (18). CD84 and Ly-9 are currently orphans.
CD2 is expressed on the surface of T cells and on NK cells (19). The extracellular domain of CD2 is an important adhesion molecule for the initial transient interaction of the T cell with an APC (20). Activation of the TCR by a MHC Ag complex leads to recruitment of CD2AP, an SH3 domain-containing adaptor protein, to the cytoplasmic tail of CD2. This leads to CD2 clustering and helps in the formation of the "immunological synapse" (21). Conversely, CD2 cross-linking has been shown to recruit the adaptor protein CD2BP1, which binds to the same region of the cytoplasmic domain of CD2 and is thought to down-regulate CD2-mediated adhesion (22). The ligand for CD2, CD58, is widely expressed on both hematopoetic and nonhematopoetic tissue.
Signaling via CD244 and CD150 involves competition between SAP
and SHP-2 (SH2-domain containing protein tyrosine phosphatase 2) for
binding to the tyrosine-based motifs (11, 23). CD244 is
expressed on NK cells, CD8 T cells, and 
T cells. Ligation of
CD244 on NK cells by CD48 on target leukocytes results in an increase
in target cell lysis. Although ligation of CD244 on CD8 cells does not
increase their cytolytic activity,
CD8+CD244+ cells have been
shown to be responsible for non-MHC-restricted "natural"
cytotoxicity (24). CD150 is expressed on activated T and B
cells. Ligation on T cells results in costimulation of activation and
an increase in IFN-
secretion (25), but not the
Th2-type cytokines IL-4 and IL-5, and on B cells induces proliferation
and Ig secretion (26).
CD84 and Ly-9 contain two tyrosine-based domains; however, they are currently orphans and their function is unclear. CD84 is expressed on B cells, thymocytes, memory T cells, monocytes, and platelets, and Ly-9 is found on thymocytes, T and B cells, and bone marrow lymphoid cells (27, 28). The remaining two family members, CD58 and CD48, are GPI-linked membrane proteins and so contain no cytoplasmic domains (13).
Several members of the family exist in different forms. Splice variants of CD150, CD244, and CD84 can be found with different cytoplasmic domains containing three or one, four or one, and two or zero tyrosine-based motifs respectively (6, 29, 30). In addition, there is a predicted secreted form of CD150 (26) and a transmembrane form of CD58 with a cytoplsmic domain of 12 amino acids containing no obvious signaling motifs.
In this paper, we describe the cloning, expression analysis, and possible function of a novel member of this family, B lymphocyte activator macrophage expressed (BLAME).
| Materials and Methods |
|---|
|
|
|---|
Mixed lymphocyte response library. Approximately 100 ml of blood was collected from 24 healthy donors with informed consent, and PBMCs were isolated by Ficoll gradient. Total lymphocytes were cultured at 1 x 107 cells/ml in RPMI 1640 with 10% FCS. Equal numbers of starting cells were harvested at 4, 8, and 24 h, and RNA was purified using standard techniques. The cDNA library was prepared as previously described (31).
Identification of human BLAME and the mouse ortholog and isolation of full-length clones. The MLR library was studied by high throughput single-pass sequencing and computer analysis. BLAME was originally identified by basic local alignment search tool analysis (32) as a homologue of SLAM (6), and a full-length clone was identified. The mouse ortholog was identified in the Millennium Pharmaceutical database as a full-length clone in a lung library from a mouse asthma model 3 h after Ag challenge (33)
Mapping. The chromosomal location of BLAME was mapped using the Genebridge 4 Human Radiation Hybrid mapping panel (Research Genetics, Huntsville, AL) with GGTACTGAGGCACTCTAGAATC as the forward primer and GGGTGAGAGAAACTGTGAACC as the reverse primer (34). PCR products were run on a 2% agarose gel and scored for the presence or absence of the band in each of the 93 cell line DNAs. The results were analyzed using Map Manager software program.
Expression of BLAME in human leukocytes
TaqMan analysis. PBMC and granulocytes were isolated from whole blood using Ficoll-Hypaque density gradient centrifugation. Whole blood was centrifuged in a step gradient of Ficoll at 1.077 and 1.119 g/ml. PBMCs were isolated from the interface between the plasma and the 1.077g/ml Ficoll layer; granulocytes were isolated from the lower interface. Both cell layers were depleted of erythrocytes and washed before activation or subsequent isolation of cell populations. Individual cell populations (CD3, CD4, CD8, CD14, and CD19) were isolated using Abs to respective cell surface markers conjugated to magnetic beads and passed through separation columns (Miltenyi Biotec, Auburn, CA). PBMC and T cells were activated with PHA (5 µg/ml), and CD14 cells were activated with LPS (100 ng/ml). Cells were cultured in RPMI 1640 medium with 10% FCS (Sigma, MO) supplemented with 2 mM L-glutamine, 0.1 mM nonessential amino acids, and 1 mM sodium pyruvate (Life Technologies, Rockville, MD).
Dendritic cells (DC) were differentiated from two sources, bone
marrow-derived CD34+ cells to give DC 1 or
CD14+ monocytes to give DC 2, as shown in Fig. 3
b. Bone marrow-derived DC 1 were propagated from
CD34+ cells cultured with GM-CSF (100 ng/ml),
stem cell factor (SCF; 120 ng/ml), and TNF-
(10 ng/ml) for 7 days
(35, 36, 37). CD1a+ cells were sorted,
and fresh cytokines (GM-CSF and TNF-
) were added to replenish the
medium. Cells were grown for 1517 more days, stained for FACS
analysis, and lysed for RNA isolation.
CD14+-derived DC 2 were generated according to
the method of Sallusto and Lanzavecchia (38) and Pickl et
al. (39). Monocytes were cultured in medium containing
GM-CSF (50 ng/ml; R&D Systems, Minneapolis, MN) and IL-4 (50 ng/ml;
PeproTech, Rocky Hill, NJ) for 1214 days, replacing half of the
medium every 3 days. Cells were stimulated with TNF-
(100 ng/ml) for
4 days to promote maturation; they were then activated with LPS (1
µg/ml) for 24 h. These cells were CD83+
after LPS stimulation.
|
Total RNA was prepared from purified cells by a single-step extraction
method using RNA STAT-60 according to the manufacturers instructions
(Tel-Test, Friendswood, TX). Each RNA preparation was treated with
DNase I (Ambion, Austin, TX) at 37°C for 1 h. DNase I treatment
was determined to be complete if the sample required at least 38 PCR
amplification cycles to reach a threshold level of fluorescence using
2-microglobulin as an internal amplicon
reference. After phenol extraction, cDNA was prepared from the sample
using the SuperScript Choice System following the manufacturers
instructions (Life Technologies).
BLAME expression was measured by TaqMan quantitative PCR (Applied
Biosystems, Foster City, CA). PCR probes designed by PrimerExpress
software (Applied Biosystems) were as follows:
2-microglobulin forward primer,
CACCCCCACTGAAAAAGATGA;
2-microglobulin probe,
ATGCCTGCCGTGTGAACCACGTG;
2-microglobulin
reverse primer, CTTAACTATCTTGGGCTGTGACAAAG; BLAME reverse primer,
GCCTAAGGACTTTCAGGTAATCAGAGT; BLAME probe,
CATGGGCCCTCAAAGGTAAATTGCAGT; and BLAME forward primer,
TGTCAACCATCCTCGGTGTCTA.
BLAME probe was labeled using 6-carboxyfluorescein, and the
2-microglobulin probe was labeled with
VIC. Each reaction contained 200 nM of forward and reverse
primers plus 100 nM probe for
2-microglobulin
and 600 nM forward and reverse primers plus 200 nM probe for BLAME, and
reactions were conducted in TaqMan Universal PCR Master Mix (Applied
Biosystems) using an ABI PRISM 7700 Sequence Detection System (Applied
Biosystems). Conditions were as follows: hold for 2 min at 50°C and
10 min at 95°C, followed by two-step PCR for 40 cycles of 95°C for
15 s followed by 60°C for 1 min.
Ct value (expression of BLAME relative to
2-microglobulin) was calculated using the following
formula:
Ct =
CtBLAME - Ct
-2 microglobulin. The
Ct value (expression of BLAME compared with a
control tissue) for each tissue sample was calculated according to the
following formula:
Ct =
Ctsample -
Ctcalibrator. Relative
expression was then calculated using the arithmetic formula given by
2-
Ct.
Northern blot analysis. Human poly(A)+ immune blot (Clontech Laboratories, Palo Alto, CA) was probed using a 32P-labeled probe corresponding to aa 1233 of human BLAME according to the manufacturers instructions.
Total PBMCs were stimulated for 4 h in RPMI 1640 with 10% FCS
supplemented with IL-2, IL-6, IL-9, IL-12, IFN-
(10 ng/ml), IL-10,
TGF-
, IL-5 (20 ng/ml), IL-4 (40 ng/ml), or TNF-
(100
U/ml). Resting monocytes were isolated from PBMCs by Percol
gradient centrifugation and were >90% CD14+.
CD4+, CD8+, and
CD19+ cells were isolated from PBMCs by positive
selection using MACS magnetic beads according to manufacturers
protocols (Miltenyi Biotec). Monocytes were stimulated for 4 h in
RPMI 1640 with 10% FCS with or without LPS or IFN-
. RNA was
prepared using RNeasy Mini Kit (Qiagen, Chatsworth, CA) according to
the manufacturers instructions, and Northern blots were probed as for
commercial blots.
Overexpression of BLAME in bone marrow-reconstituted irradiated mice
Construction and production of retroviruses.
Full-length BLAME was PCR amplified to introduce unique 5'
XhoI and a 3' EcoRI restriction sites and a Kozak
sequence (ACCGCC) in the original cDNAs (Advantage-HF kit; Clontech
Laboratories). The PCR products were ligated into the murine stem cell
virus Neo retroviral vector (41), and clones were
sequenced and selected for base-perfect match with the original cDNA.
Viral supernatants were generated into the 293-EBV nuclear Ag
cells (Invitrogen, Carlsbad, CA) by cotransfecting three constructs:
the BLAME retroviral construct or control (empty murine stem cell Neo
EB virus), pN8
vector containing the gag/pol genes from the
murine Moloney leukemia virus, and a pN8
vector containing the
vesicular stomatitis virus envelope glycoprotein G gene. Concentrated
viral supernatants were prepared by centrifugation for 2 h at
50,000 x g (SW28 rotor, 25,000 rpm) at 4°C. Pellets
were resuspended in DMEM with 10% FCS (Stem Cell Technologies,
Vancouver, Canada), shaken at 4°C for 24 h, filtered,
and frozen at -80°C.
Infection procedure.
Bone marrow cells were collected from C57BL/6 SJL mice (Taconic
Farms, Germantown, NY) 4 days after 5-fluorouracil treatment of 150
mg/kg administrated i.v. Lin- cells were
selected using a MACS depletion column (type BS; Miltenyi Biotec).
Briefly, cells were labeled with a mixture of four FITC-conjugated Abs
against CD3
, CD11b, CD45R, and Ly-6G (BD PharMingen, San Diego, CA).
Cells were washed and incubated with anti-FITC microbeads (Miltenyi
Biotec). Labeled cells were removed using depletion columns according
to manufacturers instructions. After separation,
Lin- cells were washed and resuspended in DMEM
with 10% FCS.
Before infection, Lin- cells
(106 cells/ml) were prestimulated with
recombinant mouse (rm)IL-3 (10 ng/ml; Endogen, Woburn, MA), rmIL-6 (10
ng/ml; Endogen), rmSCF (100 ng/ml; R&D Systems), rm fms-like
tyrosine kinase-3 ligand (100 ng/ml; R&D Systems) and mouse
thrombopoietin (102 U/ml, conditioned medium) for
2 days. Cells were centrifuged, resuspended in DMEM with 10% FCS and
viral supernatant (1/1 v/v) in the presence of rmIL-3, rmIL-6, rm-SCF,
rm fms-like tyrosine kinase-3 ligand, and thrombopoietin,
and incubated at 37°C, 10% CO2. This infection
procedure was repeated 24 h later and 4 h after this second
infection, the cells were collected, washed twice, and injected into
lethally irradiated C57BL/6 mice (9.5 Gy;
rays generated by cobalt
source).
Analysis of mice. Major organs were harvested and tissue fixed in 10% buffered formalin stained with hematoxylin and eosin and subject to histologic analysis. Tissue examined included skin, kidneys, sternum, uterus, thymus, bladder, heart (weighed), ovaries, lungs, skeletal muscle, thyroid/parathyroid, femur, brain (weighed), brown and white fat, pituitary, head, eyes, diaphragm, aorta, spleen (weighed), stomach, intestines, liver (weighed), and adrenals.
RNA expression of BLAME was confirmed in the spleens of the transduced mice using a slot blot analysis (Slot Blot Manifold, Amersham Pharmacia Biotech, Piscataway, NJ). Total RNA (5 µg/sample) was loaded onto duplicated membranes using the slot blot apparatus. The membranes were washed with 10x SSC and irradiated with an UV transilluminator. Hybridization was conducted using 75 ng of randomly 32P-labeled (Rediprime; Amersham Pharmacia Biotech) BLAME (0.7 kb corresponding to the extracellular domain) or GAPDH (1.2 kb) cDNA probes displaying similar specific activities. After washing, signals were analyzed using a phosphoimager (Fujifilm BAS-2500; Fuji Medical Systems, Stamford, CT). Using the same virus containing a green fluorescent protein (GFP) gene in place of the BLAME gene, we found that 74 ± 6% of the peripheral blood cells were GFP positive when mice were studied 15 wk after transplantation. Among these cells, similar percentages of GFP-positive cells were found in the Mac1+ population (87 ± 6%), the CD3+ population (67 ± 8%) and the B220+ cell populations (74 ± 8%). This result strongly suggests that the ectopic expression of BLAME is observed in all hematopoietic cell populations, including macrophages, T cells, and B cells.
Blood was collected from the tail vein or at necropsy by heart puncture. RBC were lysed, and FACS was conducted using FITC, PE, and CyChrome directly conjugated Abs from BD PharMingen according to the manufacturers instructions. Peritoneal lavage was conducted at necropsy by washing the peritoneum twice with 2 ml PBS. All FACS was gated for viable leukocytes on the basis of forward and side scatter.
| Results |
|---|
|
|
|---|
BLAME was originally cloned from a human MLR library. The open
reading frame encodes a 28 amino acid protein (Fig. 1
) with a 22 amino acid leader sequence
predicted by signal P (42). The mature protein is a type 1
transmembrane protein with a 212 amino acid extracellular domain, 21
amino acid transmembrane domain (predicted by MEMSAT
(43)), and a short 31 amino acid cytoplasmic tail. Using
the HMMER software (44) and the PFAM database of
models (45), the extracellular domain was shown to contain
the two Ig-like domains typical of the CD2 family, an N-terminal
IgV-like fold that does not contain the conserved disulfide bonds, and
a membrane proximal C2-like fold. There are no distinctive signaling
motifs in the intracellular domain; in particular, the consensus
SAP/SH2D1A binding site does not appear to be present. The mouse
ortholog shows 75% identity on the amino acid level with human BLAME.
BCM-like membrane protein precursor was recently entered in to the
public data base (GenBank accession number AAF67470) and is identical
with BLAME except for one amino acid (S99 to G).
|
|
Expression
Human immune Northern blot analysis revealed two transcripts of
2 and 3.5 kb (Fig. 3
a). In
the lymph node, spleen, thymus, and bone marrow, the smaller transcript
was more abundant, and highest BLAME expression was seen in lymph node.
To identify the specific cell types expressing BLAME, we used real-time
quantitative PCR and primers/probes within the 3' untranslated
region of BLAME. Significant expression was seen in PBMCs,
monocytes, and certain DCs (Fig. 3
b). However, Northern blot
analysis showed no detectable expression in resting PBMCs. Using 4
h of stimulation with a variety of cytokines, we found that BLAME was
induced by IFN-
(Fig. 3
c). In fact, purification of
monocytes by adhesion to plastic provided sufficient stimulation to
induce relatively high expression (data not shown), and all additional
experiments were conducted using resting monocytes purified by Percoll
gradient. Northern blot analysis of isolated monocytes stimulated with
IFN-
(but not LPS) confirmed the data generated using the sensitive
TaqMan technique suggesting that BLAME is expressed in activated
monocytes (Fig. 3
d).
Therefore, BLAME is expressed on at least two populations of professional APCs, DCs, and activated monocytes.
Retroviral forced expression of BLAME in vivo using bone marrow reconstitution of lethally irradiated mice
To investigate the in vivo function of BLAME, we used
reconstitution of lethally irradiated mice with retrovirally infected
bone marrow to give expression of mouse BLAME in all hematopoietically
derived cells. As a control, empty vector was used. Mice were examined
between 8 and 16 wk after bone marrow transplantation, when a full
hematopoietic reconstitution from these infected cells is expected.
Fifty-four percent of progenitor cells were infected with virus as
evaluated by resistance to G418 in methyl cellulose cultures (data not
shown). The level of BLAME RNA in the spleen of transduced mice was
10 times that found in control mice (
3 times GAPDH RNA level for
BLAME mice compared with 0.3 times GAPDH RNA for endogenous BLAME level
in control mice).
The mice showed normal blood cell counts (white blood cells, RBC,
platelets, neutrophils, lymphocytes, monocytes, eosinophils, and
basophils), and lymphoid organs (spleen, peripheral lymph nodes, and
thymus) were normal size and showed no gross alteration in
architecture. Pathologic examination of a panel of major organs showed
no differences from control animals. However, FACS analysis of
peripheral blood using a panel of Abs (CD3/NK1.1, CD4/CD8, GR1/Mac1,
and B220/IgD) in combination with a marker for donor cells (CD45.1)
showed an increase in Mac1low
(Mac1low compared with
Mac1high levels on monocytes) and
B220+/IgD+ cells. Further
analysis by three-color staining revealed that these were in fact the
same population of
Mac1lowB220+IgD+
cells and that the increase was statistically significant
(p = 0.006; Fig. 4
). Mac1 is not normally expressed by
peripheral B cells; however, it is expressed on B1 cells, which are
usually found primarily in the peritoneum. FACS analysis of the
peritoneal lavage showed that this population of
Mac1lowB220+IgD+
cells was greatly increased (an average of 21.5% in control mice
compared with an average of 59.5% in BLAME mice; SD 7.6 and 5.0,
respectively; p = 0.0001). The spleen showed a less
dramatic but still statistically significant increase in B1 cells (an
average of 9.2% in control mice compared with an average of 12.6% in
BLAME mice; SD 2.3 and 1.0, respectively; p = 0.04),
whereas thymus and bone marrow were similar to control. Three-color
FACS analysis showed the cells to be predominantly
B220+Mac1+CD5-CD23lowIgD+
cells (Fig. 5
), which is the phenotype of
B1b "sister" cells. Both B220 and IgD expression levels are
slightly lower than in B cells of control mice, as one would expect for
B1b cells. In addition, the total percentage of B cells in the
peritoneal lavage, as defined by expression of surface Ig, was
increased from 46% (SD 9.7) to 73% (SD 9.7). This phenotype
was duplicated in three separate experiments with five mice per group
in each experiment.
|
|
| Discussion |
|---|
|
|
|---|
In normal mice, the majority of B cells in the peritoneal cavity are
B1a CD5+ cells. However, because these cells are
not bone marrow derived, they are almost completely absent in the
peritoneal cavity of lethally irradiated bone marrow-reconstituted
mice. In their place, there is an increase in the percentage of B2
cells
(B220+CD5-CD23high)
from
1520% in wild-type mice to 4050% in bone
marrow-reconstituted mice, and B1b cells
(B220+CD5-CD23low)
from
010% to 1530% (data not shown).
Forced expression of BLAME in bone marrow-transplanted cells results in a significantly different population of B cells in the peritoneal cavity and a significant, but not as dramatic, difference in the B cells found in the spleen, peripheral blood, and peripheral lymph nodes. Analysis of total viable leukocytes in the peritoneal lavage revealed a notable increase in the percentage of B cells in BLAME-transduced mice. Analysis of these B cells shows them to be predominantly B1b sister cells based on cell surface Ag expression. In the spleen, peripheral blood, and lymph nodes, we could not see a significant increase in the total number of B cells; however, there was an increase in the percentage of these cells with a B1b phenotype.
The mechanism of this increase in B1b cells is unclear. Recent publications have shown that the differentiation of these B cell lineages depends upon the specificity and the surface density of Ig expressed during B cell development (52). It is not only the Ag specificity of the Ig but the total signal through the B cell receptor complex that determines B cell fate. CD19 normally associates with CD21 (complement receptor 2, the receptor for C3d) and provides a positive signal for B cell proliferation. In CD19-/- mice or mice lacking the associated CD81 tetraspanning molecule, a striking reduction in B1 cells, in addition to an alteration in the response of B cells to Ag, was observed (53, 54, 55). Conversely, CD22, which normally decreases Ag receptor-mediated signal, leads to an enlargement of the B1 cell population when it is knocked out (56), and overexpression of CD19 increases CD5+ cell differentiation (57).
It is possible that forced BLAME expression is modulating the signal through the B cell receptor complex by binding to a presumed receptor on B cells and acting as a costimulator or an adhesion molecule. This may occur during initial differentiation to the B1 phenotype or by increasing proliferation or survival of B1b cells (there are no B1a cells in bone marrow-reconstituted mice) once they have reached the peritoneal cavity. Although overexpression of a cell surface gene may lead to constitutive signaling, without the necessity of interaction with a ligand/coreceptor, this seems unlikely in this case because BLAME does not contain the signaling motifs usually used by this family. However, we cannot exclude the possibility that BLAME associates with another chain that does contain a signaling domain. In the retroviral system, BLAME is expected to be expressed on all bone marrow-derived cells, whereas expression is normally restricted to activated macrophages and DCs. The possibility of a direct interaction between B cells and other APCs has been well established (58), and it is possible that in normal mice interaction between BLAME on activated macrophages/DCs and its receptor on B cells is responsible for B1 cell differentiation or maintenance.
The phenotype of the retrovirally transduced mice is similar to that described for IL-9-transgenic mice (59). Although IL-9 does not directly induce expression of BLAME, it is possible that it modulates the expression of the ligand for BLAME or that, conversely, BLAME modulates the expression of IL-9. However, unlike the IL-9-transgenic mice, we saw no alteration in the circulating Ig levels in mice overexpressing BLAME.
It was proposed (23), and has since been validated (12, 60), that the ligand/receptor pairs within the CD2 family are genetically linked. It seems likely that the ligands for the orphan receptors CD84 and Ly-9 would map to the same location, chromosome 1q2123. Both of these receptors contain long cytoplasmic domains that include the TxYxxV/I/A motifs and may be likely to bind to a nonsignaling ligand. Both CD84 and Ly-9 are currently of unknown function and are expressed on B cells. It will be interesting to see whether BLAME is in fact the ligand for either of these two genes or for a novel CD2 family member.
| Acknowledgments |
|---|
vector, James Boden for
assistance with necropsies, and Keith Robison for help with computer
analysis. | Footnotes |
|---|
2 Current address: Western Australia Institute for Medical Research, rear 50 Murray Street, Perth, Australia 6000. ![]()
3 Abbreviations used in this paper: SLAM, signaling lymphocytic activation protein; SAP, SLAM-associated protein; SH, Src homology; DC, dendritic cells; SCF, stem cell factor; BLAME, B lymphocyte activator macrophage expressed; rm, recombinant mouse; GFP, green fluorescent protein. ![]()
Received for publication November 6, 2000. Accepted for publication February 21, 2001.
| References |
|---|
|
|
|---|
dependence of the CD2 pathway of activation in T lymphocytes and natural killer cells. Proc. Natl. Acad. Sci. USA 89:1492.
. J. Exp. Med. 184:695.
. II. Functional analysis. Blood 90:1458.
. J. Exp. Med. 179:1109.This article has been cited by other articles:
![]() |
Q. Yan, V. N. Malashkevich, A. Fedorov, E. Fedorov, E. Cao, J. W. Lary, J. L. Cole, S. G. Nathenson, and S. C. Almo Structure of CD84 provides insight into SLAM family function PNAS, June 19, 2007; 104(25): 10583 - 10588. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R Blazar and W. J Murphy Bone marrow transplantation and approaches to avoid graft-versus-host disease (GVHD) Phil Trans R Soc B, September 29, 2005; 360(1461): 1747 - 1767. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dorsch, Y. Qiu, D. Soler, N. Frank, T. Duong, A. Goodearl, S. O'Neil, J. Lora, and C. C. Fraser PK1/EG-VEGF induces monocyte differentiation and activation J. Leukoc. Biol., August 1, 2005; 78(2): 426 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Monti, K. J. Savage, J. L. Kutok, F. Feuerhake, P. Kurtin, M. Mihm, B. Wu, L. Pasqualucci, D. Neuberg, R. C. T. Aguiar, et al. Molecular profiling of diffuse large B-cell lymphoma identifies robust subtypes including one characterized by host inflammatory response Blood, March 1, 2005; 105(5): 1851 - 1861. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Mooney, J. Klem, C. Wulfing, L. A. Mijares, P. L. Schwartzberg, M. Bennett, and J. D. Schatzle The Murine NK Receptor 2B4 (CD244) Exhibits Inhibitory Function Independent of Signaling Lymphocytic Activation Molecule-Associated Protein Expression J. Immunol., September 15, 2004; 173(6): 3953 - 3961. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Tangye, K. E. Nichols, N. J. Hare, and B. C. M. van de Weerdt Functional Requirements for Interactions Between CD84 and Src Homology 2 Domain-Containing Proteins and Their Contribution to Human T Cell Activation J. Immunol., September 1, 2003; 171(5): 2485 - 2495. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dorsch, G. Zheng, D. Yowe, P. Rao, Y. Wang, Q. Shen, C. Murphy, X. Xiong, Q. Shi, J.-C. Gutierrez-Ramos, et al. Ectopic expression of Delta4 impairs hematopoietic development and leads to lymphoproliferative disease Blood, August 28, 2002; 100(6): 2046 - 2055. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bouchon, M. Cella, H. L. Grierson, J. I. Cohen, and M. Colonna Cutting Edge: Activation of NK Cell-Mediated Cytotoxicity by a SAP-Independent Receptor of the CD2 Family J. Immunol., November 15, 2001; 167(10): 5517 - 5521. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |